Highlights
-
•
COVID-19 patients have increased incidence of Epstein-Barr Virus reactivation.
-
•
Detection of EBV DNA is greater among COVID-19 positive patients (27.1% vs 12.5%).
-
•
No statistical difference in CRP levels of COVID-19 positive vs. negative patients.
-
•
No statistical difference in amount of EBV genomes in reactivated patient groups.
Keywords: COVID-19, Epstein-Barr virus, EBV, Reactivation, Coronavirus, SARS-CoV-2
Abstract
COVID-19, an infectious respiratory illness, is caused by infection with the SARS-CoV-2 virus. Individuals with underlying medical conditions are at increased risk of developing serious illnesses such as long COVID. Recent studies have observed Epstein-Barr virus (EBV) reactivation in patients with severe illness or long COVID, which may contribute to associated symptoms. We determined the frequency of EBV reactivation in COVID-19 positive patients compared to COVID-19 negative patients. 106 blood plasma samples were collected from COVID-19 positive and negative patients and EBV reactivation was determined by detection of EBV DNA and antibodies against EBV lytic genes in individuals with previous EBV infection. 27.1% (13/48) of EBV reactivations, based on qPCR detection of EBV genomes, are from the COVID positive group while only 12.5% (6/48) of reactivations belonged to the negative group. 20/52 (42.30%) of the COVID PCR negative group had detectable antibodies against SARS-CoV-2 nucleoprotein (Np); indicative of past infection. A significantly higher SARS-CoV-2 Np protein level was found in the COVID-19 positive group. In conclusion, COVID-19 patients experienced increased reactivation of EBV in comparison to COVID negative patients.
1. Introduction
COVID-19, which emerged in December of 2019, became a worldwide pandemic and has claimed over 6.6 million lives (World Health Organization 2023). While many infected individuals experience mild or moderate symptoms and recover in 7-10 days it has been reported that almost 16% of patients developed severe disease in a study conducted through January 29, 2020 (Guan et al., 2020). The mortality rate among severe cases of COVID has been reported to be as high as 61.5% (Yang et al., 2020). Since the initial emergence of COVID-19, four prominent variants have emerged: Alpha, Beta, Delta, and Omicron (Callaway, 2021). Omicron, the most recent and highly mutated variant of concern, was first identified in November 2021 and quickly became the dominant strain worldwide (Tian et al., 2022).
Reactivation of Epstein-Barr virus (EBV) has been reported among the critically ill and patients suffering from long COVID and EBV viremia has been correlated with COVID severity (Naendrup et al., 2022, Paolucci et al., 2021, Saade et al., 2021, Simonnet et al., 2021, Gold et al., 2021, Zubchenko et al., 2022, Vojdani et al., 2023). A longitudinal multi-omic study suggested that four main risk factors for developing long COVID are type-2 diabetes, SARS-CoV-2 RNAemia, specific auto-antibodies, and Epstein-Barr virus viremia (Su et al., 2022). Reactivation of EBV may contribute to COVID symptoms, severity, and length of illness. The mechanism by which EBV reactivation may contribute to COVID is not quite clear, however Verma et al reported that EBV lytic replication promotes ACE2 expression and therefore could facilitate entry of SARS-CoV-2 (Verma et al., 2021).
Epstein-Barr virus is one of nine known human herpesviruses and infects more than 90% of the world's population (Tzellos and Farrell, 2012). It is the first human oncogenic virus discovered and is associated with the development of Burkitt's lymphoma, Hodgkin's lymphoma, nasopharyngeal carcinoma, gastric carcinoma and more (Thompson and Kurzrock, 2004, zur Hausen et al., 1970). Primary EBV infections are usually asymptomatic and mild in children but after adolescence, it commonly causes infectious mononucleosis with symptoms including extreme fatigue, fever, head and body aches, and swollen spleen and lymph nodes. When symptoms are resolved, EBV persists for a lifetime by remaining latent in memory B lymphocytes (Fujiwara et al., 2014). However, EBV can be reactivated by prolonged psychological stress, hormonal changes, infections, and other factors that result in weakened cellular immunity (Murata et al., 2021, Sausen et al., 2021, Dochi et al., 2022, Aiello et al., 2010). This reactivation is associated with autoimmune disease, chronic fatigue syndrome and various other malignancies (Kerr, 2019). Healthy individuals are mostly asymptomatic to EBV reactivation, however immunosuppressed individuals can experience the same symptoms as their primary infection of EBV (Kerr, 2019). Here, we aim to determine if COVID infection can promote EBV reactivation, which could result in complicating symptoms of COVID illness.
After primary EBV infection is resolved and latency is established, antibodies against the latent EBV nuclear antigen-1 (EBNA-1) are produced (Murata et al., 2021, Vouloumanou et al., 2012). Anti-EBNA-1 IgG antibodies are not present during the acute phase of EBV but become detectable 2-4 months after infection and persist for life. Detection of EBNA-1 IgG indicates a past infection. EBV reactivation results in expression of lytic gene products such as the viral capsid antigen (VCA) and early antigen-diffuse (EA-D). Anti-VCA IgM is detectable early in infection and reactivation but falls to undetectable levels in approximately 6 weeks. Anti-EA-D IgG also appears early after infection (3-4 weeks) and reactivation and typically falls to undetectable levels in approximately 4 months (Lennette, 1987). Detection of antibodies against VCA IgM and EA-D IgG is an indicator of EBV reactivation (Gulley, 2001) (Fig. 1). However, diagnosing EBV reactivation on serology alone can produce different results depending on the patient's disease course and the instability of anti-EBV antibodies before the appearance of symptoms (Gold et al., 2021). EBV DNA is frequently detectable in plasma during early infection and reactivation (Lam et al., 2018). qPCR detection of EBV DNA is more sensitive than serology in terms of evaluating reactivation (She et al., 2007).
This study aims to determine if COVID-19 positive patients experience increased levels of EBV reactivation compared to COVID-19 negative patients and differs from previous studies in that samples were collected at a time when the Omicron variant was the dominant strain in the area (New York City Department of Health and Mental Hygiene 2022). Past reports on EBV reactivation were conducted largely before the Omicron variant emerged (Naendrup et al., 2022, Paolucci et al., 2021, Saade et al., 2021, Simonnet et al., 2021, Zubchenko et al., 2022, Rahimi and Talebi Bezmin Abadi, 2022, Im et al., 2022, Brooks et al., 2022, Chen et al., 2021, Meng et al., 2022, Vigon et al., 2021, Xie et al., 2021). Plasma samples from hospital patients determined to be COVID negative or COVID positive using PCR-based testing were studied. EBV DNA load was quantitated and serology toward EBV lytic genes were used as determinants of EBV reactivation (Fig. 1).
2. Materials and methods
2.1. Sample collection
106 whole blood samples were collected from different individuals treated at Westchester Medical Center, Valhalla, NY, between January 13, 2022, and March 23, 2022, and placed in EDTA tubes. Whole blood samples were spun down to collect plasma. 54 samples were from patients who tested positive for COVID-19 and 52 samples were from patients who tested negative for COVID-19 as determined by PCR-based testing by hospital staff. This IRB exempt study includes samples set to be discarded that were de-identified and marked only as COVID positive or COVID negative and given to the research team. No identifying information or patient data was supplied. Samples were collected during a time frame when the Omicron variant was the most dominant in the NYC area (New York City Department of Health and Mental Hygiene 2022).
2.2. Quantification of EBV DNA
DNA from 200 μL of plasma was extracted using the DNeasy Blood & Tissue Kit (Qiagen). TaqMan primer sets were used for EBV quantification targeting the BamH1W and LMP2 regions of the EBV genome and were purchased from IDT (Ryan et al., 2004). TaqMan probes include a 5’ reporter FAM (520 nm emission) and double quencher ZEN/IBFQ.
BamHIW1 Forward primer 5’ GCAGCCGCCCAGTCTCT 3’
BamHIW1 reverse primer 5’ ACAGACAGTGCACAGGAGACT
BamHIW1 TaqMan probe 5’- FAM-AAAAGCTGGCGCCCTTGC 3’ ZEN/IBFQ
LMP2 forward primer 5’ AGCTGTAACTGTGGTTTCCATGAC 3’
LMP2 reverse primer 5’ GCCCCCTGGCGAAGA G 3’
LMP2 TaqMan probe 5’-FAM-CTGCTGCTACTGGCTTTCGTCCTCTGG 3’ ZEN/IBFQ
qPCR conditions were 95°C for 2 min 95°C for 15 sec., 60°C for 1 min. for 45 cycles using QuantStudio™ 5 from Applied Biosystems. Positive and negative controls were included, and a cutoff of CT 40 was used. After cycle 45 negative controls were undetectable, indicating that samples detected at cycle 40 represented levels at least 5 cycles (or 32-fold) beyond background. Detection of anti-ENBA1 IgG antibodies was used as a marker of past infection. To determine percent reactivation, samples which were not positive for EBNA-1 were excluded (10 total samples).
2.3. Enzyme-linked immunosorbent assay (ELISA)
2.3.1. EBNA-1 IgG, EA-D IgG, VCA IgM
The presence of antibodies against EBNA-1 IgG, EA-D IgG, and VCA IgM were determined using ELISA kits from Abnova and were performed according to the manufacturer's protocols. To ensure the validity of the assay, positive and negative controls provided in the kit were used. Valid runs had positive controls with an index absorbance range between 2.3-4.2 AU and negative controls below 0.9 AU. The cutoff was calculated by multiplying the mean of calibrators and the calibration factor. Cutoffs were divided from each sample absorbance to get their positivity index. Positive samples have a positivity index >1.10 AU while negatives are <0.90 AU.
2.4. C-reactive protein (CRP)
The relative quantification of CRP concentration was determined using a Human C-Reactive Protein ELISA Kit (Sigma-Aldrich). Samples were diluted 200,000-fold and analysis was performed according to manufacturers’ protocol.
2.5. COVID nucleoprotein (Np)
Both COVID-19 positive and negative patient samples were quantified for antibodies against COVID Np to detect past SARS-CoV-2 virus infection. The samples were prepared according to the COVID-19 N Human IgG Indirect ELISA Kit (RayBio®) protocol. A cutoff of 6.5 U/ml was established and samples with values below 6.5 were listed as “Undetected” in Table 1 and excluded from analysis in Fig. 3C.
Table 1.
Negatives |
Positives |
||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Sample | qPCR BamHI | qPCR LMP2 | CRP | EBNA-1 | EA(D) | VCA | N Protein | Sample | qPCR BamHI | qPCR LMP2 | CRP | EBNA-1 | EA(D) | VCA | N Protein |
46 | Undetected | Undetected | 26.6 | + | - | - | Undetected | 63 | Undetected | Undetected | 44.8 | + | - | - | Undetected |
54 | Undetected | Undetected | 2951.5 | + | + | + | Undetected | 69 | Undetected | Undetected | 1466.5 | + | + | - | Undetected |
59 | Undetected | Undetected | 1548.4 | + | + | - | 12.948 | 78 | 26.145 | 29.12241936 | 4544.4 | +\- | + | - | 83.575 |
85 | Undetected | Undetected | 56.6 | + | no sample | + | 7.718 | 82 | Undetected | Undetected | 3247.5 | + | +\- | - | 16.628 |
95 | Undetected | Undetected | 222.7 | + | - | - | 7.186 | 102 | Undetected | Undetected | 3379.9 | + | - | - | Undetected |
164 | Undetected | Undetected | 6.7 | + | - | - | Undetected | 163 | 36.923 | Undetected | 1191.2 | + | - | - | 20.2 |
166 | Undetected | Undetected | 9.7 | - | + | - | 6.511 | 194 | Undetected | Undetected | 154.6 | + | - | - | 23.539 |
168 | Undetected | Undetected | 9.5 | + | - | - | Undetected | 196 | 37.197 | Undetected | 1260.4 | + | - | - | 45.169 |
172 | 36.482 | Undetected | 8087.6 | + | - | - | Undetected | 198 | 36.421 | Undetected | 594.5 | + | - | - | Undetected |
179 | Undetected | Undetected | 510.7 | + | + | - | 12.451 | 200 | Undetected | Undetected | 58.3 | + | + | - | 22.528 |
65 | Undetected | Undetected | 1083.8 | + | +\- | - | 19.653 | 75 | Undetected | Undetected | 1532 | + | - | - | 6.599 |
68 | Undetected | Undetected | 2122.7 | + | - | - | no sample | 84 | Undetected | 38.75872803 | 553.1 | + | - | - | 372.336 |
73 | Undetected | Undetected | 232.9 | + | + | - | Undetected | 115 | Undetected | Undetected | 919.2 | + | - | - | 41.382 |
76 | Undetected | Undetected | 26.7 | + | + | - | Undetected | 116 | Undetected | Undetected | 645.2 | + | - | - | 34.637 |
80 | Undetected | Undetected | 43.1 | + | + | - | Undetected | 122 | 33.331 | 38.16422653 | 286.9 | + | - | - | 30.567 |
58 | Undetected | Undetected | 9.5 | + | - | - | Undetected | 49 | Undetected | Undetected | 20.1 | + | - | - | Undetected |
64 | Undetected | Undetected | 1135 | + | - | - | Undetected | 50 | Undetected | Undetected | 468.8 | + | - | - | 178.322 |
72 | 30.186 | 34.28359222 | 35.4 | + | - | - | Undetected | 55 | 30.478 | 34.87576675 | Undetected | + | no sample | - | Undetected |
74 | Undetected | Undetected | 1024.6 | + | + | - | 27.284 | 118 | Undetected | Undetected | 46.4 | + | - | - | 56.7 |
90 | 35.134 | 37.69936752 | 80.8 | + | - | - | Undetected | 120 | 35.869 | Undetected | 1881.4 | - | - | - | Undetected |
51 | Undetected | Undetected | 214 | + | +/- | - | 57.682 | 114 | Undetected | Undetected | 3.6 | + | - | - | 49.225 |
53 | Undetected | Undetected | 1491.6 | + | - | - | Undetected | 117 | Undetected | Undetected | Undetected | + | no sample | - | 35.822 |
57 | Undetected | Undetected | 1728.6 | - | - | - | Undetected | 123 | Undetected | Undetected | 15.6 | + | - | - | 84.071 |
62 | Undetected | Undetected | 60 | + | - | + | 780.647 | 124 | Undetected | Undetected | 120.4 | + | + | - | 35.339 |
79 | Undetected | Undetected | 39.2 | + | - | - | Undetected | 126 | 38.546 | Undetected | 43 | + | +/- | - | 33.74 |
45 | Undetected | Undetected | 483.6 | + | - | - | Undetected | 125 | Undetected | Undetected | 20.4 | + | - | - | 279.828 |
48 | Undetected | Undetected | 72.8 | + | - | - | Undetected | 128 | Undetected | Undetected | 219 | + | + | + | 47.561 |
56 | Undetected | Undetected | 71.8 | + | + | - | 7.771 | 133 | Undetected | Undetected | 587.6 | - | - | - | 19.985 |
60 | Undetected | Undetected | 768.4 | + | +/- | - | Undetected | 136 | 35.145 | 36.49794769 | 1049.8 | + | + | - | 54.595 |
61 | Undetected | Undetected | 2133 | + | - | - | Undetected | 139 | 36.752 | Undetected | 861.8 | + | + | - | 62.035 |
131 | 31.656 | 35.08949661 | 2133 | - | - | - | Undetected | 129 | Undetected | 39.97701645 | 775.2 | + | + | - | Undetected |
134 | Undetected | Undetected | 664 | + | +/- | - | 8.645 | 138 | Undetected | Undetected | 479.2 | + | + | - | Undetected |
165 | Undetected | Undetected | 6 | + | +/- | - | 25.352 | 140 | Undetected | Undetected | 1710.8 | + | - | - | 215.617 |
167 | 37.5962944 | Undetected | 1438.8 | + | + | - | Undetected | 143 | 29.645 | 33.68924332 | 2688.6 | + | + | + | 28.817 |
177 | Undetected | Undetected | 54.2 | + | - | - | Undetected | 147 | Undetected | Undetected | 26.4 | + | - | - | Undetected |
171 | Undetected | Undetected | 40.6 | + | - | - | Undetected | 127 | Undetected | Undetected | 1707.6 | + | - | - | 7.849 |
173 | Undetected | Undetected | 12.8 | + | - | - | 7.859 | 142 | Undetected | Undetected | 281.2 | + | +/- | - | 8.746 |
175 | Undetected | Undetected | 8.8 | + | - | - | 24.327 | 152 | Undetected | Undetected | 19.4 | + | - | - | 65.977 |
176 | Undetected | Undetected | 7.6 | + | - | - | 18.832 | 158 | Undetected | Undetected | 1211.2 | + | - | - | Undetected |
187 | 37.096 | 37.981 | 358.6 | + | + | - | 17.92 | 161 | Undetected | Undetected | 34.6 | + | - | - | Undetected |
170 | Undetected | Undetected | 13.8 | + | - | - | 36.545 | 144 | Undetected | Undetected | 187.4 | + | - | - | Undetected |
174 | Undetected | Undetected | 1356.2 | + | - | - | Undetected | 150 | Undetected | Undetected | 6.2 | + | - | - | Undetected |
178 | Undetected | Undetected | 315 | + | - | - | 9.457 | 155 | Undetected | Undetected | 2087.2 | + | + | - | 59.019 |
182 | Undetected | Undetected | 326.8 | + | - | - | 25.194 | 157 | Undetected | Undetected | 6.2 | + | + | - | 26.006 |
189 | Undetected | Undetected | 1899.4 | + | - | - | Undetected | 159 | 35.39 | 37.545 | 683.4 | + | - | - | 148.646 |
181 | 37.451 | 38.086 | 1963 | + | - | - | Undetected | 149 | Undetected | Undetected | 5.4 | - | - | - | Undetected |
183 | Undetected | Undetected | 6.4 | + | + | - | Undetected | 153 | Undetected | Undetected | 583 | + | - | - | 29.974 |
184 | Undetected | Undetected | 360.6 | + | - | - | Undetected | 154 | Undetected | Undetected | 553.8 | + | +/- | +\- | 77.32 |
185 | Undetected | Undetected | 36.4 | + | - | - | Undetected | 156 | 36.199 | 39.246 | 1485 | + | + | - | Undetected |
188 | Undetected | Undetected | 167.6 | - | - | - | Undetected | 192 | Undetected | Undetected | 23.6 | - | +/- | - | Undetected |
190 | Undetected | Undetected | 552.2 | + | - | - | 16.409 | 193 | Undetected | Undetected | 83.6 | + | - | - | 340.319 |
191 | Undetected | Undetected | 13.6 | + | - | - | Undetected | 195 | Undetected | Undetected | 29.2 | - | - | - | 17.152 |
201 | Undetected | Undetected | 10.4 | + | - | - | Undetected | ||||||||
202 | Undetected | Undetected | 70 | + | - | - | 29.742 |
2.6. Statistical analysis
Welch's t-test (Figs. 2B, 3D, 3E, 4B), Mann-Whitney test (Figs. 3C and 4A) and two sample proportion Z test (Figs. 2A, 3A, 3B) were used to calculate significant difference. GraphPad Prism 9 was used to construct graphs and conduct statistical analysis. Summary of raw data is shown in Table 1.
3. Results
3.1. Quantitative PCR detection of EBV
SARS-CoV-2 infection results in increased EBV reactivation. Detection of COVID-19 resulted in increased EBV reactivation as determined by detection of EBV DNA in plasma. To distinguish primary infection from reactivation, past infection status must first be determined. EBNA-1 IgG is an indicator of previous EBV infection. Samples that did not test positive for the presence of EBNA-1 IgG were excluded from analysis and are likely primary infections, not a result of reactivation. 19/96 samples (19.8%) showed reactivated EBV based on detection of EBV genomes with TaqMan probes and at least one primer set (BamHI and LMP2). 13/48 (27.1%) of reactivations were from the COVID positive group, while only 6/48 (12.5%) of reactivations belonged to the negative group. 17/96 (17.7%) were detected using BamHI primers with 6/48 (12.5%) reactivated in the COVID negative group, and 11/48 (22.9%) reactivated in the COVID positive group. qPCR using the LMP2 primer set showed the reactivation of 12/96 samples (12.5%) with 4/48 (8.3%) reactivated in the COVID negative group, and 8/48 (16.7%) reactivated in the COVID positive group (Fig. 2A). 10/12 samples found to be reactivated with LMP2 were also detected with BamHI primers demonstrating strong overlap. For detection of EBV genomes in the plasma samples, 45 PCR cycles were performed to detect EBV DNA using TaqMan probes. In order to distinguish true positives from background levels, a cut-off of cycle 40 was used for inclusion as EBV reactivation determined by qPCR DNA detection. This represents a minimum 32-fold increase above background levels, drastically reducing the possibility of false positives. Negative controls were undetectable at cycle 45. Taken together the data shows that the incidence of EBV reactivation is increased in COVID patients.
No statistical difference was found in the amount of EBV genomes detected in the plasma of reactivated COVID negative and COVID positive patients (Fig. 2B). The mean CT value of the COVID negative group (35.66 CT) was not statistically significant (p=0.8223) compared to the COVID positive group (35.09 CT) with BamHI primers. The mean CT values of EBV reactivated samples detected with LMP2 primers were very similar between the COVID negative group (37.01 CT) and positive (37.34 CT) group (p=0.9436). This data indicates that, in this study, the number of EBV genomes produced via reactivation do not differ significantly between COVID positive and negative patients.
3.2. EBV serology
96/106 patients (90.56%) had detectable levels of anti-EBNA-1 IgG, indicative of a past EBV infection. 25/103 (24.3%) were positive for anti-EA-D IgG and only 5/106 (4.71%) had anti-VCA IgM antibodies. 23/93 (24.7%) samples were positive for both EBNA-1 and EA-D, 12/46 (26.0%) of which were COVID positive and 11/47 (23.4%) were negative. 3/48 (6.3%) were positive for EBNA-1 and VCA from the COVID negative group and 2/48 (4.2%) were positive from the COVID positive group. When either EA-D or VCA was detected in combination with EBNA-1, 12/48 (25.0%) COVID negative patients showed reactivation compared to 12/48 (25.0%) in the COVID positive group (Fig. 3A). There was no significant difference in EBV reactivation as determined by serology against VCA and EA-D antibodies when the COVID negative and positive groups were defined by PCR assay.
To determine if a patient had a past SARS-CoV-2 infection, we quantified antibodies against the COVID nucleoprotein. Most COVID-19 patients develop IgG antibodies within 2–3 weeks after symptom present (Van Elslande et al., 2021). COVID-19 anti-Np IgG antibodies can be detected as early as 7 -10 days after infection and remain for at least several months, whereas PCR-based testing for COVID-19 DNA may be detected 0-4 days after symptoms begin and may remain for several weeks (Koc et al., 2022, Centers for Disease Control and Prevention 2022, Mallett et al., 2020). 20/52 of the patient samples that were determined to be COVID negative based on PCR were found to have antibodies against COVID Np, indicating they had a past infection. 36/54 COVID positive samples (as determined by PCR) were positive for antibodies against Np. Overall, 56/106 (52.8%) patients had a previous or current SARS-CoV-2 infection as determined by antibody against Np.
When seropositivity for anti-Np is used as the indicator for COVID-19 detection, there is an increasing trend in EBV reactivation determined through detection of antibodies against EA-D and VCA in COVID-19 positivity samples. 9/38 (23.7%) patient samples were negative for anti-Np antibodies but had antibodies against either EA-D or VCA, whereas 16/55 (29.1%) patient samples were positive for anti-Np antibodies and had antibodies against either VCA or EA-D. When COVID-19 positivity is determined via positive PCR test or Np seropositivity EBV reactivation is also observed more in COVID-19 positive samples (5/26 (19.2%) vs 20/68 (29.4%)) (see Fig. 3B).
COVID positive samples had a median of 38.60 unit/mL of anti-Np antibodies, while negatives had a median of 17.16 unit/mL as determined by ELISA (Fig. 3C). The positive and negative groups have a statistically significant difference according to the Mann-Whitney test (p=0.0002), indicating an increase in Np antibodies for COVID PCR+ positive patients.
The relationship between anti-Np IgG levels in EBV reactivated patients was evaluated. Samples with antibodies against COVID Np protein for patients found to have reactivated EBV are shown in Fig. 3D. Reactivated EBV was determined by detection of EBV DNA via either BamHI or LMP2 primers. COVID +/- groups represent COVID determination by PCR test. COVID negative patients with detection of antibodies against Np indicates a past infection. Interestingly, EBV reactivation patients with current COVID, determined by PCR, had higher levels of antibodies against Np than EBV reactivating patients who had a past infection (5.0 vs 61.9 average mean (p=0.066)) (Fig. 3D).
Similarly, the relationship between anti-Np IgG levels in patients that did not experience EBV reactivation was also investigated among the COVID negative and positive groups (Fig. 3E). COVID PCR + patients had higher levels of antibodies against Np than those without current COVID (28.4 vs 58.5 average mean (p=0.223)). While Fig. 3D and E both show increased detection of antibodies against Np in individuals with PCR+ COVID, the difference in Np antibody levels among COVID positive and COVID negative group is much larger in the EBV reactivated patients. However this difference may be due to one sample with a very high level of antibodies against Np.
3.3. C-reactive protein
COVID-19 positive and negative patient samples were monitored for CRP levels. The COVID positive samples have a higher median of 474 AU compared to the negative group's median of 218.4 AU. The difference of medians in the two groups is not statistically significant according to the Mann-Whitney test (p=0.4691) (Fig. 4A). There was no correlation between CRP levels and COVID positive vs. negative patients. Additionally, no correlation between CRP levels and EBV reactivation between COVID -/+ groups was found (Fig. 4B). COVID negative samples had a mean of 1994 AU and the COVID positive group's mean is 956 AU (p=0.4508).
4. Discussion
Several studies have investigated the relationship between EBV and COVID. A study conducted in Wuhan, China observed that 55.2% of hospitalized COVID-19 patients were positive for EBV reactivation based on the presence of antibodies against VCA IgM (Chen et al., 2021). A recent observational case-control study conducted in Italy saw 95.2% of COVID-19 ICU patients and 83.6% SICU patients were positive for EBV reactivation. Their comparison between the two groups suggested a correlation between EBV DNA load and COVID severity (Paolucci et al., 2021). Saade et al found 56.1% of EBV reactivations in severe COVID-19 patients after admission to the ICU (Saade et al., 2021) and another reported increased antibodies against EBV and detectable viremia in plasma in critical COVID patients (Vigon et al., 2021).
EBV reactivation has also been examined in the context of long COVID. As of 2022, the CDC determined that 1 in 5 adults in the U.S. who were previously infected with COVID-19 experienced long COVID conditions (Centers for Disease Control and Prevention 2022). Long COVID claimed over 3500 lives in America between January 2020 and June 2022 (Centers for Disease Control and Prevention 2022). The most persistent symptoms in patients hospitalized due to long COVID are fatigue, dyspnoea, loss of memory, and sleep disorders (Garrigues et al., 2020). A 2021 retrospective study observed 66.7% of long COVID patients were positive for EBV based on the presence of EA-D and VCA IgM antibodies (Gold et al., 2021). Another study by Zubchenko et al found EBV reactivation, determined by PCR detection of EBV DNA in peripheral blood, in 42.6% of long COVID patients (Zubchenko et al., 2022). Peluso et al reported that EBV reactivation is associated with higher odds of long COVID symptoms (Peluso et al., 2023).
These previous studies focused on patient populations that were infected with a variants prior to Omicron. Our samples were collected when the Omicron variant was the most dominant in NYC cases (New York City Department of Health and Mental Hygiene 2022) which may result in differences from past studies. To our knowledge this is the first report investigating EBV reactivation due to COVID during the Omicron surge. This study analyzed EBV in samples from hospital patients that are positive and negative for COVID-19 to determine whether EBV reactivation is triggered by COVID-19 irrespective of disease severity, whereas many previous studies focused on severe or long COVID. Patient samples from this study likely represent the full spectrum of COVID infection, ranging from asymptomatic, to mild cases, to severe cases and long COVID. Herein we use both serology and EBV genome detection to analyze EBV reactivation and include detection of EBNA-1 to differentiate primary EBV infection from reactivation. Additionally past SARS-Cov-2 infections were detected by detecting antibodies against the SARS-CoV-2 Np.
Using two primer sets for determining EBV reactivation, it was found that the COVID positive group resulted in significantly increased reactivation of EBV (27.1% vs 12.5%) compared to the negative group. It should be noted that our COVID negative group does not represent a healthy population and rather that of patients treated for various unknown reasons at Westchester Medical Center. Interestingly, the 12.5% reactivation among non-COVID patients found in this study is similar to the amount reported in a 2016 study among a cohort of patients (12%) treated at Johns Hopkins Hospital with no current, prior, or subsequent EBV disease (Kanakry et al., 2016). While we did not have access to a healthy population for this study, other groups have reported EBV reactivation rates of 0.6% and 3% among healthy and immunocompetent individuals as determined by PCR of serum samples (Kanakry et al., 2016, Walton et al., 2014).
The mean CT for EBV genome copy detection of the COVID positive (35.09 CT) and negative group (35.66 CT) was not statistically significant (p=0.8223) using primers targeting BamHI. Paolucci et al reported increased EBV genome copy number in severe COVID cases (patients in ICU) compared those in less severe cases (sub-ICU) (Paolucci et al., 2021). While we did not observe an increase in EBV DNA in the serum, we did detect approximately a 2-fold increase in the number of people with EBV reactivation among COVID positive patients.
The serology of EBNA-1 antibody presence in samples is in line with what can be seen in the general population (approximately 90%) (Tzellos and Farrell, 2012). The serology for EA-D and VCA antibodies did not differ between the COVID positive and negative groups when COVID status is determined by PCR. However, when COVID status was determined by detection of Np there was a noticeable increase in EBV reactivation as determined by serology for VCA and EA-D. Differences accounting for EBV reactivation determined by PCR vs serology are likely due to the time course of disease and initial production and duration of antibodies produced. The presence of EBV DNA-containing particles is likely cleared by the immune system before EA-D and VCA antibodies are produced. EBV reactivation results in the presence of EBV particles in the extracellular serum, therefore detection of EBV DNA via qPCR is likely a better indicator of reactivation.
CRP is a biochemical marker of inflammation (Pepys and Hirschfield, 2003). An increase in its concentration is also associated with the severity of COVID-19 (Ali, 2020). A 2021 study found higher CRP levels in patients with both EBV and COVID-19 compared to patients with only COVID-19 (Chen et al., 2021). However, another study conducted when the alpha strain was dominant, found no association between EBV reactivation and elevated CRP (Brooks et al., 2022). When comparing data from this study we also found there was no statistical difference in CRP levels among COVID positive patients with and without EBV reactivation. COVID positive EBV reactivated patients had a mean CRP level of 956 AU and the COVID positive population without EBV reactivation had a CRP mean of 712 AU (p=0.357). Perhaps these variations are due to differences in COVID variants and disease severity of patients included in the studies. In this study, according to the comparison between COVID positive and negative groups, there is also not a significantly higher (p=0.4691) CRP level for patients with COVID-19. Since we do not have a healthy population, this could be due to other CRP-elevating conditions.
High levels of antibodies against COVID Np can indicate patients that have been infected within weeks to 3 to 6 months prior. 20/52 of the COVID negative patients (38.5%) were identified to have been previously infected with SARS-CoV-2. Therefore, if these patients experience EBV reactivation, it is reasonable to consider COVID-19 as one of the possible causes. In this study it was found that EBV reactivation patients with current COVID-19 had higher levels of antibodies against Np than EBV reactivating patients who had a past infection (Fig. 3D). A study by Imai et al found that more severe COVID correlates with elevated anti-Np antibodies (Imai et al., 2021) and this data taken together could suggest that COVID severity correlates with increased EBV reactivation. The COVID negative group's significantly lower (p=0.0002) antibodies against COVID Np is also in line with the fact that these levels gradually decrease after the infection has been resolved.
Our results point to a trend suggesting that COVID-19 reactivates EBV at a higher rate than non-COVID patients. Significance of this work is heightened by studies of hospitalized COVID patients showing that reactivated EBV significantly increased mortality when compared to EBV negative patients (Xie et al., 2021, Manoharan and Ying, 2023). In addition, it was found that patients with more severe pneumonia had EBV viremia (Im et al., 2022). Results of this work may help determine the course of treatment for COVID positive patients experiencing EBV reactivation. To this end, Meng et al found that patients experiencing EBV reactivation due to COVID showed increased survival outcomes when treated with the EBV inhibitor, ganciclovir (Meng et al., 2022).
Funding
This work was supported by a startup grant from New York Medical College.
CRediT authorship contribution statement
Keishanne Danielle E. Bernal: Conceptualization, Methodology, Investigation, Formal analysis, Writing – review & editing. Christopher B. Whitehurst: Conceptualization, Methodology, Investigation, Formal analysis, Writing – review & editing, Supervision.
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgments
The authors would like to thank the staff of the blood bank at Westchester Medical Center for the clinical samples, and Lawrence McIntyre, science research teacher at Westlake High School for supervision, review and editing.
Data availability
Data will be made available on request.
References
- Aiello AE, Simanek AM, Galea S. Population levels of psychological stress, herpesvirus reactivation and HIV. AIDS Behav. 2010;14:308–317. doi: 10.1007/s10461-008-9358-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ali N. Elevated level of C-reactive protein may be an early marker to predict risk for severity of COVID-19. J. Med. Virol. 2020;92:2409–2411. doi: 10.1002/jmv.26097. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brooks B, Tancredi C, Song Y, Mogus AT, Huang MW, Zhu H, Phan TL, Zhu H, Kadl A, Woodfolk J, Jerome KR, Zeichner SL. Epstein-Barr virus and human herpesvirus-6 reactivation in acute COVID-19 patients. Viruses. 2022;14 doi: 10.3390/v14091872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Callaway E. Beyond Omicron: what's next for COVID's viral evolution. Nature. 2021;600:204–207. doi: 10.1038/d41586-021-03619-8. [DOI] [PubMed] [Google Scholar]
- Centers for Disease Control and Prevention . 2022. Interim Guidelines for COVID-19 Antibody Testing.https://www.cdc.gov/coronavirus/2019-ncov/hcp/testing/antibody-tests-guidelines.html Accessed. [Google Scholar]
- Centers for Disease Control and Prevention . 2022. Nearly One in Five American Adults Who Have Had COVID-19 Still Have “Long COVID”.https://www.cdc.gov/nchs/pressroom/nchs_press_releases/2022/20220622.htm Accessed. [Google Scholar]
- Centers for Disease Control and Prevention . 2022. More Than 3,500 Americans Have Died from Long COVID-Related Illness in the First 30 Months of the Pandemic.https://www.cdc.gov/nchs/pressroom/nchs_press_releases/2022/20221214.htm Accessed. [Google Scholar]
- Chen T, Song J, Liu H, Zheng H, Chen C. Positive Epstein-Barr virus detection in coronavirus disease 2019 (COVID-19) patients. Sci. Rep. 2021;11:10902. doi: 10.1038/s41598-021-90351-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dochi H, Kondo S, Murata T, Fukuyo M, Nanbo A, Wakae K, Jiang WP, Hamabe-Horiike T, Tanaka M, Nishiuchi T, Mizokami H, Moriyama-Kita M, Kobayashi E, Hirai N, Komori T, Ueno T, Nakanishi Y, Hatano M, Endo K, Sugimoto H, Wakisaka N, Juang SH, Muramatsu M, Kaneda A, Yoshizaki T. Estrogen induces the expression of EBV lytic protein ZEBRA, a marker of poor prognosis in nasopharyngeal carcinoma. Cancer Sci. 2022;113:2862–2877. doi: 10.1111/cas.15440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fujiwara S, Kimura H, Imadome K, Arai A, Kodama E, Morio T, Shimizu N, Wakiguchi H. Current research on chronic active Epstein-Barr virus infection in Japan. Pediatr. Int. 2014;56:159–166. doi: 10.1111/ped.12314. [DOI] [PubMed] [Google Scholar]
- Garrigues E, Janvier P, Kherabi Y, Le Bot A, Hamon A, Gouze H, Doucet L, Berkani S, Oliosi E, Mallart E, Corre F, Zarrouk V, Moyer JD, Galy A, Honsel V, Fantin B, Nguyen Y. Post-discharge persistent symptoms and health-related quality of life after hospitalization for COVID-19. J. Infect. 2020;81:e4–e6. doi: 10.1016/j.jinf.2020.08.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gold JE, Okyay RA, Licht WE, Hurley DJ. Investigation of long COVID prevalence and its relationship to Epstein-Barr virus reactivation. Pathogens. 2021;10 doi: 10.3390/pathogens10060763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guan WJ, Ni ZY, Hu Y, Liang WH, Ou CQ, He JX, Liu L, Shan H, Lei CL, Hui DSC, Du B, Li LJ, Zeng G, Yuen KY, Chen RC, Tang CL, Wang T, Chen PY, Xiang J, Li SY, Wang JL, Liang ZJ, Peng YX, Wei L, Liu Y, Hu YH, Peng P, Wang JM, Liu JY, Chen Z, Li G, Zheng ZJ, Qiu SQ, Luo J, Ye CJ, Zhu SY, Zhong NS, China Medical Treatment Expert Group for C. Clinical characteristics of coronavirus disease 2019 in China. N. Engl. J. Med. 2020;382:1708–1720. doi: 10.1056/NEJMoa2002032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gulley ML. Molecular diagnosis of Epstein-Barr virus-related diseases. J. Mol. Diagn. 2001;3:1–10. doi: 10.1016/S1525-1578(10)60642-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Im JH, Nahm CH, Je YS, Lee JS, Baek JH, Kwon HY, Chung MH, Jang JH, Kim JS, Lim JH, Park MH. The effect of Epstein-Barr virus viremia on the progression to severe COVID-19. Medicine (Baltimore). 2022;101:e29027. doi: 10.1097/MD.0000000000029027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Imai K, Kitagawa Y, Tabata S, Kubota K, Nagura-Ikeda M, Matsuoka M, Miyoshi K, Sakai J, Ishibashi N, Tarumoto N, Takeuchi S, Ito T, Maesaki S, Tamura K, Maeda T. Antibody response patterns in COVID-19 patients with different levels of disease severity in Japan. J. Med. Virol. 2021;93:3211–3218. doi: 10.1002/jmv.26899. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kanakry JA, Hegde AM, Durand CM, Massie AB, Greer AE, Ambinder RF, Valsamakis A. The clinical significance of EBV DNA in the plasma and peripheral blood mononuclear cells of patients with or without EBV diseases. Blood. 2016;127:2007–2017. doi: 10.1182/blood-2015-09-672030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kerr JR. Epstein-Barr virus (EBV) reactivation and therapeutic inhibitors. J. Clin. Pathol. 2019;72:651–658. doi: 10.1136/jclinpath-2019-205822. [DOI] [PubMed] [Google Scholar]
- Koc HC, Xiao J, Liu W, Li Y, Chen G. Long COVID and its Management. Int J Biol Sci. 2022;18:4768–4780. doi: 10.7150/ijbs.75056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lam WKJ, Jiang P, Chan KCA, Cheng SH, Zhang H, Peng W, Tse OYO, Tong YK, Gai W, Zee BCY, Ma BBY, Hui EP, Chan ATC, Woo JKS, Chiu RWK, Lo YMD. Sequencing-based counting and size profiling of plasma Epstein-Barr virus DNA enhance population screening of nasopharyngeal carcinoma. Proc. Natl. Acad. Sci. U. S. A. 2018;115:E5115–E5124. doi: 10.1073/pnas.1804184115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lennette E HW. Epstein-Barr virus infections: clinical and serologic features. Lab. Manag. 1987;25:23–26. [Google Scholar]
- Mallett S, Allen AJ, Graziadio S, Taylor SA, Sakai NS, Green K, Suklan J, Hyde C, Shinkins B, Zhelev Z, Peters J, Turner PJ, Roberts NW, di Ruffano LF, Wolff R, Whiting P, Winter A, Bhatnagar G, Nicholson BD, Halligan S. At what times during infection is SARS-CoV-2 detectable and no longer detectable using RT-PCR-based tests? A systematic review of individual participant data. BMC Med. 2020;18:346. doi: 10.1186/s12916-020-01810-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Manoharan S, Ying LY. Epstein Barr virus reactivation during COVID-19 hospitalization significantly increased mortality/death in SARS-CoV-2(+)/EBV(+) than SARS-CoV-2(+)/EBV(-) Patients: a comparative meta-analysis. Int. J. Clin. Pract. 2023;2023 doi: 10.1155/2023/1068000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Meng M, Zhang S, Dong X, Sun W, Deng Y, Li W, Li R, Annane D, Wu Z, Chen D. COVID-19 associated EBV reactivation and effects of ganciclovir treatment. Immun Inflamm Dis. 2022;10:e597. doi: 10.1002/iid3.597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Murata T, Sugimoto A, Inagaki T, Yanagi Y, Watanabe T, Sato Y, Kimura H. Molecular basis of Epstein-Barr virus latency establishment and Lytic reactivation. Viruses. 2021;13 doi: 10.3390/v13122344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Naendrup JH, Garcia Borrega J, Eichenauer DA, Shimabukuro-Vornhagen A, Kochanek M, Boll B. Reactivation of EBV and CMV in severe COVID-19-epiphenomena or trigger of hyperinflammation in need of treatment? A large case series of critically ill patients. J. Intensive Care Med. 2022;37:1152–1158. doi: 10.1177/08850666211053990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- New York City Department of Health and Mental Hygiene . 2022. Omicron Variant: NYC Report for January 13, 2022.https://www1.nyc.gov/assets/doh/downloads/pdf/covid/omicron-variant-report-jan-13-22.pdf Accessed. [Google Scholar]
- Paolucci S, Cassaniti I, Novazzi F, Fiorina L, Piralla A, Comolli G, Bruno R, Maserati R, Gulminetti R, Novati S, Mojoli F, Baldanti F, San Matteo, Pavia C-TF. EBV DNA increase in COVID-19 patients with impaired lymphocyte subpopulation count. Int. J. Infect. Dis. 2021;104:315–319. doi: 10.1016/j.ijid.2020.12.051. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peluso MJ, Deveau TM, Munter SE, Ryder D, Buck A, Beck-Engeser G, Chan F, Lu S, Goldberg SA, Hoh R, Tai V, Torres L, Iyer NS, Deswal M, Ngo LH, Buitrago M, Rodriguez A, Chen JY, Yee BC, Chenna A, Winslow JW, Petropoulos CJ, Deitchman AN, Hellmuth J, Spinelli MA, Durstenfeld MS, Hsue PY, Kelly JD, Martin JN, Deeks SG, Hunt PW, Henrich TJ. Chronic viral coinfections differentially affect the likelihood of developing long COVID. J. Clin. Invest. 2023:133. doi: 10.1172/JCI163669. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pepys MB, Hirschfield GM. C-reactive protein: a critical update. J. Clin. Invest. 2003;111:1805–1812. doi: 10.1172/JCI18921. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rahimi F, Talebi Bezmin Abadi A. Omicron: a highly transmissible SARS-CoV-2 variant. Gene Rep. 2022;27 doi: 10.1016/j.genrep.2022.101549. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ryan JL, Fan H, Glaser SL, Schichman SA, Raab-Traub N, Gulley ML. Epstein-Barr virus quantitation by real-time PCR targeting multiple gene segments: a novel approach to screen for the virus in paraffin-embedded tissue and plasma. J. Mol. Diagn. 2004;6:378–385. doi: 10.1016/S1525-1578(10)60535-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saade A, Moratelli G, Azoulay E, Darmon M. Herpesvirus reactivation during severe COVID-19 and high rate of immune defect. Infect. Dis. Now. 2021;51:676–679. doi: 10.1016/j.idnow.2021.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sausen DG, Bhutta MS, Gallo ES, Dahari H, Borenstein R. Stress-induced Epstein-Barr virus reactivation. Biomolecules. 2021;11 doi: 10.3390/biom11091380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- She RC, Stevenson J, Phansalkar AR, Hillyard DR, Litwin CM, Petti CA. Limitations of polymerase chain reaction testing for diagnosing acute Epstein-Barr virus infections. Diagn. Microbiol. Infect. Dis. 2007;58:333–335. doi: 10.1016/j.diagmicrobio.2007.01.014. [DOI] [PubMed] [Google Scholar]
- Simonnet A, Engelmann I, Moreau AS, Garcia B, Six S, El Kalioubie A, Robriquet L, Hober D, Jourdain M. High incidence of Epstein-Barr virus, cytomegalovirus, and human-herpes virus-6 reactivations in critically ill patients with COVID-19. Infect. Dis. Now. 2021;51:296–299. doi: 10.1016/j.idnow.2021.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Su Y, Yuan D, Chen DG, Ng RH, Wang K, Choi J, Li S, Hong S, Zhang R, Xie J, Kornilov SA, Scherler K, Pavlovitch-Bedzyk AJ, Dong S, Lausted C, Lee I, Fallen S, Dai CL, Baloni P, Smith B, Duvvuri VR, Anderson KG, Li J, Yang F, Duncombe CJ, McCulloch DJ, Rostomily C, Troisch P, Zhou J, Mackay S, DeGottardi Q, May DH, Taniguchi R, Gittelman RM, Klinger M, Snyder TM, Roper R, Wojciechowska G, Murray K, Edmark R, Evans S, Jones L, Zhou Y, Rowen L, Liu R, Chour W, Algren HA, Berrington WR, Wallick JA, Cochran RA, et al. Multiple early factors anticipate post-acute COVID-19 sequelae. Cell. 2022;185:881–895.e20. doi: 10.1016/j.cell.2022.01.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Thompson MP, Kurzrock R. Epstein-Barr virus and cancer. Clin. Cancer Res. 2004;10:803–821. doi: 10.1158/1078-0432.ccr-0670-3. [DOI] [PubMed] [Google Scholar]
- Tian D, Sun Y, Xu H, Ye Q. The emergence and epidemic characteristics of the highly mutated SARS-CoV-2 Omicron variant. J. Med. Virol. 2022;94:2376–2383. doi: 10.1002/jmv.27643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tzellos S, Farrell PJ. Epstein-barr virus sequence variation-biology and disease. Pathogens. 2012;1:156–174. doi: 10.3390/pathogens1020156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Van Elslande J, Oyaert M, Ailliet S, Van Ranst M, Lorent N, Vande Weygaerde Y, Andre E, Lagrou K, Vandendriessche S, Vermeersch P. Longitudinal follow-up of IgG anti-nucleocapsid antibodies in SARS-CoV-2 infected patients up to eight months after infection. J. Clin. Virol. 2021;136 doi: 10.1016/j.jcv.2021.104765. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Verma D, Church TM, Swaminathan S. Epstein-Barr virus lytic replication induces ACE2 expression and enhances SARS-CoV-2 pseudotyped virus entry in epithelial cells. J. Virol. 2021;95 doi: 10.1128/JVI.00192-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vigon L, Garcia-Perez J, Rodriguez-Mora S, Torres M, Mateos E, Castillo de la Osa M, Cervero M, Malo De Molina R, Navarro C, Murciano-Anton MA, Garcia-Gutierrez V, Planelles V, Alcami J, Perez-Olmeda M, Coiras M, Lopez-Huertas MR. Impaired antibody-dependent cellular cytotoxicity in a Spanish cohort of patients with COVID-19 admitted to the ICU. Front. Immunol. 2021;12 doi: 10.3389/fimmu.2021.742631. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vojdani A, Vojdani E, Saidara E, Maes M. Persistent SARS-CoV-2 infection, EBV, HHV-6 and other factors may contribute to inflammation and autoimmunity in long COVID. Viruses. 2023;15 doi: 10.3390/v15020400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vouloumanou EK, Rafailidis PI, Falagas ME. Current diagnosis and management of infectious mononucleosis. Curr. Opin. Hematol. 2012;19:14–20. doi: 10.1097/MOH.0b013e32834daa08. [DOI] [PubMed] [Google Scholar]
- Walton AH, Muenzer JT, Rasche D, Boomer JS, Sato B, Brownstein BH, Pachot A, Brooks TL, Deych E, Shannon WD, Green JM, Storch GA, Hotchkiss RS. Reactivation of multiple viruses in patients with sepsis. PLoS One. 2014;9:e98819. doi: 10.1371/journal.pone.0098819. [DOI] [PMC free article] [PubMed] [Google Scholar]
- World Health Organization . 2023. WHO Coronavirus (COVID-19) Dashboard.https://covid19.who.int/ Accessed. [Google Scholar]
- Xie Y, Cao S, Dong H, Lv H, Teng X, Zhang J, Wang T, Zhang X, Qin Y, Chai Y, Yang L, Liu J, Wang R. Clinical characteristics and outcomes of critically ill patients with acute COVID-19 with Epstein-Barr virus reactivation. BMC Infect. Dis. 2021;21:955. doi: 10.1186/s12879-021-06638-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang X, Yu Y, Xu J, Shu H, Xia J, Liu H, Wu Y, Zhang L, Yu Z, Fang M, Yu T, Wang Y, Pan S, Zou X, Yuan S, Shang Y. Clinical course and outcomes of critically ill patients with SARS-CoV-2 pneumonia in Wuhan, China: a single-centered, retrospective, observational study. Lancet Respir. Med. 2020;8:475–481. doi: 10.1016/S2213-2600(20)30079-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zubchenko S, Kril I, Nadizhko O, Matsyura O, Chopyak V. Herpesvirus infections and post-COVID-19 manifestations: a pilot observational study. Rheumatol. Int. 2022;42:1523–1530. doi: 10.1007/s00296-022-05146-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- zur Hausen H, Schulte-Holthausen H, Klein G, Henle W, Henle G, Clifford P, Santesson L. EBV DNA in biopsies of Burkitt tumours and anaplastic carcinomas of the nasopharynx. Nature. 1970;228:1056–1058. doi: 10.1038/2281056a0. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data will be made available on request.