Skip to main content
NCBI home page
Iranian Journal of Veterinary Research logoLink to Iranian Journal of Veterinary Research
. 2023;24(1):22–29. doi: 10.22099/IJVR.2022.43280.6301

Characterization of extended spectrum β-lactamase producing Escherichia coli strains isolated from urogenital system of dogs in Van province of Turkey

B Kaplan 1, O Gulaydin 2,*
PMCID: PMC10291521  PMID: 37378384

Abstract

Background:

Escherichia coli is a bacterial agent that causes urogenital system infection in dogs. Beta-lactam (β-lactam) group antibiotics are frequently used in the treatment of E. coli infections.

Aims:

This study aimed to investigate the presence of extended-spectrum β-lactamase (ESBL) and plasmidic AmpC in E. coli strains isolated from the urogenital tracts of 125 dogs.

Methods:

Fifty E. coli strains were identified by conventional bacteriological and PCR methods. Disk diffusion method was used for the determination of antimicrobial susceptibility of the isolates as well as productions of plasmidic AmpC and ESBL. The presence of blaTEM, blaSHV, and blaCTX-M group genes was determined in the isolates by PCR. ERIC-PCR was also used for genotyping of the isolates.

Results:

Although 22 (44%) of 50 E. coli isolates were found to be ESBL positive, no isolate shows plasmidic AmpC β-lactamase production. Among 22 ESBL positive isolates, blaTEM, blaSHV, and blaCTX-M group 1 genes were found in 11 (50%), 1 (4.54%), and 6 (27.27%) isolates, respectively. The highest resistance was observed against tetracycline (28%), followed by streptomycin (24%), trimethoprim-sulfamethoxazole (24%), and chloramphenicol (22%), respectively. In the isolates, 11 different main profiles were also determined by ERIC-PCR. It was shown that ESBL positive isolates were related to G10 profiles.

Conclusion:

The use of extended spectrum β-lactam group antibiotics for the treatment of E. coli infections in dogs is critical; nevertheless, they may not be effective due to the high rate of resistance to this antibiotic group in E. coli.

Key Words: AmpC, Dog, E. coli, ERIC-PCR, ESBL

Introduction

Beta lactam group antibiotics inhibit the activity of transpeptidase and carboxypeptidase enzymes which are involved in peptidoglycan synthesis (Essack, 2001). Beta lactamase enzymes disrupt the amide bonds in the β-lactam ring of these substances. These enzymes were first identified in Escherichia coli in the 1940s (Gür, 1997). The most important mechanism for β-lactam resistance in Gram-negative bacteria, especially in the members of Enterobacteriaceae, is the production of β-lactamases (Pool, 2004).

Extended spectrum beta-lactamases (ESBL) can inhibit the effect of penicillin, the first three generations of cephalosporins, monobactam, aztreonam, and partially cefepimes. On the other hand carbapenem, cephamycin, and β-lactamase inhibitors can block the effect of these enzymes (Sader et al., 2007). Generally, ESBLs are originated from TEM, SHV, and OXA enzymes (Bush et al., 1995). On the other hand, CTX-M group of ESBL can hydrolyze cefotaxime (Oliver et al., 2001), and unlike TEM and SHV groups of ESBL, the CTX-M genes are spread by horizontal gene transfer among bacteria via plasmids (Livermore, 2007). ESBLs are reported to be extensively present in E. coli and Klebsiella pneumoniae isolates (Mulvey et al., 2004).

AmpC β-lactamases are active against penicillins, but more active against cephalosporins (Galleni et al., 1988). The members of Enterobacteriaceae can produce AmpC β-lactamases. These enzymes can make the isolates to be resistant to cephalothin, cefazolin, cefoxitin, most of the penicillin, and β-lactam combinations (Jacoby, 2009).

E. coli, which is classified in the Enterobacteriaceae family, is an opportunistic pathogen that can be found in the natural flora of the gastrointestinal tract of humans and animals (Kaper et al., 2004). While it causes many diseases in human such as enteritis, urinary tract infection, meningitis, septicemia, community and hospital acquired pneumonia (Vila et al., 2016), it is frequently isolated from the infected urinary tract and pyometra cases of cats and dogs (Fransson et al., 1997; Hagman and Greko, 2005; Windahl et al., 2014; Moyaert et al., 2017; Yu et al., 2020).

Since they cause hospital infections, and treatment options are limited, there are many studies conducted on the isolation and the identification of extended-spectrum β-lactam resistant members of Enterobacteriaceae. Because β-lactam group antibiotics are also frequently used in veterinary medicine, it is important to monitor frequently the resistance profile against these antimicrobials in the strains isolated from animals to acquire up-to-date data (Li et al., 2007).

Although the prevalence of ESBL positive E. coli isolated from various samples of dogs was revealed different rates in different geographical regions (Carattoli et al., 2005; Huber et al., 2013; Aslantas et al., 2017; Gumus et al., 2017; Zogg et al., 2018; Paredes et al., 2019), it had been reported that the prevalence of plasmidic AmpC β-lactamase producing isolates was generally low (Aslantaş and Yılmaz, 2017; Gumus et al., 2017; Shimizu et al., 2017; Paredes et al., 2019). In these studies, it was reported that TEM and CTX-M group 1 genes were found at a higher rate than SHV genes in E. coli isolates.

In this study, the presence of ESBL and plasmid-derived AmpC β-lactamase in E. coli strains isolated from the urogenital system of dogs and the susceptibility of these isolates to various antimicrobial agents were investigated.

Materials and Methods

Ethics approval

This study has been approved ethically by Van Yuzuncu Yil University Animal Researches Ethic Committee with the number of 2020/12-11.

Sampling

In this study, urine and/or vaginal swab samples were collected from 125 dogs of different ages and genders, housed in Van/Turkey Metropolitan Municipality Animal Care and Rehabilitation Center between December 2020 and June 2021. A total of 195 clinical samples including urine samples (taken to sterile tubes during physiological urination) from 44 dogs (35.2%), vaginal swab samples from 11 dogs (8.8%), and both urine and vaginal swab samples from 70 dogs (56%) were analyzed.

E. coli isolation

Urine samples were centrifuged at 5000 ×g for 10 min, and the sediment was diluted with 1 ml of physiological saline (FTS). Also, vaginal swabs were transferred to plastic tubes containing 3 ml sterile FTS, and the suspension was centrifuged at 3000 ×g for 10 min. The final sediment was resuspended in 1 ml sterile FTS. Then, 0.1 ml of urine and vaginal swab samples suspension were spread onto 5-7% sheep blood agar base (Oxoid, CM 03331, England), MacConkey agar (MCA) (Merck, 1.05465, Germany), and Eosin Methylene Blue (EMB) agar (Merck, 1.01347, Germany), and incubated at 37°C for 24 h. At the end of the incubation period, the colonies approximately 2 mm in diameter, gray colored, smooth, rounded or mucoid, hemolytic or non-hemolytic on blood agar, pink colored on MCA, and Gram-negative oxidase-negative with metallic shine on EMB were considered as E. coli (Papini et al., 2006; Quinn et al., 2011). A PCR test was used to confirm the identity of suspected colonies.

E. coli identification PCR

The genomic DNA was obtained by boiling method (Pehlivanoglu et al., 2016). The specific primers (Table 1) were used for the identification of E. coli isolates (Wang et al., 2002). The PCR mix consisted of 1 µL of each primer (10 µM), 5 µL of genomic DNA, and 10 µL of A.B.TTM 2X PCR master mix (Turkey). The total volume was completed to 25 µL with nuclease-free water (BP2819, Thermo Fisher Scientific, USA). The mixture was kept at 95°C for 10 min for preliminary denaturation. A total of 35 amplification cycles were performed containing denaturation at 95°C for 1 min, annealing at 56°C for 1 min, and elongation at 72°C for 1 min. Final elongation was applied at 72°C for 10 min. E. coli ATCC® 25922 reference strain was used as positive control and nuclease-free water was used as no template control (NTC). The amplicons were electrophoresed on 1.5% agarose gel containing gel-red stain at 80 V for 2 h and were examined in a UV transilluminator.

Table 1.

Primer sequences used to identify the E. coli isolates and to determine genes associated with ESBL

Genes Primer sequences (5´-3´) Amplicon size (bp) Reference
E. coli
16S rRNA F: CCCCCTGGACGAAGACTGAC
R: ACCGCTGGCAACAAAGGATA		 401 Wang et al. (2002)
ESBL
blaTEM F: ATAAAATTCTTGAAGACGAAA
R: GACAGTTACCAATGCTTAATCA		 1079 Kapoda et al. (2018)
blaSHV F: ATTTGTCGCTTCTTTACTCGC
R: TTTATGGCGTTACCTTTGACC		 1051 Kapoda et al. (2018)
blaCTX-M group 1 F: GGTTAAAAAATCACTGCGTC
R: TTGGTGACGATTTTAGCCGC		 863 Kapoda et al. (2018)
Open in a new tab

Phenotypic determination of the extended spectrum β-lactamase

The presence of ESBL in E. coli isolates was determined according to the criteria reported in Clinical and Laboratory Standards Institute (CLSI) (2018). For this purpose, the susceptibility of isolates to cefpodoxime (CPD, 10 µg, Himedia), ceftazidime (CAZ, 30 µg, Himedia), aztreonam (AT, 30 µg, Himedia), cefotaxime (CTX, 30 µg, Himedia), and ceftriaxone (CI, 30 µg, Himedia) antibiotic disks were determined by disk diffusion method. Resistance of E. coli isolates (according to the cut-off inhibition diameter) to at least one of the following antibiotics was defined as possible ESBL production; cefpodoxime (≤17 mm), ceftazidime (≤22 mm), aztreonam (≤27 mm), cefotaxime (≤27 mm), and ceftriaxone (≤25 mm). A combined disk method was used for the phenotypic confirmation of positive ESBL isolates. For this purpose, the susceptibility of isolates to antibiotic disk combinations of ceftazidime-clavulanate (CAC, 30/10 µg, Himedia) and cefotaxime-clavulanate (CEC, 30/10 µg, Himedia) was determined by disk diffusion test method and a difference of ≥5 mm between the zone diameters of with and without clavulanate was considered ESBL positive. The inhibition zone of the disk with clavulanate should be larger than the zone of a disk without clavulanate.

Phenotypic determination of plasmidic AmpC β-lactamase

The isolates were considered as plasmidic AmpC β-lactamase producers if the inhibition zone diameter of cefoxitin (CX, 30 µg, Himedia) was found to be <19 mm in E. coli isolates by disk diffusion test method (EUCAST, 2019). The combined disk method reported by Tan et al. (2009) was used for the phenotypic confirmation of the presence of plasmidic AmpC β-lactamases. Therefore, the inhibition zone diameters of cefoxitin and cefoxitin-cloxacillin (CXX, 30/200 µg, Himedia) disks in the isolates were examined separately, and a difference of ≥4 mm was considered positive for plasmidic AmpC β-lactamases. The inhibition zone of the disc with cloxacillin should be larger than the zone of a disk without cloxacillin.

Genotypic determination of extended spectrum β-lactamase

For the genotypic determination of ESBL, blaTEM, blaSHV, blaCTX-M group 1 genes were examined by PCR method using specific primers (Table 1). PCR mix was prepared as described in the identification of the E. coli isolates by PCR. The mix was held at 94°C for 10 min for initial denaturation. The amplification process consisted of 35 cycles containing denaturation at 94°C for 1 min, annealing at 52°C, 57°C, and 55°C for blaTEM, blaSHV, and blaCTX-M group 1, respectively, for 1 min and extension at 72°C for 1 min. The final extension was applied at 72°C for 10 min.

Phenotypic determination of antimicrobial susceptibility

The susceptibility of isolates against gentamicin (GEN, 10 µg, Himedia), streptomycin (S, 10 µg, Himedia), piperacillin-tazobactam (PIT, 100/10 µg, Himedia), enrofloxacin (EX, 5 µg, Himedia), ciprofloxacin (CIP, 5 µg, Himedia), trimethoprim-sulfamethoxazole (COT, 1.25/23.7 µg, Himedia), chloramphenicol (C, 30 µg, Himedia), tetracycline (TE, 30 µg, Himedia), ertapenem (ERT, 10 µg, Himedia), and imipenem (IMP, 10 µg, Himedia) was determined by disk diffusion test method according to CLSI (2018) and European Committee on Antimicrobial Susceptibility Testing (EUCAST) (2019) criteria. The isolates were classified as susceptible (S), intermediate (I), and resistant (R) according to inhibition zone diameters. Isolates that showed resistance to at least one or more antibiotics of three different groups were considered as multi-drug resistant (Magiorakos et al., 2012). E. coli ATCC® 25922 reference strain was used as the test control.

Enterobacterial repetitive intergenic consensus (ERIC)-PCR

The genotype profiles of the isolates were determined by ERIC-PCR using 5´-AAG TAA GTG ACT GGG GTG AGC G-3´ ERIC2 primer (Versalovic et al., 1991). ERIC-PCR profiles of the isolates were grouped by using cluster analysis with 80% similarity. PCR mix was prepared as described in the identification of the isolates by PCR. The mixture was kept at 94°C for 10 min for preliminary denaturation. 35 amplification cycles were performed with the protocol of denaturation at 94°C for 1 min, annealing at 62°C for 1 min, and extension at 72°C for 3 min. Final elongation was applied at 72°C for 15 min.

The PCR products were electrophoresed on 1.5% agarose gel (80 V, 180 min) and photographed by a gel documentation system (Gen-Box imagER Fx, ERBiyotek, Turkey). The ERIC-PCR patterns were analyzed using the PyElph software (version 1.4). The clustering was performed by the unweighted pair group algorithm (UPGMA), and the Dice correlation coefficient.

Statistical analysis

The relationship between urinary and vaginal isolates, multiple-drug resistance, and ESBL positivity, and the genotype profiles and ESBL positivity were analyzed by the Z ratio (two-sample proportion test) and Fisher’s Exact test methods using Minitab Statistical Software 20.

Results

E. coli isolation and identification

In this study, 50 E. coli (25.64%) strains were isolated from a total of 195 samples collected from 125 dogs by the bacteriological method. All E. coli isolates were confirmed by PCR. Forty two isolates (84%) were obtained from urine samples and 8 (16%) from vaginal swab samples. When E. coli was isolated from both urine and vaginal swab samples from the same dog, only the isolates obtained from the urine samples were used in the disk diffusion tests.

Phenotypic determination of the extended-spectrum β-lactamase

Twenty nine isolates (58%) were found to be ESBL positive by the disk diffusion method. On the other hand, 22 of 29 isolates (75.86%) were confirmed as ESBL positive by the combined disk method. It was determined that 20 (90.91%) and 2 (9.09%) of the ESBL positive strains were isolated from urine and vaginal swab samples, respectively. It was found that there was not a significant association between ESBL positivity and the sampling site (P=0.439).

Phenotypic determination of the plasmidic AmpC β-lactamase

Plasmid mediated AmpC resistance was not detected in the strains. So, the presence of related genes was not investigated.

Genotypic determination of extended-spectrum β-lactamase

BlaTEM, blaSHV, blaCTX-M group 1 genes were detected in 11 (50%), 1 (4.54%), and 6 (27.27%) ESBL positive isolates, respectively. Both of the blaTEM and blaCTX-M group 1 genes were found only in 5 (22.72%) isolates. In addition, blaTEM, blaSHV, blaCTX-M group 1 genes were found in 10 (50%), 1 (5%), and 5 (25%) ESBL positive isolates obtained from urine samples, respectively. It was also determined that only 1 ESBL positive isolate obtained from vaginal swab samples carried blaTEM, and blaCTX-M group 1 genes.

Phenotypic determination of antimicrobial susceptibility

All isolates in the study were found susceptible to imipenem, whereas it was determined that 1 (2%), 1 (2%), 2 (4%), 4 (8%), 5 (10%), 11 (22%), 12 (24%), 12 (24%), and 14 (28%) isolates were detected to be resistant against ertapenem, piperacillin-tazobactam, gentamicin, enrofloxacin, ciprofloxacin, chloram-phenicol, streptomycin, trimethoprim-sulfamethoxazole, and tetracycline, respectively. When the frequencies of antimicrobial resistance in urinary and vaginal isolates shown in Fig. 1 were compared, a significant statistical relationship was not determined among the isolates (P>0.05).

Fig. 1.

Fig. 1

Open in a new tab

Frequencies of antimicrobial resistance in vaginal and urinary isolates (%). GEN: Gentamicin, S: Streptomicin, EX: Enrofloxacin, CIP: Ciprofloxacin, TE: Tetracycline, C: Chloramphenicol, IMP: Imipenem, ERT: Ertapenem, COT: Trimethoprim-Sulfamethoxazole, and PIT: Piperacillin-Tazobactam

Multi-drug resistance was determined in 12 isolates (24%), and 8 of these isolates (66.66%) were found to be ESBL positive (Table 2). However, 10 out of 12 multi-drug resistant isolates (83.33%) were obtained from urine samples, only 2 isolates from vaginal samples. In the statistical analysis, it was determined that there was no relationship between multi-drug resistance and ESBL positive isolates (P=0.069).

Table 2.

Multiple antibiotic resistance profiles determined in isolates

Resistance profile Number of ESBL (+) isolates (%) (n:22) Number of ESBL (-) isolates (%) (n:28) Total (%) (n:50)
S+TE+C+COT 4 (18.18) 1 (3.57) 5 (10)
S+TE+COT 0 1 (3.57) 1 (2)
S+EX+CIP+TE+C 0 1 (3.57) 1 (2)
GEN+S+EX+CIP+TE+C+COT 1 (4.54) 0 1 (2)
EX+CIP+TE+ETP+COT+PIT 1 (4.54) 0 1 (2)
TE+C+COT 2 (9.09) 1 (3.57) 3 (6)
Total 8 (36.36) 4 (14.28) 12 (24)
Open in a new tab

S: Streptomycin, TE: Tetracycline, C: Chloramphenicol, COT: Trimethoprim-Sulfamethoxazole, EX: Enrofloxacin, CIP: Ciprofloxacin, GEN: Gentamicin, ETP: Ertapenem, and PIT: Piperacillin-Tazobactam

In the statistical analysis, ESBL positivity was found to be significantly related to G10 profiles (P=0.040). In addition, it was found that vaginal isolates (n=8) had G6 (n=2), G7 (n=4), G9 (n=1), and G10 (n=1) profiles (Fig. 2). Statistically significant relationship was not determined between genotype profile and isolation site of the strains (P>0.05).

Genotyping by ERIC-PCR

According to ERIC-PCR results, E. coli isolates were divided into 11 different main groups (G). Seven of these groups included subgroups (Fig. 2). It was determined that 2 (4%), 1 (2%), 7 (14%), 2 (4%), 8 (16%), 12 (24%), 7 (14%), 2 (4%), 1 (2%), 7 (14%), and 1 (2%) of the isolates had G1, G2, G3, G4, G5, G6, G7, G8, G9, G10, and G11 profiles, respectively. ESBL positive isolates were distributed in G1, G3, G5, G6, G7, G8, G10, and G11 profiles with different rates (Fig. 2). It was determined that 2 (9.09%), 3 (13.63%), 2 (9.09%), 5 (22.72%), 2 (9.09%), 1 (4.54%), 6 (27.27%), and 1 (4.54%) of 22 ESBL positive isolates had G1, G3, G5, G6, G7, G8, G10, and G11 profiles, respectively (Fig. 2).

Fig. 2.

Fig. 2

Open in a new tab

Cluster analysis and ERIC-PCR genotypes detected in E. coli isolates (decimal numbers indicates differences (%) between ERIC-PCR genotype profiles). * ESBL positive isolates, v: Vaginal isolates, and G: ERIC-PCR genotype profile

Discussion

Because E. coli is a significant and common pathogen in both humans and animals, the antimicrobial resistance profile of isolates should be monitored continuously to find out the most effective antibiotics against circulating bacteria. Also, dogs are companion animals in close contact with humans. So, the emergence of resistant strains in dogs can adversely affect both animal and human health.

Although there are many studies investigating the presence of ESBL in E. coli isolates in the field of human medicine, there is a limited number of studies on animal isolates. Therefore, in this study, ESBL resistance, which is one of the most important resistance mechanisms (Bradford, 2001; Pool, 2004), was investigated in E. coli strains isolated from dogs.

Huber et al. (2013) reported that ESBL producing E. coli isolates were identified from 7.47% of urine samples of cats and dogs, whereas this rate was determined as 54.68% by Zoogg et al. (2018) in Zurich, Germany. In other studies, it was reported that extended-spectrum β-lactam resistance varied between 42.69%, and 91.30% in E. coli isolates obtained from the rectal swabs, and stool samples of cats, and dogs (Aslantaş and Yılmaz, 2017; Gumus et al., 2017; Paredes et al., 2019). On the other hand, Rzewuska et al. (2015) reported that the ESBL phenotype was detected at a very low rate in the strains which were isolated from nasal, pharyngeal, and ear swab samples of dogs in Poland.

In the present study, extended-spectrum β-lactam resistance was phenotypically determined in 44% of E. coli isolates obtained from urine, and vaginal swab samples of dogs. It was observed that the data were compatible with the results of the study conducted by Aslantaş and Yılmaz (2017). However, it is determined that the results achieved were lower than the results reported by Gumus et al. (2017) and Paredes et al. (2019).

There are few studies that investigated the presence of plasmid related AmpC β-lactamase in E. coli isolates of dogs. In these studies, it was reported that the prevalence of plasmid related AmpC β-lactamase positive E. coli strains isolated from dogs was generally low (Aslantaş and Yılmaz, 2017; Gumus et al., 2017; Shimizu et al., 2017; Paredes et al., 2019). However, Bortolami et al. (2019) reported that 40.85% of E. coli strains obtained from various clinical samples of cats, dogs, and horses were plasmidic AmpC producers. In this study, plasmid related AmpC β-lactamase was not detected in E. coli isolates of dogs.

In various studies, it was concluded that blaTEM group genes were detected with a higher rate (17.07-100%) in ESBL positive E. coli isolates, but blaSHV genes were reported at a lower rate (2.43-35.29%) (Carattoli et al., 2005; Huber et al., 2013; Rzewuska et al., 2015; Aslantaş and Yılmaz, 2017; Gumus et al., 2017; Karkaba et al., 2017; Bortolami et al., 2019; Garcia et al., 2019; Sfaciotte et al., 2021; Shin et al., 2021). In this study, similar to other studies, the blaTEM gene was detected in 11 of 22 ESBL positive isolates (50%), whereas the blaSHV gene positivity was lower (4.54%) than blaTEM gene positivity in the isolates.

It is known that blaCTX-M genes, classified in 1, 2, 8, 9, and 25 groups, unlike TEM and SHV group genes, are transferred among bacteria (Livermore, 2007). In addition, it has been reported that the blaCTX-M-15 gene, which is classified in group 1, has been determined at a higher rate in E. coli isolates in the studies. In various research, it was reported that the presence of blaCTX-M group 1 genes varied between 2.43-100% (Carattoli et al., 2005; Huber et al., 2013; Rzewuska et al., 2015; Aslantaş and Yılmaz, 2017; Gumus et al., 2017; Karkaba et al., 2017; Shimizu et al., 2017; Zogg et al., 2018; Bortolami et al., 2019; Garcia et al., 2019; Sfaciotte et al., 2021; Shin et al., 2021). Similarly, in this study, blaCTX-M group 1 genes were detected in 27.27% of E. coli isolates.

E. coli isolates have resistance mechanisms against β-lactam group antimicrobial substances and these mechanisms are spread by horizontal gene transfer among isolates. Consequently, the use of antimicrobial substances other than the β-lactam group is mandatory for the elimination of these infections (Panos et al., 2006). It is important to follow the resistance profiles of isolates against antimicrobial agents other than penicillin and cephalosporin group antibiotics, which are frequently used in veterinary medicine.

In previous studies, resistance profiles of E. coli strains isolated from pet animals were determined at different rates. In this context, the highest resistance was found against tetracycline (45-100%), which was followed by ciprofloxacin (41-100%), chloramphenicol (22-100%), enrofloxacin (15-100%), trimethoprim+ sulfamethoxazole (24-65%), streptomycin (37-54%), and gentamicin resistance (8-54%), respectively (Carattoli et al., 2005; Maluta et al., 2012; Huber et al., 2013; Aslantaş and Yılmaz, 2017; Shimizu et al., 2017; Qekwana et al., 2018; Zogg et al., 2018; Garcia et al., 2019; Paredes et al., 2019). It was also reported that all E. coli isolates were found to be susceptible to imipenem (Huber et al., 2013; Aslantaş and Yılmaz, 2017; Garcia et al., 2019; Paredes et al., 2019).

In the present study, the resistance rates against gentamicin, streptomycin, enrofloxacin, ciprofloxacin, tetracycline, chloramphenicol, and trimethoprim+ sulfamethoxazole in E. coli strains were determined as 4%, 24%, 8%, 10%, 28%, 22%, and 24%, respectively. Although the resistance rates in this study were found to be lower than those of other studies, the highest resistance was found against tetracycline (28%), which was consistent with the results of other studies. Similar to data reported in the previous studies, no resistance was detected against imipenem in this study. Also, it was determined that the number of resistant strains to ertapenem and piperacillin-tazobactam was limited (2%). These antibiotics are mostly used in the treatment of infections caused by ESBL positive E. coli in human medicine.

The ERIC-PCR provides advantages over PFGE, and MLST methods in the genotyping of E. coli isolates because ERIC-PCR is easier and more economical. However, because of different PCR optimizations, different band profiles may result in different studies with the same primer which means that the reproducibility of ERIC-PCR is more limited than the other genotyping methods (Meacham et al., 2003). In Brazil, Maluta et al. (2012) reported that 5 different genotype profiles were determined in 13 E. coli isolates, which were obtained from urine samples of dogs by ERIC-PCR method. In a similar study, Tramuta et al. (2011) reported that 36 different profiles were determined in isolates in Italy, whereas Bourne et al. (2019) reported that only 6 different ERIC-PCR profiles in E. coli isolates were detected. In another study, 14 ESBL positive E. coli isolated from fecal samples of cats and dogs, and 4 different band profiles were determined by ERIC-PCR method. It was also reported that the genotype profiles of the isolates, which carried the genes associated with ESBL resistance, show different distributions (Moreno et al., 2008). In the present study, 11 different main genotypes were determined in 50 E. coli isolates by ERIC-PCR. It was observed that the distribution of genotype profiles in ESBL positive isolates was at different rates, and only G10 profile was statistically associated with the ESBL positivity.

In this study, it was determined that more attention should be paid to extended-spectrum β-lactam resistance in E. coli strains that were isolated from dogs in close contact with humans in social life. Also, it was concluded that increasing resistance rates against cephalosporin group antibiotics, which are frequently used in the treatment of infections caused by E. coli isolates in both human and veterinary medicine, have critical importance. However, resistance against tetracycline, streptomycin, trimethoprim-sulfamethoxazole, and chloramphenicol should also be considered in E. coli isolates obtained from dogs. It has been concluded that the data obtained from this study would contribute to the control of infections due to E. coli which cause important infections in pet breeding and to the establishment of antimicrobial surveillance programs in the field of veterinary medicine.

Conflict of interest

None of the authors have any potential conflict of interest to declare.

Acknowledgements

This study was summarized from the master thesis of first author and supported by Research Fund of Van Yuzuncu Yil University with the project number of TYL-2021-9400.

References

  1. Aslantaş Ö, Yılmaz EŞ. Prevalence and molecular characterization of extended spectrum β-lactamase (ESBL) and plasmidic AmpC β-lactamase (pAmpC) producing Escherichia coli in dogs. J. Vet. Med. Sci. 2017;79:1024–1030. doi: 10.1292/jvms.16-0432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bortolami A, Zendri F, Maciuca EI, Watrett A, Ellis C, Vanessa S, Pinchbeck G, Timofte D. Diversity, virulence and clinical significance of extended spectrum β-Lactamase and pAmpC producing Escherichia coli from companion animals. Front. Microbiol. 2019;10:1260–1274. doi: 10.3389/fmicb.2019.01260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bourne JA, Chong WL, Gordon DM. Genetic structure, antimicrobial resistance and frequency of human associated Escherichia coli sequence types among faecal isolates from healthy dogs and cats living in Canberra, Australia. PLoS One. 2019;14:e0212867. doi: 10.1371/journal.pone.0212867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bradford PA. Extended spectrum beta-lactamases in the 21st century Characterization, epidemiology and detection of this important resistance threat. Clin. Micr. Rev. 2001;14:933–951. doi: 10.1128/CMR.14.4.933-951.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bush K, Jacoby GA, Medeiros AA. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob. Agents. Chemother. 1995;39:1211–1233. doi: 10.1128/aac.39.6.1211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Carattoli A, Lovari S, Franco A, Cordaro G, Di MP, Battisti A. Extended spectrum β-lactamases in Escherichia coli isolated from dogs and cats in Rome, Italy, from 2001 to 2003. Antimicrob. Agents. Chemother. 2005;49:833–835. doi: 10.1128/AAC.49.2.833-835.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Clinical and Laboratory Standards Institute (CLSI) Performance standards for antimicrobial disk and dilution susceptibility test for bacteria isolated from animals. 4th Edn. Wayne, PA: CLSI Supplement VET08. Clinical and Laboratory Standards Institute; 2018. [Google Scholar]
  8. Essack SY. The development of beta lactam antibiotics in response to the evolution of beta lactamases. Pharm. Res. 2001;18:1391–1399. doi: 10.1023/a:1012272403776. [DOI] [PubMed] [Google Scholar]
  9. Fransson B, Lagerstedt AS, Hellmen E, Jonsson P Bacteriological findings, blood chemistry profile and plasma endotoxin levels in bitches with pyometra or other uterine diseases. Zentralbl. Veterinarmed. 1997;44:417–426. doi: 10.1111/j.1439-0442.1997.tb01127.x. [DOI] [PubMed] [Google Scholar]
  10. Galleni M, Amicosante G, Frere JM. A survey of the kinetic parameters of class C beta-lactamases, cephalosporins and other beta-lactam compounds. Biochem. J. 1988;255:123–129. doi: 10.1042/bj2550123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Garcia BS, Galan F, Rodriguez-Iglesias MA, Perez-Gracia MT. Detection and characterization of extended-spectrum beta-lactamases-producing Escherichia coli in animals. Vector Borne Zoonotic Dis. 2019;19:115–120. doi: 10.1089/vbz.2018.2333. [DOI] [PubMed] [Google Scholar]
  12. Gumus B, Celık B, Kahraman BB, Sıgırcı BD, Ak S. Determination of extended spectrum beta-lactamase (ESBL) and AmpC beta lactamase producing Escherichia coli prevalence in faecal samples of healthy dogs and cats. Revue Med. Vet. 2017;168:46–52. [Google Scholar]
  13. Gür D. Antibiotic resistance mechanisms in Gram-negative bacteria that gain importance in hospital infections. Hastane İnfeksiyonları Dergisi. 1997;1:38–45. [Google Scholar]
  14. Hagman R, Greko C. Antimicrobial resistance in Escherichia coli isolated from bitches with pyometra and from urine samples from other dogs. Vet. Rec. 2005;157:193–197. doi: 10.1136/vr.157.7.193. [DOI] [PubMed] [Google Scholar]
  15. Huber H, Zweifel C, Wittenbrink MM, Stephan R. ESBL-producing uropathogenic Escherichia coli isolated from dogs and cats in Switzerland. Vet. Microbiol. 2013;162:992–996. doi: 10.1016/j.vetmic.2012.10.029. [DOI] [PubMed] [Google Scholar]
  16. Jacoby GA. AmpC beta lactamases. Clin. Microbiol. Rev. 2009;22:161–182. doi: 10.1128/CMR.00036-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2004;2:123–140. doi: 10.1038/nrmicro818. [DOI] [PubMed] [Google Scholar]
  18. Kapoda DS, Ajayi A, Somda M, Traore O, Guessennd N, Ouattara AS, Sangare L, Alfred S, Traore AS, Dosso M. Distribution of resistance genes encoding ESBLs in Enterobacteriaceae isolated from biological samples in health centers in Ouagadougou, Burkina Faso. BMC Res. Notes. 2018;11:471–475. doi: 10.1186/s13104-018-3581-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Livermore DM, Canton R, Gniadkowski M, Nordmann P, Rossolini GM, Arlet G, Ayala J, Coque TM, Kern-Zdanowicz I, Luzzaro F, Poirel L, Woodford N. CTX-M: changing the face of ESBLs in Europe. J. Antimicrob. Chemother. 2007;59:165–174. doi: 10.1093/jac/dkl483. [DOI] [PubMed] [Google Scholar]
  20. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, Paterson DL, Rice LB, Stelling J, Maluta RP, Stella AE, Riccardi K, Rigobelo EC, Marin JM, Carvalho MB. Phenotypical characterization and adhesin identification in Escherichia coli strains isolated from dogs with urinary tract infections. Braz. J. Microbiol. 2012;43:375–381. doi: 10.1590/S1517-838220120001000045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Meacham KJ, Zhang L, Foxman B, Bauer RJ, Marrs CF. Evaluation of genotyping large numbers of Escherichia coli isolates by enterobacterial repetitive intergenic consensus-PCR. J. Clin. Microbiol. 2003;41:5224–5226. doi: 10.1128/JCM.41.11.5224-5226.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Moreno A, Bello H, Guggiana D, Dominguez M andGonzalez G. Extended-spectrum β-lactamases belonging to CTX-M group produced by Escherichia coli strains isolated from companion animals treated with enrofloxacin. Vet. Microbiol. 2008;129:203–208. doi: 10.1016/j.vetmic.2007.11.011. [DOI] [PubMed] [Google Scholar]
  23. Moyaert H, Morrissey I, Jong A, El Garch F, Klein U, Ludwig C, Thiry J, Youala M. Antimicrobial susceptibility monitoring of bacterial pathogens isolated from urinary tract infections in dogs and cats across Europe: ComPath results. Microb. Drug. Resist. 2017;23:391–403. doi: 10.1089/mdr.2016.0110. [DOI] [PubMed] [Google Scholar]
  24. Mulvey MR, Bryce E, Boyd D, Marianna OA, Christianson S, Simor AE, Paton S. Ambler class A extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella spp in Canadian hospitals. Antimicrob. Agents. Chemother. 2004;48:1204–1214. doi: 10.1128/AAC.48.4.1204-1214.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Oliver A, Perez-Diaz JC, Coque TM, Baquero F, Canton R. Nucleotide sequence and characterization of a novel cefotaxime-hydrolyzing beta-lactamase (CTX-M-10) isolated in Spain. Antimicrob. Agents. Chemother. 2001;45:616–620. doi: 10.1128/AAC.45.2.616-620.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Panos GZ, Betsi GI, Falagas ME. Systematic review: Are antibiotics detrimental or beneficial for the treatment of patients with Escherichia coli O157:H7 infection. Aliment. Pharmacol. Ther. 2006;24:731–742. doi: 10.1111/j.1365-2036.2006.03036.x. [DOI] [PubMed] [Google Scholar]
  27. Papini R, Ebani VV, Cerri D, Guidi G. Survey on bacterial isolates from dogs with urinary tract infections and their in vitro sensitivity. Rev. Med. Vet. 2006;157:35–45. [Google Scholar]
  28. Paredes DO, Haro M, Leoro-Garzon P, Barba P, Loaiza K, Mora F, Fors M, Vinueza-Burgos C, Fernández-Moreira E. Multidrug resistant Escherichia coli isolated from canine faeces in a public park in Quito, Ecuador. J. Glob. Antimicrob. Re. 2019;18:263–268. doi: 10.1016/j.jgar.2019.04.002. [DOI] [PubMed] [Google Scholar]
  29. Pool K. Resistance to beta-lactam antibiotics. Cell Mol. Life Sci. 2004;61:2200–2223. doi: 10.1007/s00018-004-4060-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Qekwana DN, Phophi L, Naidoo V, Oguttu JW. Antimicrobial resistance among Escherichia coli isolates from dogs presented with urinary tract infections at a veterinary teaching hospital in South Africa. BMC Vet. Res. 2018;14:228–233. doi: 10.1186/s12917-018-1552-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Rzewuska M, Stefanska I, Kizerwetter-Swida M, Chrobak-Cmiel D, Szczygielska P, Lesniak M, Binek M. Characterization of extended-spectrum β-lactamases produced by Escherichia coli strains isolated from dogs in Poland. Pol. J. Microbiol. 2015;64:285–288. [PubMed] [Google Scholar]
  32. Sader HS, Hsiung A, Fritsche TR, Jones RN. Comparative activities of cefepime and piperacillin/ tazobactam tested against a global collection of Escherichia coli and Klebsiella spp with an ESBL phenotype. Diagn. Microbiol. Infect. Dis. 2007;57:341–344. doi: 10.1016/j.diagmicrobio.2006.08.016. [DOI] [PubMed] [Google Scholar]
  33. Sfaciotte RAP, Parussolo L, Melo FD, Wildemann P, Bordignon G, Israel ND, Leitzke M, Wosiacki SR, Salbego FZ, da Costa UM, Ferraz SM. Identification and characterization of multidrug-resistant extended-spectrum beta-lactamase-producing bacteria from healthy and diseased dogs and cats admitted to a veterinary hospital in Brazil. Microbial. Drug Resist. 2021;27:855–864. doi: 10.1089/mdr.2020.0043. [DOI] [PubMed] [Google Scholar]
  34. Shimizu T, Harada K, Tsuyuki Y, Kimura Y, Miyamoto T, Hatoya S, Hikasa Y. In vitro efficacy of 16 antimicrobial drugs against a large collection of β-lactamase producing isolates of extraintestinal pathogenic Escherichia coli from dogs and cats. J. Med. Microbiol. 2017;66:1085–1091. doi: 10.1099/jmm.0.000535. [DOI] [PubMed] [Google Scholar]
  35. Shin SR, Noh SM, Jung WK, Shin S, Park YK, Moon DC, Lim SK, Park YH, Park KT. Characterization of extended-spectrum β-lactamase producing and AmpC β-lactamase producing Enterobacterales isolated from companion animals in Korea. Antibiotics. 2021;10:249–259. doi: 10.3390/antibiotics10030249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Tan TY, Ng LSY, He J, Koh TH, Hsu LY. Evaluation of screening methods to detect plasmid-mediated AmpC in Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis. Antimicrob. Agents Chemother. 2009;53:146–149. doi: 10.1128/AAC.00862-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Tramuta C, Nucera D, Robino P, Salvarani S, Nebbia P. Virulence factors and genetic variability of uropathogenic Escherichia coli isolated from dogs and cats in Italy. J. Vet. Sci. 2011;12:49–55. doi: 10.4142/jvs.2011.12.1.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Versalovic J, Koeuth T, Lupski R. Distribution of repetitive DNA sequences in eubacteria and application to finerpriting of bacterial genomes. Nucleic Acids Res. 1991;19:6823–6831. doi: 10.1093/nar/19.24.6823. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Iranian Journal of Veterinary Research are provided here courtesy of Shiraz University

RESOURCES