Evaluation of IL-17F A7488G polymorphism in Helicobacter pylori-infected patients: a case–control study

Objective:

Interleukin 17 (IL-17) plays an important role in the inflammation of the gastric mucosa and, in severe cases, the development of gastric cancer. Thus, the authors aimed to evaluate the IL-17F A7488G polymorphism in Helicobacter pylori (H. pylori) patients.

Patients and methods:

A total of 86 adults (in two H. pylori-positive and H. pylori-negative groups) were included in the study. To identify the infection, rapid urease test and polymerase chain reaction (PCR) were performed. The cagA gene was also evaluated as a bacterial virulence factor. PCR–restriction fragment length polymorphism was used to investigate the IL-17F A7488G polymorphism in gastric biopsies using the NlaIII enzyme.

Results:

96.5% of patients in both groups did not show any mutation and had AA genotype, and only three patients infected with cagA-carrying H. pylori strains had polymorphism in the IL-17F A7488G gene, which included AG (one case) and GG (two cases) patterns. No significant relationship was found between these polymorphisms in the two groups of H. pylori-positive and H. pylori-negative patients, while, interestingly, a significant difference was observed between the polymorphisms and the presence of the cagA gene.

Conclusion:

This report is one of the first to demonstrate the association of IL-17F A7488G polymorphism with H. pylori infection and the presence of the cagA gene. Although no significant association between IL-17F polymorphism and H. pylori infection was found in the population of this study, the patients with mutated genotypes were positive for the cagA gene, which was statistically significant. Therefore, the possibility of the role of pathogenic strains in causing mutations in cytokine genes is more conceivable.

Introduction

Highlights

• This study provides the first data on IL-17F A7488G gene polymorphisms among individuals with Helicobacter pylori infection in Qom.

• This study is the first study on interleukin 17 polymorphism and cagA.

Helicobacter pylori (H. pylori) is a gram-negative bacterial pathogen that colonizes the gastric epithelium and was identified by Warren and Marshall in 1983¹. This bacterium is the most common cause of chronic infection in humans worldwide and is usually seen in all age groups². The prevalence of infection caused by this bacterium is different in each country and population and is directly associated with the people’s social and economic status³. Most people colonized with H. pylori have no specific symptoms, while in some cases it can cause various clinical complications from gastritis, gastric atrophy, peptic and duodenal ulcers to finally mucosa-associated lymphoid tissue (MALT) lymphoma and gastric cancer^4,5. Reports have indicated that less than 3% of patients develop gastric adenocarcinoma and less than 0.1% develop MALT lymphoma⁶.

H. pylori infection and the progression of related diseases are influenced by the heterogeneity of bacterial virulence genes, host genetic susceptibility to infection, regulation of host/pathogen genes expression, and environmental factors⁷. Among H. pylori virulence factors, cytotoxin-associated gene A protein (CagA) is well known, and its gene encoding is in a gene region called cagPAI (cag pathogenicity island). This protein plays an important role in pathogenesis, especially in the development of gastric cancer⁸.

Chronic H. pylori infection can induce innate and acquired immune responses and the overexpression of pro-inflammatory cytokines such as interleukins (ILs), tumor necrosis factor-alpha (TNF-α), and interferons (IFNs), which ultimately leads to gastritis, etc.⁹. Among cytokines, interleukin 17 (IL-17), as a pro-inflammatory cytokine, is a homodimeric glycoprotein consisting of 155 amino acids with a molecular weight of 35 kDa produced by a broad spectrum of cell populations, including T helper 17, γδT, NKT cells, etc.^10,11. This cytokine is a primary factor in inflammatory responses that induce the expression of IL-6, IL-8, and granulocyte-macrophage colony-stimulating factor (GM-CSF), resulting in inflammation¹¹. IL-17 family includes isoforms A to F, where IL-17A and IL-17F are located on chromosome 6 (6p12)¹². Reports have shown that T helper 17 cells and IL-17 are involved in many disorders, including rheumatoid arthritis, psoriasis, multiple sclerosis, inflammatory bowel diseases, lupus erythematosus, etc.^11,13,14.

Cytokine gene polymorphisms are usually associated with host susceptibility to varying diseases^15,16. Numerous studies have shown that polymorphisms in pro-inflammatory or anti-inflammatory cytokine genes, including IL-1β, IFN-γ, IL-17, IL-6, and IL-10, are associated with a higher risk of active gastritis and stomach cancer^17–19. Among these, polymorphisms in IL-17A and IL-17F genes increased the risk of gastrointestinal diseases, especially in cancers^20–22. However, limited data are available on these polymorphisms and H. pylori infection in the world as well as in Iran. Therefore, the aim of this study was to investigate the association of IL-17F A7488G (His161Arg, rs763780) polymorphism with H. pylori infection and the presence of the cagA virulence gene in Qom, Iran, for the first time.

Material and methods

Patients

This case–control study was conducted for 12 months (2020–2021) on patients referred to the endoscopy department of Shahid-Beheshti Hospital in Qom. In fact, the patients included in the study were those who were recommended to perform endoscopy in their treatment process based on the decision of the gastroenterologist. Therefore, no additional endoscopy was performed for the patients.

Based on the researcher’s estimates and considering the percentage of polymorphism in two groups equal to 18% and 1% and using the percentage comparison formula, the sample size of 86 people (43 in each group) was calculated. Sampling continued until reaching 43 people in both groups. The case group consisted of patients who were positive for H. pylori infection, and the control group was those who were not infected. The main inclusion criteria were patient satisfaction and no history of using anti-H. pylori drug regimens during the past 3 weeks prior to sampling.

Sampling

After recording informed written consent, demographic information, and clinical symptoms of the patients, the endoscopy was performed by a gastroenterologist. One biopsy sample was taken from the incisura angularis of each patient and endoscopic findings were also recorded. The sample was divided into two parts: one for initial infection screening using rapid urease test (RUT) and the other for molecular evaluations using polymerase chain reaction (PCR) for 16S rRNA, cagA, and IL-17F genes. The last sample was kept in a sterile physiological buffer at −20°C until genome extraction.

DNA extraction and PCRs

Total DNA was extracted from biopsy specimens using FavorPrep Tissue Genomic DNA Extraction Mini Kit (Favorgen Biotech, Ping-Tung, Taiwan) according to the manufacturer’s instructions. For a definitive diagnosis of H. pylori infection, a fragment of the 16S rRNA gene was evaluated using PCR. Next, all positive samples containing the 16S rRNA gene were analyzed for the presence of the cagA virulence gene. The final PCR test was carried out to amplify the IL-17F gene.

PCRs were performed in a final volume of 25 μl, containing 10 μl of 2× Master Mix (Ampliqon, Denmark), 1 μl of each primer (10 pmol/μl) listed in Table 1 (Metabion, Germany), 5 μl of the extracted genome, and 8 μl of sterile distilled water. The PCR temperature cycling conditions were as follows: initial denaturation (95°C/5 min for one cycle), and then denaturation (94°C/30 s), annealing (54°C/60 s for 16S rRNA, cagA, and IL-17F genes), extension (72°C/30 s) was performed in 33 cycles, and then 72°C for 10 min in a thermocycler (Eppendorf, Hamburg, Germany). Finally, the PCR products were examined on 1% agarose gel.

Table 1.

Primers used in this study.

Target gene	Sequence (5ʹ→3ʹ)	Size of products (bp)	Reference
16S rRNA	F: CTGGAGAGACTAAGCCCTCC R: ATTACTGACGCTGATTGTGC	110	23
cagA	F: CGGTATCAGTGGCTAAAGC R: AGCAACTTGAGCGTAAATG	377	24
IL-17F	F: ACCAAGGCTGCTCTGTTTCT R: GGTAAGGAGTGGCATTTCTA	143	25

IL-17F A7488G genotyping by PCR–restriction fragment length polymorphism (PCR-RFLP).

IL-17F A7488G genotyping by PCR–restriction fragment length polymorphism (PCR–RFLP)

Ten microliters of the IL-17F PCR product was digested with 1 μl of NlaIII restriction enzyme (Thermo Scientific, USA) for 5 h at 37°C in the buffer recommended by the supplier and visualized after separation by electrophoresis on 3% agarose gel. One to three patterns are expected to be observed after digestion by NlaIII enzyme and electrophoresis: one fragment of 143 bp (lacking the digestion site, GG genotype); two fragments of 80 and 63 bp (AA genotype); or three fragments of 143, 80, and 63 bp in length (AG genotype)²⁶.

Statistical analysis

The relationship between infection, polymorphism, age, gender, and other variables in both groups was calculated by Fisher’s exact test, χ ² test (with exact method), and independent t-test. Statistical analysis was performed using the statistical program SPSS version 22 (IBM, New York, USA). A P-value of less than 0.05 was considered statistically significant.

Results

Of the 86 patients participating in this study, 49 (57.0%) and 37 (43.0%) were male and female, respectively, with a mean±SD age of 47.10±16.83 years. Also, the mean±SD of height and weight was 167.50±9.76 cm and 72.52±18.03 kg, respectively. 16S rRNA PCR results confirmed that all 43 RUT-positive samples had H. pylori infection and no positive cases were observed in patients with negative urease tests. The positive infection rate in men was significantly higher than in women (69.8% vs. 30.2%). Except for gender (P-value=0.017), there was no significant difference between age, height, weight, etc., and H. pylori infection. More information about patients is presented in Table 2.

Table 2.

Comparison of demographic variables between two groups of patients.

	Groups
Variables	Total	Case	Control	P
Gender, N (%)
Male	49 (57.0)	30 (69.8)	19 (44.2)	0.017
Female	37 (43.0)	13 (30.2)	24 (55.8)
Age (M±SD), year	47.10±16.83	45.12±14.88	49.09±18.55	0.276
Height (M±SD), cm	167.50±9.76	165.91±9.73	169.09±9.65	0.131
Weight (M±SD), kg	72.52±18.03	70.42±14.76	74.63±20.77	0.282
BMI (M±SD), kg/m2	25.76±5.6	25.46±4.31	26.07±6.70	0.621
Smoking, N (%)	5 (5.81)	3 (7.0)	2 (4.7)	0.50
Education level, N (%)
Less than Diploma	60 (69.8)	28 (65.1)	32 (74.4)	0.515
Diploma	17 (19.8)	9 (20.9)	8 (18.6)
Bachelor and higher	9 (10.5)	6 (14.0)	3 (7.0)

BMI, body mass index; M±SD, mean±standard deviation; N, number.

Based on the recorded findings of all patients, the most clinical symptom was abdominal pain (61.6%), and the least was diarrhea (3.5%). The highest number of endoscopic findings was also duodenal ulcer (23.3%), and the lowest were gastric cancer (1.2%) and hiatal gastric hernia (1.2%).

In the H. pylori-positive group, the highest and lowest clinical symptoms were related to abdominal pain (74.4%) and diarrhea (2.3%), while the highest and lowest endoscopic findings were correlated with duodenal ulcer (27.9%) and cancer (0.0%), respectively. No significant correlation was observed between clinical symptoms/endoscopic findings in both H. pylori-positive and H. pylori-negative groups, except for abdominal pain. Moreover, the results of the frequency of the cagA gene in H. pylori-infected patients showed that 13 of 43 cases (30.2%) were positive. There was no significant difference between clinical symptoms/endoscopic findings and the presence of the cagA gene (Table 3).

Table 3.

Comparison between clinical symptoms and endoscopic findings in two groups of patients and their relationship with the presence of the cagA gene.

	Groups
		H. pylori			cagA
Variables	Total, N (%)	Positive (N=43), N (%)	Negative (N=43), N (%)	P	Positive (N=13), N (%)	Negative (N=30), N (%)	P
Clinical symptoms
Abdominal pain	53 (61.6)	32 (74.4)	21 (48.8)	0.015	12 (92.3)	20 (66.7)	0.077
Weight loss	24 (27.9)	13 (30.2)	11 (25.6)	0.631	2 (15.4)	11 (36.7)	0.163
Heartburn	21 (24.4)	10 (23.3)	11 (25.6)	0.802	3 (23.1)	7 (23.33)	0.985
Decreased appetite	21 (24.4)	14 (32.6)	7 (16.3)	0.079	2 (15.4)	12 (40.0)	0.114
Nausea	39 (45.3)	19 (44.2)	20 (46.5)	0.829	5 (38.5)	14 (46.7)	0.619
Diarrhea	3 (3.5)	1 (2.3)	2 (4.7)	0.557	0 (0.0)	1 (3.3)	0.505
Bloating	13 (15.1)	7 (16.3)	6 (14.0)	0.763	1 (7.7)	6 (20.0)	0.315
Endoscopic findings
Duodenal ulcer	20 (23.3)	12 (27.9)	8 (18.6)	0.307	6 (46.1)	6 (20.0)	0.079
Gastritis	12 (14.0)	3(7.0)	9 (20.9)	0.062	0 (0.0)	3 (10.0)	0.237
Gastroesophageal reflux	3 (3.5)	1 (2.3)	2 (4.7)	0.557	1 (7.7)	0 (0.0)	0.124
Gastric ulcer	4 (4.7)	1 (2.3)	3 (7.0)	0.306	0 (0.0)	1(3.3)	0.505
Hiatal gastric hernia	1 (1.2)	1 (2.3)	0 (0.0)	0.314	1 (7.7)	0 (0.0)	0.124
Gastric cancer	1 (1.2)	0 (0.0)	1 (2.3)	0.314	0 (0.0)	0 (0.0)	–

Based on IL-17 enzymatic digestion on 86 samples and the pattern of fragments observed on electrophoresis (Fig. 1), our results showed that 83 samples (96.5%) had AA genotype, two patients had GG genotype, and one case had AG genotype. No significant relationship was found between polymorphisms in the two groups of H. pylori-positive and H. pylori-negative patients. All three patients with AG and GG patterns belonged to the case group and were positive for the cagA gene. Interestingly, a significant difference was observed between the IL-17F polymorphism and the presence of the cagA gene (P=0.003) (Table 4). Also, more information about the three patients is provided in Table 5.

Figure 1.

PCR–RFLP electrophoresis gel. M: 100 bp marker; lane 1: PCR product of IL-17 (positive control, without enzymatic digestion); lane 2: GG pattern; lanes 3 and 4: AA pattern; lane 5: AG pattern; lane 6: negative control. PCR, polymerase chain reaction; RFLP, restriction fragment length polymorphism.

Table 4.

Comparison between IL-17F polymorphisms according to the Helicobacter pylori infection and presence of the cagA gene.

	Groups
	H. pylori			cagA
Genotypes	Positive (N=43)	Negative (N=43)	P	Positive (N=13)	Negative (N=30)	P
AA, N (%)	40 (93.0)	43 (100.0)	0.241	10 (76.9)	30 (100.0)	0.003
AG, N (%)	1 (2.3)	0 (0.0)		1 (7.7)	0 (0.0)
GG, N (%)	2 (4.7)	0 (0.0)		2 (15.4)	0 (0.0)

Table 5.

Information of three patients with IL-17F polymorphisms.

Patients	Polymorphism	Age (year)	Gender	Clinical symptoms/endoscopic findings
Case 1	AG	38	Female	Abdominal pain, heartburn
Case 2	GG	44	Male	Duodenal ulcer
Case 3	GG	37	Male	Duodenal ulcer, decreased appetite

Discussion

H. pylori is one of the most important causes of gastric diseases worldwide³. In studies conducted in Iran, the prevalence of this infection varies between 36 and 90% in different geographical areas²⁷. Most infections caused by this bacterium are asymptomatic and can persist for a long time, causing inflammation of the stomach and inducing gastritis, gastric cancer, etc.⁶. Usually, bacterial pathogens alone cannot play a full role in disease progression, and therefore other factors, including host factors, especially those that regulate immune and inflammatory responses, also play an important role in this process²⁸. In order to increase knowledge in this field of study, it seems that it is important to evaluate infections and bacterial genetic traits along with host factors among different populations. Thus, this study was conducted to investigate the IL-17F polymorphism for the first time in H. pylori-positive patients in Qom at the same time as evaluating one of the bacterial virulence factors.

Various methods are used to diagnose H. pylori infection, including culture, serological methods, molecular assays, urease tests, etc., among which molecular techniques are more sensitive^29,30. In this study, 16S rRNA gene was used to confirm the infection, the results of which were similar to the RUT and there were no false positives or negatives. Lu et al.’s study compared five molecular PCR assays using 16S rRNA gene, random chromosome sequence, 26-kDa Helicobacter species-specific antigen gene, and ureA and ureC genes (urease A and C) to detect H. pylori in gastric tissue. Their results showed that 16S rRNA and ureC genes could detect 100% of the H. pylori-positive cases with high sensitivity³¹.

The mean age of patients in the H. pylori-positive group was 45.12 years, which showed a lower rate than the H. pylori-negative group. Moreover, there was no statistically significant difference between the H. pylori-positive and H. pylori-negative patients in terms of age, which is consistent with Bazin’s study in France³². Some other studies also show the prevalence of H. pylori infection depending on age in different countries. For example, a study by Venerando et al.³³ in Brazil showed that patients under 10 years of age are 1.3 times more susceptible to H. pylori infection. Another study by Mori et al.³⁴ in Malaysia reported that the highest infection rate was in patients aged 30–39 years.

Our results showed that BMI has no significant relationship with H. pylori infection, which is consistent or contradictory with some other studies. For example, in a study by Xu et al.³⁵ among the Chinese population, BMI was significantly associated with H. pylori infection, while Kyriazanos et al.³⁶ in Greece showed that the presence of obesity was not related to the status of H. pylori positivity. Also, the smoking status among our patients in both groups had no significant relationship, which is consistent with the study of Khalifa et al.³⁷.

In addition, our findings showed that the most clinical symptoms in H. pylori-infected patients were abdominal pain. Lubetzky et al.³⁸ also stated that abdominal pain was the main manifestation in patients infected with this bacterium. Furthermore, in our case group, the most common endoscopic results were duodenal ulcers, which is in agreement with other studies. In the Otero Regino et al.³⁹ study in Colombia, 76 of 104 patients (73%) with duodenal ulcers were positive for H. pylori.

Except for abdominal pain, our results showed no significant difference between the two groups of patients in terms of other clinical symptoms as well as endoscopic findings. Various studies have shown that these symptoms and findings may have etiological factors other than H. pylori infection. For example, the cause of gastritis and peptic ulcer disease in H. pylori-negative patients may be due to smoking, stress, alcohol consumption, viral infections, and/or the use of non-steroidal anti-inflammatory drugs (NSAIDs) or steroids, etc.^40–42. In another study, obesity was associated with a statistically significant increase in the risk of gastroesophageal reflux disease symptoms⁴³.

Evaluation of the cagA gene in the positive samples of H. pylori revealed that 30.2% of strains carried this gene. This finding shows a lower prevalence of this gene compared to other studies. In a study in Iran, the prevalence of the cagA gene among gastroesophageal reflux disease patients was 44.4%⁴⁴. In Saudi Arabia, 49.2% of H. pylori-positive cases were also positive for cagA ⁴⁵. In addition, a higher prevalence of this gene has been reported in some studies in China, one of which showed that 85.3% of H. pylori strains contained the cagA gene⁴⁶, while the other stated 96.2 and 97.4% positive cases from the antrum and corpus samples, respectively⁴⁷. Overall, these findings show that the presence of this gene is completely different in different geographical areas.

According to PCR–RFLP results, 83 of the patients in both groups did not show any mutation and had wild AA genotype, and three cases had AG and GG mutant genotypes. No significant relationship was observed between both groups and the IL-17F gene polymorphism. There are different published results in this field. Arisawa et al. reported genetic polymorphisms in Japanese subjects with functional dyspepsia. They indicated a significant association between IL-17F polymorphism and the development of functional dyspepsia, especially epigastric pain syndrome, among H. pylori-positive patients⁴⁸. Similar to our study, Ghorbani et al.⁴⁹ in Sari, northern Iran, found no association between the IL-17F A7488G polymorphism and stages/grades of gastric cancer and H. pylori infection. In another study conducted in Shahrekord, near the southwest of Iran, Shirzad et al.⁵⁰ also reported that there was no change in the mucosal pattern of IL-17F A7488G in subjects with H. pylori-associated gastritis. Compared with these reports, our study was performed on gastric tissue samples from H. pylori patients with a wider range of clinical symptoms and endoscopic findings, which seems to be superior to theirs.

Furthermore, in the current study, IL-17F A7488G polymorphisms with a virulence factor of H. pylori were evaluated for the first time. Our results showed that three patients with AG and GG mutations were also positive for the cagA gene, and there was a significant relationship between the polymorphism of the cytokine and the presence of this gene. In the study of Mizuno et al., IL-17 secretion and IL-17 mRNA expression in H. pylori-infected gastric mucosa were investigated. Their results showed that all H. pylori strains had cagA and vacA virulence genes and suggested that IL-17 may play an important role in the inflammatory response to bacterial colonization, which may ultimately affect the outcome of H. pylori-related diseases⁵¹.

Conclusions

This study is one of the first to demonstrate IL-17F A7488G polymorphism among subjects with H. pylori infection and the presence of the cagA virulence gene. The findings show no significant association between IL-17F polymorphism and H. pylori positivity among our patients. All three patients with AG and GG mutant genotypes were positive for the cagA virulence gene, thus it could prove a stronger relationship between pathogenic strains and cytokine polymorphism. However, due to the small number of patients with IL-17F polymorphism, statistical inference in this regard may be associated with relatively low accuracy. Therefore, it is recommended to conduct future studies with a larger sample size. In addition, the relationship between H. pylori treatment outcomes and cytokine polymorphisms is an interesting topic that is suggested to be investigated in future studies.

Limitations

Due to financial constraints, it was not possible to study more pathogenic genes of the target bacteria as well as other polymorphisms of IL-17. Unfortunately, most of our patients had no information about taking NSAIDs or steroids. Therefore, incomplete information about these cases is not given in our results.

Ethical approval

The study was reviewed and approved by the Medical Ethics Committees of Islamic Azad University, Qom Branch, and Qom University of Medical Sciences (code: IR.IAU.Qom.REC.1397.006).

Consent

This study is not a case report.

Sources of funding

Not applicable.

Author contribution

A.H. and S.S.: developed and supervised the work; F.S.M.R.: performed the experiments; S.S. and M.A.: drafted the manuscript; A.H., S.S., and M.A.: contributed to data interpretation. All authors reviewed the manuscript. All authors read and approved the final manuscript.

Conflicts of interest disclosure

The authors declare that there are no conflicts of interest.

Research registration unique identifying number (UIN)

1. Name of the registry: not applicable.

2. Unique identifying number or registration ID: 8807.

3. Hyperlink to your specific registration (must be publicly accessible and will be checked):not applicable.

Guarantor

Saeed Shams.

Data availability statement

I confirm if any datasets generated during and/or analyzed during the current study are publicly available, available upon reasonable request.

Provenance and peer review

Not commissioned, externally peer-reviewed.