Skip to main content
Genes logoLink to Genes
. 2023 Jun 6;14(6):1227. doi: 10.3390/genes14061227

The Complete Mitochondrial Genome of the Freshwater Fish Onychostoma ovale (Cypriniformes, Cyprinidae): Genome Characterization and Phylogenetic Analysis

Renyi Zhang 1,*,, Tingting Zhu 1,, Qi Luo 1
Editor: Manuel Vera Rodríguez1
PMCID: PMC10298739  PMID: 37372406

Abstract

In this study, we sequenced and characterized the complete mitochondrial genome (mitogenome) of Onychostoma ovale. The mitogenome of O. ovale was 16,602 bp in length with 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and a control region. The nucleotide composition of the O. ovale mitogenome was 31.47% A, 24.07% T, 15.92% G, and 28.54% C, with a higher A + T content (55.54%) than G + C content (44.46%). All PCGs began with the standard ATG codon, except for the cytochrome c oxidase subunit 1 (COX1) gene and the NADH dehydrogenase 3 (ND3) gene with GTG, while six PCGs ended with incomplete termination codons (TA or T). The Ka/Ks ratios of 13 PCGs were all less than one, indicating that they were under purifying selection. All tRNA genes were folded into the typical cloverleaf secondary structures with the exception of tRNASer(AGY), whose dihydrouridine (DHU) arm was absent. The phylogenetic trees showed that Onychostoma and Acrossocheilus were classified into three clades. There was a mosaic relationship between Onychostoma and Acrossocheilus. Moreover, the phylogenetic tree analysis showed that O. rarum was the closest species to O. ovale. This study can provide a useful resource for further phylogeny and population genetic analyses of Onychostoma and Acrossocheilus.

Keywords: Acrossocheilinae, Onychostoma ovale, mitogenome, phylogeny

1. Introduction

In fish, as in other vertebrates, mitochondrial DNA (mtDNA) is organized as an extranuclear, closed circular, double-stranded DNA molecule that is composed of the heavy (H) strand and the light (L) strand) [1,2]. Fish mtDNA is generally small, ranging from 15–18 kb, which typically contain 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and 1 control region (D-loop) [2,3]. In comparison with nuclear DNA, mtDNA has the unique characteristics of maternal inheritance, multiple copies, no introns, a rapid evolution rate, and small molecular size, so it has become an important molecular marker in evolutionary genetics, molecular ecology, species identification, and the conservation biology of fish [1,4,5]. In recent years, with the rapid development and application of high-throughput DNA sequencing technologies and bioinformatics analysis, more and more fish mitochondrial genomes have been successfully sequenced and characterized.

The newly established subfamily Acrossocheilinae consists of three genera (Acrossocheilus, Onychostoma, and Folifer) distributed in East Asia and Southeast Asia, including Vietnam, Laos, Thailand, Cambodia, and China [6,7]. The subfamily consists of 23 species in the genus Onychostoma, 26 species in the genus Acrossocheilus, and only 3 valid species in the genus Folifer [8]. It is a kind of small- and medium-sized freshwater economic fish [9]. Acrossocheilinae is characterized primarily by three rows of pharyngeal teeth, a dorsal fin with eight branched rays, a lower jaw with a horny sheath, and the last simple ray of the dorsal fin with a serrated or smooth posterior edge [6]. Previous molecular phylogenetic studies have shown that Acrossocheilinae is a monophyletic group [6,10]. However, the phylogenetic relationship between Acrossocheilus and Onychostoma has long been controversial [6,11]. More extensive species sampling will be essential to refine our understanding of the molecular phylogeny of Acrossocheilinae. So far, there are a total of 28 available mitogenomes of the subfamily Acrossocheilinae at the National Center for Biotechnology Information.

Onychostoma ovale Pellegrin & Chevey, 1936 is a kind of medium-sized freshwater fish species that is distributed in the Yuanjiang River in China and can also be found in the Pearl River and Wujiang River. O. ovale is a bottom-dwelling freshwater fish and feeds mainly on algae and copepods [12]. O. ovale can be distinguished from other Onychostoma fish based on its morphological characteristics such as the number of lateral line scales and the length of the first branch of the dorsal fin [9]. In this study, we sequenced and analyzed the mitogenome of O. ovale and reconstructed the mitogenomic phylogeny of Onychostoma and the relative genera (Acrossocheilus and Folifer) with 13 PCGs. The results of this study may provide basic genetic information for phylogenetic and population genetic studies of the Acrossocheilinae and expand our knowledge of the mitochondrial genome features of Acrossocheilinae and the classification of the subfamily Acrossocheilinae.

2. Materials and Methods

2.1. Sampling, DNA Extraction, PCR Amplification, and Sanger Sequencing

An individual sample of O. ovale was collected in Luodian Country, Guizhou Province, China (25°33′ N, 106°51′ E). The voucher specimen (GZNUSLS202009033) was preserved immediately in 75% ethanol and then stored at −20 °C for genomic DNA extraction. Total genomic DNA was extracted from a piece of muscle tissue using a modification of the high salt method [13] and standard protease K digestion. The integrity of the extracted DNA was checked by 1% agarose gel electrophoresis, and the DNA concentration and purity were determined by analysis with the Epoch 2 spectrophotometer system (Biotek Instruments, Inc., Winooski, VT, USA). The genomic DNA was used as a template for the overlapping polymerase chain reaction (PCR) amplification. Thirteen pairs of PCR primers were designed according to the conservative region of O. rarum (GenBank accession number: NC_022869) (Table 1). The PCR was performed in a total volume of 35 μL containing 17.5 μL of 2xTaq Plus MasterMix (CoWin Biosciences, Beijing, China), 14.5 μL ultrapure water, 1 μL of template DNA (100 ng/μL), and 1 μL of each primer (10 μM). The PCR conditions were as follows: initial denaturation for 5 min at 95 °C followed by 35 cycles of 1 min denaturation at 95 °C, 30 s annealing at 37–53.4 °C (Table 1), and 1.5 min elongation at 72 °C, with a final extension for 10 min at 72 °C. The amplified PCR products were visualized on 1% agarose gels to confirm amplification. The sizes of the amplified PCR products were estimated by comparison to a DL2000 DNA size marker (TaKaRa, Beijing, China). The PCR products were then sent to Sangon Biotech Company (Shanghai, China) and sequenced directly on both strands using the same primers for PCR amplification with a 3730xl DNA analyzer (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) and a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems).

Table 1.

Thirteen PCR primers for the amplification of the mitochondrial genome of O. ovale.

Primer Name Primer Sequences (5′–3′) Annealing Temperature
OF1 AGGGACAAAAGTAAGCAAAA 43.7 °C
OR1 CCCAACCGAAGGTAAAATA
OF2 TGCCCAGTGACCACAAGTT 51.6 °C
OR2 GTGAGGCTCCCAGGAAAAG
OF3 GTGAGGCTCCCAGGAAAAG 43.9 °C
OR3 TGGTTGAGTTGGTTGTGTT
OF4 TTAGTAGGGGGATGAGGAG 47.3 °C
OR4 GGGTCAAAGAATGTGGTGT
OF5 TTCCACGAATGAACAACA 42.2 °C
OR5 AATACAGCGGGTAAAATG
OF6 GCATTCGTTCAAGTTCAA 44.2 °C
OR6 TACGGCAGTAGCGATAAG
OF7 AGAAGGACACAAATGAGCAC 46.3 °C
OR7 AGGAAAAAGCGTAGAGAGAA
OF8 GCCTGATACTGACACTTCGT 48 °C
OR8 GGCTTCTACATGTGCTTTTG
OF9 TTCCAACCCTCATCATCAT 46.9 °C
OR9 CCTACTCCTTCTCAGCCAA
OF10 CTTTCTCATCCTACTCCACC 45 °C
OR10 GTTTTTGCCATAGTTTTTTG
OF11 AAGCAAACAAGTAAAAATCA 37 °C
OR11 AACAAACGGTAGTAGGAAGT
OF12 CCTCTACAAAGAAACCTGAAAC 43.3 °C
OR12 CAAGTGAAAAGAAACCAAAAA
OF13 TCAGGGACAATAACTGTGGGGG 53.4 °C
OR13 TTGGTGTGTTTTGACGGGGAG

2.2. Mitogenome Assembly, Annotation, and Bioinformatics Analysis

The sequence fragments were manually assembled into a circularized contig by SeqMan software (DNA STAR package; DNAStar Inc., Madison, WI, USA). After being assembled, the mitogenome sequence was automatically annotated using the MitoAnnotator pipeline [14]. In addition, the tRNA genes were identified and annotated using MITOS Web Server [15] and tRNAscan-SE search server [16]. The sequences of the extend termination associated sequence (ETAS), the central conserved blocks (CSB-F, -E, -D), and the conserved sequence block domains (CSB-1, -2, -3) in the control region were identified using the Basic Local Alignment Search Tool (BLAST) against the sequences of the reported fish. The base composition and codon usages were calculated using MEGA 6.0 software [17]. The relative synonymous codon usage (RSCU) of each PCGs was analyzed using PhyloSuite v1.2.3 [18]. We calculated A + T skew and G + C skew using the following general formulae: A + T skew = (A% − T%)/(A% + T%) and G + C skew = (G% − C%)/(G% + C%), respectively [19]. The rates of non-synonymous substitutions and synonymous substitutions (Ka/Ks) in the mitogenomes of all species of Acrossocheilinae were calculated using DnaSP 6.0 [20].

2.3. Phylogenetic Analysis

We herein reconstruct the phylogeny of the Acrossocheilinae using the mitogenome sequences of 29 species (Table 2); Cyprinus carpio was used as an outgroup (Table 2). The nucleotide sequences of 13 PCGs of all mitogenomes were extracted by PhyloSuite v1.2.3 [18]. Then, sequences were aligned using MAFFT v7.313 [21] with default parameters in PhyloSuite v1.2.3 [18] and concatenated into a single supergene for each species. The optimal partitioning strategy and the best-fit evolution model for each partition were inferred using PartitionFinder v2 [22] under the Bayesian information criterion (BIC) and the greedy search scheme in PhyloSuite v1.2.3 [18]. The phylogenetic relationships of 29 species of the subfamily Acrossocheilinae were inferred using the maximum likelihood (ML) and Bayesian inference (BI) methods based on the concatenated nucleotide sequences of all 13 PCGs. The ML phylogenetic tree was constructed using IQ-TREE v. 1.6.8 [23] in PhyloSuite v1.2.3 [18] with 1000 bootstrap replicates. The BI analysis was performed with MrBayes v. 3.2.6 [24]. Four Markov chain Monte Carlo (MCMC) chains were run simultaneously for 20 million generations sampling every 1000 generations. Bayesian posterior probability (BPP) was calculated in a majority-rule consensus tree after discarding the first 25% of samples as burn-in. The phylogenetic trees were visualized and edited using the online tool Interactive Tree Of Life (iTOL) (https://itol.embl.de/) (accessed on 19 January 2023) [25].

Table 2.

Species information used in this study.

NO. Species Size (bp) A% T% G% C% A + T Content A + T Skew G + C Skew Accession No.
1 Acrossocheilus barbodon 16,596 31.55 24.37 15.88 28.20 55.92 0.13 −0.28 NC_022184
2 Acrossocheilus beijiangensis 16,600 31.16 24.99 16.13 27.73 56.14 0.11 −0.26 NC_028206
3 Acrossocheilus fasciatus 16,589 30.85 24.87 16.54 27.75 55.71 0.11 −0.25 NC_023378
4 Acrossocheilus hemispinus 16,590 31.16 24.70 16.15 28.00 55.85 0.12 −0.27 NC_022183
5 Acrossocheilus iridescens 16,596 31.51 24.42 15.93 28.14 55.94 0.13 −0.28 NC_031551
6 Acrossocheilus jishouensis 16,587 31.16 25.09 16.19 27.55 56.25 0.11 −0.26 NC_034917
7 Acrossocheilus kreyenbergii 16,849 31.16 25.43 16.26 27.15 56.60 0.10 −0.25 NC_024844
8 Acrossocheilus longipinnis 16,593 31.54 24.39 15.95 28.12 55.93 0.13 −0.28 NC_047455
9 Acrossocheilus monticola 16,599 31.42 24.54 15.81 28.24 55.96 0.12 −0.28 NC_022145
10 Acrossocheilus paradoxus 16,586 31.13 25.10 16.24 27.52 56.23 0.11 −0.26 MG878098
11 Acrossocheilus parallens 16,592 30.97 24.70 16.33 28.00 55.67 0.11 −0.26 NC_026973
12 Acrossocheilus spinifer 16,591 31.24 24.71 16.07 27.97 55.95 0.12 −0.27 NC_034918
13 Acrossocheilus stenotaeniatus 16,594 31.22 24.70 16.07 28.02 55.91 0.12 −0.27 NC_024934
14 Acrossocheilus wenchowensis 16,591 31.05 24.97 16.32 27.67 56.02 0.11 −0.26 NC_020145
15 Acrossocheilus wuyiensis 16,594 31.12 24.71 16.16 28.01 55.83 0.11 −0.27 NC_034919
16 Acrossocheilus yunnanensis 16,588 31.39 24.66 16.12 27.83 56.05 0.12 −0.27 NC_028527
17 Cyprinus carpio 16,575 31.86 24.88 15.80 27.46 56.74 0.12 −0.27 NC_001606
18 Folifer brevifilis 16,707 31.08 24.63 16.36 27.93 55.71 0.12 −0.26 NC_031606
19 Onychostoma alticorpus 16,607 30.88 23.57 16.56 28.99 54.45 0.13 −0.27 NC_021473
20 Onychostoma barbatulum 16,597 31.45 25.15 16.00 27.40 56.60 0.11 −0.26 NC_021644
21 Onychostoma barbatum 16,592 31.54 24.49 15.94 28.04 56.03 0.13 −0.28 NC_019630
22 Onychostoma fangi 16,597 31.55 24.50 15.90 28.05 56.05 0.13 −0.28 NC_031529
23 Onychostoma gerlachi 16,601 31.38 24.24 16.09 28.29 55.62 0.13 −0.27 NC_026549
24 Onychostoma lepturus 16,601 31.31 23.89 16.16 28.64 55.20 0.13 −0.28 NC_054158
25 Onychostoma lini 16,595 31.62 24.57 15.87 27.94 56.19 0.13 −0.28 NC_018043
26 Onychostoma macrolepis 16,595 31.29 24.53 16.21 27.97 55.82 0.12 −0.27 NC_023799
27 Onychostoma meridionale 16,595 31.19 24.30 16.23 28.29 55.49 0.12 −0.27 NC_031603
28 Onychostoma ovale 16,602 31.47 24.07 15.92 28.54 55.54 0.13 −0.28 NC_066040
29 Onychostoma rarum 16,590 31.49 24.15 15.88 28.47 55.65 0.13 −0.28 NC_022869
30 Onychostoma simum 16,601 31.31 24.30 16.11 28.28 55.61 0.13 −0.27 NC_021972

3. Results and Discussion

3.1. Mitochondrial Genomic Structure and Base Composition

The complete mitogenome sequence of O. ovale (GenBank accession number: NC_066040) was 16,602 bp (Figure 1), which was consistent with other known species of Acrossocheilinae (Table 2). Like most fish, the mitogenome of O. ovale also contained 37 mitochondrial genes, with 13 typical PCGs, 22 tRNA genes, 2 rRNA genes, and 1 control region (Figure 1; Table 3). All mitochondrial genes were encoded on the H chain, with the exception of the ND6 gene and the eight tRNA genes (tRNAGln, tRNAAla, tRNAAsn, tRNACys, tRNATyr, tRNASer, tRNAGlu, and tRNAPro) were encoded on the L chain (Figure 1; Table 3). In the mitogenome, there were six overlapping regions (from 1 to 7 bp in size). The longest overlapping regions (7 bp) were located between ATP8/ATP6 and ND4L/ND4. In addition, there were 12 gene spacers (from 1 to 33 bp in size). The longest gap was found between tRNAAsn and tRNACys by 33 nucleotides.

Figure 1.

Figure 1

Circular map of the mitogenome of O. ovale.

Table 3.

Mitochondrial genome composition and characteristics of O. ovale.

Gene Position Number Size (bp) Codon Strand Intergenetic Nucleotide
Start Stop Start Stop
tRNAPhe 1 69 69 H 0
12S rRNA 70 1028 959 H 0
tRNAVal 1029 1100 72 H 0
16S rRNA 1101 2780 1680 H 0
tRNALeu 2781 2856 76 H 0
ND1 2858 3832 975 ATG TAA H +1
tRNAIle 3837 3908 72 H +4
tRNAGln 3907 3977 71 L −2
tRNAMet 3979 4047 69 H +1
ND2 4048 5092 1045 ATG T-- H 0
tRNATrp 5093 5163 71 H 0
tRNAAla 5166 5234 69 L +2
tRNAAsn 5236 5308 73 L +1
tRNACys 5342 5408 67 L +33
tRNATyr 5408 5478 71 L −1
COI 5480 7030 1551 GTG TAA H +1
tRNASer 7031 7101 71 L 0
tRNAAsp 7104 7175 72 H +2
COII 7191 7881 691 ATG T-- H +15
tRNALys 7882 7957 76 H 0
ATPase8 7959 8123 165 ATG TAG H +1
ATPase6 8117 8800 684 ATG TAA H −7
COIII 8800 9584 785 ATG TA- H −1
tRNAGly 9585 9656 72 H 0
ND3 9657 10,005 349 GTG T-- H 0
tRNAArg 10,006 10,075 70 H 0
ND4L 10,076 10,372 297 ATG TAA H 0
ND4 10,366 11,746 1381 ATG T-- H −7
tRNAHis 11,747 11,815 69 H 0
tRNASer 11,816 11,884 69 H 0
tRNALeu 11,886 11,958 73 H +1
ND5 11,959 13,782 1824 ATG TAA H 0
ND6 13,779 14,300 522 ATG TAA L −4
tRNAGlu 14,301 14,369 69 L 0
Cyt b 14,376 15,516 1141 ATG T-- H +6
tRNAThr 15,517 15,588 72 H 0
tRNAPro 15,588 15,657 70 L −1
D-loop 15,658 16,602 945 0

The overall base composition of O. ovale mitogenome was slightly biased toward A and T at 55.54% (A = 31.47%%, T = 24.07%, G = 15.92%, and C = 28.54%) with a positive A + T skew (0.13) and a negative G + C skew (−0.28) (Table 4). The mitogenome of O. ovale exhibited a clear A + T preference in its base composition, which was similar to that of other Onychostoma fish (Table 2). Compared with the whole genome, the control region has the highest A + T content, up to 66.99% (Table 4), which is a typical feature of animal mitochondrial genomes [2,26]. On the contrary, the first codon position of the PCGs with the lowest A + T content, which was 47.10% (Table 4).

Table 4.

Base composition of the O. ovale mitochondrial genome.

Size (bp) A% T% G% C% A + T% G + C% A + T Skew G + C Skew
Genome 16,602 31.47 24.07 15.92 28.54 55.54 44.46 0.13 −0.28
PCGs 11,410 29.36 25.74 15.45 29.45 55.10 44.90 0.07 −0.31
First codon position 3807 26.87 20.23 25.64 27.26 47.10 52.90 0.14 −0.03
Second codon position 3802 18.52 40.19 13.62 27.67 58.71 41.29 −0.37 −0.34
Third codon position 3801 42.70 16.81 7.08 33.41 59.51 40.49 0.43 −0.65
rRNA 2639 34.71 18.98 20.73 25.58 53.69 46.31 0.29 −0.10
tRNA 1563 28.60 27.00 23.22 21.18 55.60 44.38 0.03 0.05
D-loop region 945 33.97 33.02 12.59 20.42 66.99 33.01 0.01 −0.24

3.2. Protein-Coding Genes and Codon Usage

The PCGs ranged in size from 165 bp (ATP8) to 1824 bp (ND5) with a total length of 11,410 bp. Eleven PCGs were canonical ATG start codons, while the start codon of the COI gene, and the ND3 gene was a GTG start codon. The non-standard start codon was also found in other fish species [4,5]. Seven PCGs had complete stop codons, while the remaining six PCGs ended with the incomplete stop codons TA or T (COIII ended with TA and ND2, COII, ND3, ND4, and Cyt b ended with T) (Table 3). These incomplete stop codons widely exist in vertebrate mitochondrial PCGs, which were presumed to be completed via post-transcriptional polyadenylation [27]. Moreover, the values of A + T skew and G + C skew for the PCGs were 0.07 and –0.31, respectively, indicating that the abundance of A and C is higher than that of their respective counterparts (Table 4).

The amino acid usage and RSCU values in the PCGs of O. ovale are summarized in Table 5 and Figure 2. The mitogenome encoded a total of 3801 amino acids, among which leucine (16.55%) and cysteine (0.68%) were the most and the least frequently used amino acids, respectively. The six most frequently used codons in O. ovale were CUA (Leu), ACA (Thr), AUC (Ile), UUC (Phe), GCC (Ala), and GCA (Ala).

Table 5.

Codon number and RSCU of O. ovale mitochondrial PCGs.

AA Codon Count RSCU AA Codon Count RSCU
Phe UUU(F) 74 0.66 Tyr UAU(Y) 34 0.58
Phe UUC(F) 149 1.34 Tyr UAC(Y) 83 1.42
Leu UUA(L) 73 0.70 Stop codon UAA 6 3.43
Leu UUG(L) 16 0.15 Stop codon UAG 1 0.57
Leu CUU(L) 85 0.81 His CAU(H) 23 0.45
Leu CUC(L) 114 1.09 His CAC(H) 80 1.55
Leu CUA(L) 284 2.71 Gln CAA(Q) 99 1.89
Leu CUG(L) 57 0.54 Gln CAG(Q) 6 0.11
Ile AUU(I) 128 0.89 Asn AAU(N) 27 0.44
Ile AUC(I) 159 1.11 Asn AAC(N) 95 1.56
Met AUA(M) 118 1.40 Lys AAA(K) 69 1.79
Met AUG(M) 50 0.60 Lys AAG(K) 8 0.21
Val GUU(V) 44 0.80 Asp GAU(D) 14 0.39
Val GUC(V) 44 0.80 Asp GAC(D) 58 1.61
Val GUA(V) 106 1.92 Glu GAA(E) 87 1.74
Val GUG(V) 27 0.49 Glu GAG(E) 13 0.26
Ser UCU(S) 40 1.03 Cys UGU(C) 9 0.69
Ser UCC(S) 49 1.26 Cys UGC(C) 17 1.31
Ser UCA(S) 88 2.26 Trp UGA(W) 106 1.77
Ser UCG(S) 5 0.13 Trp UGG(W) 14 0.23
Pro CCU(P) 22 0.41 Arg CGU(R) 11 0.58
Pro CCC(P) 63 1.18 Arg CGC(R) 13 0.68
Pro CCA(P) 123 2.30 Arg CGA(R) 45 2.37
Pro CCG(P) 6 0.11 Arg CGG(R) 7 0.37
Thr ACU(T) 33 0.42 Ser AGU(S) 12 0.31
Thr ACC(T) 117 1.48 Ser AGC(S) 40 1.03
Thr ACA(T) 159 2.01 Stop codon AGA 0 0.00
Thr ACG(T) 8 0.10 Stop codon AGG 0 0.00
Ala GCU(A) 55 0.65 Gly GGU(G) 28 0.46
Ala GCC(A) 141 1.66 Gly GGC(G) 48 0.79
Ala GCA(A) 135 1.59 Gly GGA(G) 125 2.05
Ala GCG(A) 8 0.09 Gly GGG(G) 43 0.70

Figure 2.

Figure 2

Relative synonymous codon usage of all PCGs in the mitogenome of O. ovale.

3.3. Selective Pressure Analysis

In order to investigate the selective pressure on 13 PGCs of 29 Acrossocheilinae species, we calculated the non-synonymous substitutions rate (Ka) to the synonymous substitutions rate (Ks) ratio (Ka/Ks). The Ka/Ks ratios of all PCGs were far lower than one (Figure 3), indicating that all of the PCGs were evolving under strong purifying selection in these species [28]. The ND6 gene exhibited the highest ratio (Ka/Ks = 0.133) of all the PCGs, whereas the COI gene had the lowest ratio (Ka/Ks = 0.01).

Figure 3.

Figure 3

The Ka, Ks, and Ka/Ks values for each PCG from 29 Acrossocheilinae species mitogenomes.

3.4. Transfer RNAs, Ribosomal RNAs, and Control Region

The mitogenome of O. ovale consisted of 22 tRNA genes individually ranging in size from 67 to 76 bp, representing 9.4% (1563 bp) of the entire mitogenome (Table 3). Among the 22 tRNA genes, 14 tRNA genes were encoded on the H strand, while 8 tRNA genes were encoded on the L strand (Table 3), and this distribution was similar to that observed in other Acrossocheilus species [29,30]. All tRNA genes were predicted to fold into the typical cloverleaf secondary structures except that the tRNASer(AGY) lacked the dihydrouridine (DHU) arm (Figure S1), which has been reported in most bony fish [31,32]. The A + T content of the 22 tRNA genes was 55.60%, with a positive A + T skew (0.03) and G + C skew (0.05).

There were two rRNA genes, a small ribosomal RNA (12S rRNA) gene and a large ribosomal RNA (16S rRNA) gene. The lengths of the 12S rRNA gene and the 16S rRNA gene were 959 bp and 1680 bp, respectively (Table 3). As in other vertebrates, they were located between tRNAPhe and tRNALeu and were separated from each other by tRNAVal (Figure 1). The A + T and G + C content of the two rRNA genes was 53.69% and 46.31% and the A + T skew and G + C skew were 0.29 and −0.10, respectively, suggesting an apparent bias toward the use of A and C.

The control region in the mitogenome is also known as the A + T-rich region and is essential for the initiation of mitogenome replication and transcription [26,33]. The control region of O. ovale is located between tRNAPhe and tRNAPro, with a total length of 945 bp (Figure 1; Table 3). An extend terminal associated sequence (ETAS), central conserved sequence block (CSB) domains containing three conserved sequence blocks (CSB-F, CSB-E, and CSB-D), and a variable domain consisting of three conserved sequence blocks (CSB-1, CSB-2, and CSB-3) were identified in the control region of O. ovale through a homology search (Figure S2).

3.5. Phylogenetic Analysis

The molecular phylogenetic trees of Acrossocheilinae were reconstructed using both ML and BI methods on the 13 concatenated protein-coding genes. Phylogenetic analyses inferred through BI and ML yielded a consistent topology. The phylogenetic trees showed that Acrossocheilinae could be divided into three distinct clades (Figure 4), which is congruent with previous studies [6,11]. Clade I included both Onychostoma (O. alticorpus, O. rarum, and O. ovale), Acrossocheilus (A. monticola and A. yunnanensis), and Folifer (F. brevifilis) (Figure 4). Clade II was composed of nine Onychostoma species. Clade III was composed of 14 Acrossocheilus species. The phylogenetic trees showed that O. ovale was most closely related to O. rarum, and they were grouped with other species belonging to clade I with high bootstrap support. Our phylogenetic results also supported that neither Onychostoma nor Acrossocheilus was a monophyletic group [11]. The phylogenetic trees suggested that the classification of Onychostoma and Acrossocheilus should be further evaluated and revised. The current molecular phylogenetic study of Onychostoma showed that it was a complex group. This implied a conflict between morphological and molecular phylogenetic classification. Therefore, in future studies, extensive taxon sampling and new types of molecular markers are needed.

Figure 4.

Figure 4

Phylogenetic estimate of relationships within the subfamily Acrossocheilinae based on the 13 PCGs using Bayesian inference (BI) and maximum likelihood (ML) analyses. The BI posterior probability (right) and ML bootstrap support values (left) are denoted at each node.

4. Conclusions

We obtained the mitogenome sequence of O. ovale by overlapping PCR, and its length was 16,602 bp. The mitogenome was composed of 37 genes (13 PCGs, 22 tRNA genes, and 2 rRNA genes) and a control region. The genome size, gene arrangement, codon usage, and nucleotide composition of O. ovale were similar to those of other fish reported previously. The mitogenome of O. ovale showed a clear A + T preference in base composition. Most of the PCGs started with the standard ATG codon and stopped with the termination codon TAA. Moreover, the Ka/Ks ratios were all less than 1, indicating that the PCGs of these Acrossocheilinae species were under purifying selection. The phylogenetic trees showed that Onychostoma and Acrossocheilus were classified into three clades. The results of this study can provide valuable genetic data for population genetic studies and phylogenetic analysis of Onychostoma and Acrossocheilus.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes14061227/s1. Figure S1: Secondary structure of the 22 tRNA genes of the mitochondrial genome of O. ovale; Figure S2: The structure and sequence of the control region of the O. ovale mitochondrial genome. The extend termination associated sequence domain (ETAS), the central conserved blocks (CSB-F, CSB-E, and CSB-D), and the conserved sequence block domains (CSB-1, CSB-2, and CSB-3) were identified and are shown in red font size, and the conserved sequences are shown underlined and with black font.

Author Contributions

Conceptualization, R.Z.; methodology, T.Z., R.Z. and Q.L.; software, R.Z., T.Z. and Q.L.; validation, R.Z. and T.Z.; formal analysis, R.Z. and T.Z.; investigation, R.Z. and Q.L.; resources, R.Z.; data curation, R.Z. and T.Z.; writing—original draft preparation, T.Z. and R.Z.; writing—review and editing, R.Z. and T.Z.; visualization, R.Z.; supervision, R.Z.; project administration, R.Z.; funding acquisition, R.Z. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The mitogenome was deposited at NCBI with the accession number NC_066040.

Conflicts of Interest

The authors declare no conflict of interest.

Funding Statement

This research was funded by the National Natural Science Foundation of China (31960097, 32160293), the Natural Science Foundation of Guizhou Educational Committee (QianjiaoheKY [2021]306), and the Undergraduate Research Training Program of Guizhou Normal University [DK2020A038].

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Xiao W.H., Zhang Y.P. Genetics and evolution of mitochondrial DNA in fish. Acta Hydrobiol. Sin. 2000;24:384–391. [Google Scholar]
  • 2.Satoh T.P., Miya M., Mabuchi K., Nishida M. Structure and variation of the mitochondrial genome of fishes. BMC Genom. 2016;17:719. doi: 10.1186/s12864-016-3054-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Brown K.H. Fish mitochondrial genomics: Sequence, inheritance and functional variation. J. Fish Biol. 2008;72:355–374. doi: 10.1111/j.1095-8649.2007.01690.x. [DOI] [Google Scholar]
  • 4.Zhang R., Deng L., Lv X., Tang Q. Complete mitochondrial genomes of two catfishes (Siluriformes, Bagridae) and their phylogenetic implications. Zookeys. 2022;1115:103–116. doi: 10.3897/zookeys.1115.85249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang R., Tang Q., Deng L. The complete mitochondrial genome of Microphysogobio elongatus (Teleostei, Cyprinidae) and its phylogenetic implications. Zookeys. 2021;1061:57–73. doi: 10.3897/zookeys.1061.70176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Yang L., Sado T., Hirt M.V., Pasco-Viel E., Arunachalam M., Li J., Wang X., Freyhof J., Saitoh K., Simons A.M., et al. Phylogeny and polyploidy: Resolving the classification of cyprinine fishes (Teleostei: Cypriniformes) Mol. Phylogenetics Evol. 2015;85:97–116. doi: 10.1016/j.ympev.2015.01.014. [DOI] [PubMed] [Google Scholar]
  • 7.Tan M., Armbruster J.W. Phylogenetic classification of extant genera of fishes of the order Cypriniformes (Teleostei: Ostariophysi) Zootaxa. 2018;4476:6–39. doi: 10.11646/zootaxa.4476.1.4. [DOI] [PubMed] [Google Scholar]
  • 8.Froese R., Pauly D., editors. FishBase. [(accessed on 8 January 2023)]. Available online: https://www.fishbase.org.
  • 9.Shan X., Lin R., Yue P., Chu X. Barbinae. In: Yue P., editor. Fauna Sinica, Osteichthyes, Cypriniformes (III) Science Press; Beijing, China: 2000. pp. 3–170. [Google Scholar]
  • 10.Zheng L.-P., Yang J.-X., Chen X.-Y. Molecular phylogeny and systematics of the Barbinae (Teleostei: Cyprinidae) in China inferred from mitochondrial DNA sequences. Biochem. Syst. Ecol. 2016;68:250–259. doi: 10.1016/j.bse.2016.07.012. [DOI] [Google Scholar]
  • 11.Wang I.-C., Lin H.-D., Liang C.-M., Huang C.-C., Wang R.-D., Yang J.-Q., Wang W.-K. Complete mitochondrial genome of the freshwater fish Onychostoma lepturum (Teleostei, Cyprinidae): Genome characterization and phylogenetic analysis. Zookeys. 2020;1005:57–72. doi: 10.3897/zookeys.1005.57592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wu L. The Fishes of Guizhou. Guizhou People’s Publishing House; Guiyang, China: 1989. [Google Scholar]
  • 13.Aljanabi S.M., Martinez I. Universal and rapid salt-extraction of high quality genomic DNA for PCR- based techniques. Nucleic Acids Res. 1997;25:4692–4693. doi: 10.1093/nar/25.22.4692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Iwasaki W., Fukunaga T., Isagozawa R., Yamada K., Maeda Y., Satoh T.P., Sado T., Mabuchi K., Takeshima H., Miya M., et al. MitoFish and MitoAnnotator: A Mitochondrial Genome Database of Fish with an Accurate and Automatic Annotation Pipeline. Mol. Biol. Evol. 2013;30:2531–2540. doi: 10.1093/molbev/mst141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bernt M., Donath A., Jühling F., Externbrink F., Florentz C., Fritzsch G., Pütz J., Middendorf M., Stadler P.F. MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol. Phylogenetics Evol. 2013;69:313–319. doi: 10.1016/j.ympev.2012.08.023. [DOI] [PubMed] [Google Scholar]
  • 16.Lowe T.M., Chan P.P. tRNAscan-SE On-line: Integrating search and context for analysis of transfer RNA genes. Nucleic Acids Res. 2016;44:W54–W57. doi: 10.1093/nar/gkw413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tamura K., Stecher G., Peterson D., Filipski A., Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013;30:2725–2729. doi: 10.1093/molbev/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhang D., Gao F., Jakovlić I., Zhou H., Zhang J., Li W.X., Wang G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020;20:348–355. doi: 10.1111/1755-0998.13096. [DOI] [PubMed] [Google Scholar]
  • 19.Perna N.T., Kocher T.D. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J. Mol. Evol. 1995;41:353–358. doi: 10.1007/BF01215182. [DOI] [PubMed] [Google Scholar]
  • 20.Rozas J., Ferrer-Mata A., Sánchez-DelBarrio J.C., Guirao-Rico S., Librado P., Ramos-Onsins S.E., Sánchez-Gracia A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017;34:3299–3302. doi: 10.1093/molbev/msx248. [DOI] [PubMed] [Google Scholar]
  • 21.Katoh K., Standley D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013;30:772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lanfear R., Frandsen P.B., Wright A.M., Senfeld T., Calcott B. PartitionFinder 2: New Methods for Selecting Partitioned Models of Evolution for Molecular and Morphological Phylogenetic Analyses. Mol. Biol. Evol. 2017;34:772–773. doi: 10.1093/molbev/msw260. [DOI] [PubMed] [Google Scholar]
  • 23.Nguyen L.-T., Schmidt H.A., Von Haeseler A., Minh B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015;32:268–274. doi: 10.1093/molbev/msu300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ronquist F., Teslenko M., van der Mark P., Ayres D.L., Darling A., Höhna S., Larget B., Liu L., Suchard M.A., Huelsenbeck J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice across a Large Model Space. Syst. Biol. 2012;61:539–542. doi: 10.1093/sysbio/sys029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Letunic I., Bork P. Interactive Tree Of Life (iTOL) v4: Recent updates and new developments. Nucleic Acids Res. 2019;47:256–259. doi: 10.1093/nar/gkz239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zhang D.-X., Hewitt G.M. Insect mitochondrial control region: A review of its structure, evolution and usefulness in evolutionary studies. Biochem. Syst. Ecol. 1997;25:99–120. doi: 10.1016/S0305-1978(96)00042-7. [DOI] [Google Scholar]
  • 27.Ojala D., Montoya J., Attardi G. tRNA punctuation model of RNA processing in human mitochondria. Nature. 1981;290:470–474. doi: 10.1038/290470a0. [DOI] [PubMed] [Google Scholar]
  • 28.Yang Z., Bielawski J.P. Statistical methods for detecting molecular adaptation. Trends Ecol. Evol. 2000;15:496–503. doi: 10.1016/S0169-5347(00)01994-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Hou X.-J., Lin H.-D., Tang W.-Q., Liu D., Han C.-C., Yang J.-Q. Complete mitochondrial genome of the freshwater fish Acrossocheilus longipinnis (Teleostei: Cyprinidae): Genome characterization and phylogenetic analysis. Biologia. 2020;75:1871–1880. doi: 10.2478/s11756-020-00440-y. [DOI] [Google Scholar]
  • 30.Chen I.-S., Han M., Wang C.-L., Shen C.-N. The complete mitochondrial genome of rainbow barbel Acrossocheilus barbodon (Nichols and Pope) (Teleostei, Cyprinidae, Barbinae) Mitochondrial DNA. 2015;26:145–146. doi: 10.3109/19401736.2013.819495. [DOI] [PubMed] [Google Scholar]
  • 31.Yu J.-N., Kim S., Kwak M. Complete mitochondrial genome sequence of a Korean Pungtungia herzi (Cypriniformes, Gobioninae) Mitochondrial DNA. 2014;25:414–415. doi: 10.3109/19401736.2013.809435. [DOI] [PubMed] [Google Scholar]
  • 32.Wang C., Ye P., Liu M., Zhang Y., Feng H., Liu J., Zhou H., Wang J., Chen X. Comparative Analysis of Four Complete Mitochondrial Genomes of Epinephelidae (Perciformes) Genes. 2022;13:660. doi: 10.3390/genes13040660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wolstenholme D.R. Animal Mitochondrial DNA: Structure and Evolution. Int. Rev. Cytol. 1992;141:173–216. doi: 10.1016/s0074-7696(08)62066-5. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The mitogenome was deposited at NCBI with the accession number NC_066040.


Articles from Genes are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES