. 2023 Jun 26;11:142. doi: 10.1186/s40168-023-01582-2

Table 1.

Primer sets used in this study

Primer	Sequence (5′-3′)	Efficiency^a	Function
27F	AGAGTTTGATCCTGGCTCAG		For bacterial 16S rDNA amplification, identification, and 16S rDNA standard plasmid construction
1492R	TACGGCTACCTTGTTACGACTT
515F	GTGNCAGCMGCCGCGGTAA	95.39%	For qPCR of total bacterial 16S rDNA
806R	GGACTACNSGGGTATCTA^b	95.39%	For qPCR of total bacterial 16S rDNA
PsudmPJ-F^c	GAGCGCAAGGCGATGGGCAT		For Pseudomonas strains phnJ gene amplification and Pseudomonadales standard plasmid construction
PsudmPJ-R^c	ACTCGCCGACGATGCCCAGCAC
PsudmoPJ-622F^c	GACGAACAGACCAARCGCATGAT	90.30%	For qPCR of phnJ in Pseudomonadales
PsudmoPJ-910R^c	GGTGACGGGTCTGGATCAC	90.30%	For qPCR of phnJ in Pseudomonadales
RhizoPJ-F3^c	ATCATCCAGACGCGCCACCGCATT		For Rhizobium strains phnJ gene amplification and Rhizobiales standard plasmid construction
RhizoPJ-R3^c	AGTCGGTGCGCATCAGGAA
RhizobPJ-153F^c	ATGCCSATGCCYTATGGSTGGGG	87.29%	For qPCR of phnJ in Rhizobiales
RhizobPJ-558R^c	CGACCTTSACCGGRTAGGC	87.29%	For qPCR of phnJ in Rhizobiales
Methyl-F^c	AGGACCAGGAATTCGTGCT		For Methylobacterium strains phnJ gene amplification and Rhodospirillales standard plasmid construction
Methyl-R^c	TGTCCGAGCAGACGAACAT
RhispiPJ-242F^c	CCCTATGGYTGGGGCAC	97.66%	For qPCR of phnJ in Rhodospirillales
RhispiPJ-494R^c	GGATCGGCACCTGRTAGAC	97.66%	For qPCR of phnJ in Rhodospirillales

^aAmplification efficiency for each qPCR primer set

^bOne base was modified from G to N (shown in italics) to match the cyanobacterial 16S rDNA sequence

^cDesigned in this study