The Transcription Factor CcRlm1 Regulates Cell Wall Maintenance and Poplar Defense Response by Directly Targeting CcChs6 and CcGna1 in Cytospora chrysosperma

ABSTRACT

Maintenance of cell wall integrity is important for fungal cell morphology against external stresses and even virulence. Although the transcription factor Rlm1 is known to play major regulatory roles in the maintenance of cell integrity, the underlying mechanism of how Rlm1 contributes to cell wall integrity and virulence in phytopathogenic fungi remains unclear. Here, we demonstrated that CcRlm1 plays important roles in cell wall maintenance and virulence in the poplar canker fungus Cytospora chrysosperma. Among putative downstream targets, CcChs6 (chitin synthase) and CcGna1 (glucosamine 6-phosphate N-acetyltransferase) were found to be direct targets of CcRlm1 and shown to function in chitin synthesis and virulence. Furthermore, we found stronger induction of poplar defense responses when challenged with these gene deletion mutants. Collectively, these results suggest that CcRlm1 plays a critical role in the regulation of cell wall maintenance, stress response, and virulence by directly regulating CcChs6 and CcGna1 in C. chrysosperma.

IMPORTANCE Cytospora chrysosperma causes canker diseases on woody plants, and the molecular basis of its infection is not well understood. This study shows that CcRlm1 is the major regulator of chitin synthesis and virulence of the poplar canker fungus. Our research contributes to further understanding the molecular basis of the interaction between C. chrysosperma and poplar.

INTRODUCTION

The cell wall is a highly dynamic structure providing rigidity and plasticity during fungal growth and development, and it changes with alterations in the surrounding environment (1). In plant pathogenic fungi, the cell wall is of particular importance for cell viability, morphogenesis, and pathogenesis (2). As a rigid but dynamic protective barrier, the fungal cell wall is constantly synthetized and remodeled to avoid recognition by plants as well as adapt to multiple environmental challenges during infection. Thus, the state and integrity of the fungal cell wall need accurate alteration during fungal infection, which involves fine transcriptional regulation, especially transcription factors (3).

The transcription factor Rlm1 is the key transcription regulator of cell wall integrity in fungi. It belongs to the MADS (Mcm1-agamous-deficiencyiciens-serum response factor)-box transcription factor family (4). In Magnaporthe oryzae, Mig1 (the ortholog of Rlm1) is important for cell wall modifications of secondary infectious hyphae (5). In Fusarium oxysporum, deletion of FoRlm1 downregulated the expression levels of multiple genes encoding chitin synthases (6). Although other studies have also reported the roles of Rlm1 orthologs (7, 8), how Rlm1 affects cell wall integrity and pathogenesis remains elusive.

The ascomycete Cytospora chrysosperma can infect dozens of woody plant species, including poplar, willow, and walnut (9). C. chrysosperma is the main causal agent of the poplar canker; it is widespread in poplar plantations and results in huge annual economic losses in northern China (10). One strategy used by C. chrysosperma to establish infection is the colonization first restricted to injured or dying bark in healthy poplar, then the hyphae rapidly and expansively spread in poplar stem once the tree vigor becomes weak (9, 11). Fungal cell walls play an essential role in plant-pathogen interactions (12). However, the maintenance of cell walls in C. chrysosperma and the role of fungal cell walls in plant infection remain unclear.

Here, we aimed to characterize the function of CcRlm1 in C. chrysosperma and to explore the potential molecular mechanism of CcRlm1. We demonstrated the role of CcRlm1 in the maintenance of cell wall integrity. Transcriptomic analysis and protein-DNA interaction revealed that two genes, CcChs6 and CcGna1, were direct targets of CcRlm1. Furthermore, our results showed that these gene deletion mutants exhibited altered chitin synthesis and attenuated virulence and triggered obvious induction of poplar defense responses.

RESULTS

CcRlm1 is involved in cell wall integrity and virulence.

CcRlm1 was identified in the genome of C. chrysosperma (NCBI accession number JAEQMF000000000) by the BLASTP tool. Phylogenetic analysis showed that Rlm1 is highly conserved in fungi. Two CcRlm1 deletion mutants (ΔCcRlm1-12 and ΔCcRlm1-19) were obtained by the split-marker method (see Fig. S1A and B in the supplemental material). Then, we generated a complemented strain (ΔCcRlm1-C) through the ectopic reintroduction of fragments containing the native promoter and the CcRlm1 coding sequence into the ΔCcRlm1 strains (Fig. S1A).

To determine whether CcRlm1 is involved in hyphal growth and cell wall integrity, we first assessed the growth rate and biomass of the different strains. As shown in Fig. 1A to C, compared with the wild-type and ΔCcRlm1-C strains, the ΔCcRlm1 strains showed a significant decrease in colony growth on Potato Dextrose Agar (PDA) and reduced dry weight on potato dextrose broth (PDB). Then, the sensitivity of the ΔCcRlm1 strains to cell wall-disrupting agents and osmotic-interfering agents was tested. The results showed that the sensitivity of the ΔCcRlm1 strains to Congo red (CR), calcofluor white (CFW), and NaCl was significantly increased compared to that of the wild-type and ΔCcRlm1-C strains (Fig. 1D and E). Furthermore, we examined the number of protoplasts released by cell wall-degrading enzyme digestion. At 1.5 h postdigestion, more protoplasts were released from the ΔCcRlm1 strains than from the other strains (Fig. 1F and G), suggesting that the cell walls of the ΔCcRlm1 strains are more susceptible to enzymatic degradation. In addition, transmission electron microscopy was used to examine cell wall structure. The thickness of the cell wall of the ΔCcRlm1 strains was approximately twice as thin as that of the wild-type and ΔCcRlm1-C strains (Fig. 1H and I). Thus, CcRlm1 is required for cell wall integrity in C. chrysosperma.

FIG 1.

CcRlm1 is involved in the cell wall integrity and virulence of Cytospora chrysosperma. (A) Colony morphology of the wild-type, ΔCcRlm1, and ΔCcRlm1-C strains after 24 h and 48 h of growth on PDA. Bar, 3 cm. (B) Comparison of hyphal growth rate of the above strains. (C) Dry biomass of the above strains in liquid PDB. (D) Sensitivity of the above strains to cell wall stress agents and osmotic stress agents. Bar, 3 cm. (E) Statistical analysis of the growth inhibition ratio under different chemical stresses. (F) Sensitivity of the above strains to cell wall-degrading enzymes. Bar, 25 μm. (G) Quantification of protoplast release. (H) Transmission electron microscopy analysis of conidia. Bar, 100 nm. (I) Cell wall thickness measurements. Values are expressed as the mean ± standard deviation (SD) of 30 sections of different conidia. (J) Expression levels of CcRlm1 during C. chrysosperma infection. (K) Canker symptoms on detached poplar twigs inoculated with the above strains. CK represents twigs inoculated with PDA plugs after scalding. (L) Lesion sizes on twigs at 5 dpi. All experiments were performed with three biological repeats, and each biological repeat was performed with three technical repeats. For CK treatment, agar plugs taken from PDA were used to inoculate twigs. Error bars in the figure, data are represented as the mean ± standard error (SE). Lowercase letters indicate significant differences at P < 0.05.

To explore the effect of CcRlm1 on the virulence of C. chrysosperma, we first focused on the expression pattern of CcRlm1 during the infection of the wild-type strain CN-1. The results showed that the expression level of CcRlm1 was low at the early stage of the infection (2 dpi), started to increase rapidly at 4 dpi, reached a maximum at 8 dpi, and then started to decline, suggesting that CcRlm1 was highly induced in the middle and late stages of the infection process (Fig. 1J). Furthermore, the virulence of the ΔCcRlm1 strains was examined using traditional lesion measurements, and the results revealed that the lesion length on poplar branches infected with the ΔCcRlm1 strains was approximately 3 cm, whereas the lesion length on poplar branches infected with the wild-type or ΔCcRlm1-C strains was approximately 4.8 cm (Fig. 1K and L), indicating that the ΔCcRlm1 strains exhibited reduced virulence.

CcRlm1 is involved in chitin synthesis by directly regulating CcChs6.

We further assessed the chitin level of the cell wall by CFW staining and acid hydrolysis to determine the relationship between CcRlm1 and chitin because chitin is necessary for fungal growth and virulence. These qualitative and quantitative data showed that chitins in the ΔCcRlm1 strains were significantly reduced (Fig. 2A and B). Fluorescein isothiocyanate (FITC)-conjugated wheat germ agglutinin (WGA) was also used to test the exposure of chitin on the surface of the cell wall via fluorescence microscopy. Compared to the wild-type and ΔCcRlm1-C strains, the ΔCcRlm1 strains exhibited increased WGA staining (Fig. 2C). To further determine whether the ΔCcRlm1 strains release more chitin oligosaccharide (CTOS) when infecting poplar stems, poplar bark was obtained and used for ion chromatographic determination. The results showed that the ΔCcRlm1 strains exhibited the highest concentration of CTOS (Fig. 2D; Table 1). Thus, these results indicate that CcRlm1 not only regulates chitin biosynthesis but also controls the release of CTOS during infection by reducing the exposure of chitin on the hyphal surface.

FIG 2.

CcRlm1 affects cell wall chitin. (A) Hyphal total chitin was assessed in the wild-type, ΔCcRlm1, and ΔCcRlm1-C strains via soluble CFW staining. Bar, 25 μm. (B) Cell wall chitin contents. (C) FITC-WGA was used to stain exposed chitin/chitooligomers. Bar, 50 μm. (D) Ion chromatogram of samples taken from the above strains. The ordinate represents the signal response (nC), and the abscissa represents the retention time (min). (E) Expression level of chitin synthase genes. (F) EMSA analysis of the interactions between CcRlm1 and the promoters of multiple chitin synthase genes. The HIS protein was used as a negative control. (G) The direct binding of CcRlm1 to the CcChs6 promoter was verified by EMSA. The wild-type probes contain the CcRlm1 binding site CTAAAAATAG of the CcChs6 promoter, and the binding site sequences of the mutant probe were replaced with AAAAAAAAAA. Plus (+) and minus (−) symbols represent presence or absence, respectively, and the (+++) symbol means increasing amounts compared to the (+) symbol. (H) Luciferase luminescence images from Nicotiana benthamiana leaves coinfiltrated with Agrobacterium tumefaciens strains containing CcChs6pro-Luc and CcRlm1-62-SK. All experiments were performed three times. Error bars in the figure, data are represented as the mean ± SE. Lowercase letters indicate significant differences at P < 0.05.

TABLE 1.

Types and concentrations of CTOS at the plant-pathogen interaction interface

CTOS	WT (μg/mg)	ΔCcRlm1 (μg/mg)	ΔCcRlm1-C (μg/mg)
(GlcNAc)2	1.5 ± 0.14	4.5 ± 0.18	1.45 ± 0.11
(GlcNAc)3	0	0	0
(GlcNAc)4	2.26 ± 0.2	3.48 ± 0.35	2.53 ± 0.17
(GlcNAc)5	2.56 ± 0.23	7.16 ± 0.47	2.9 ± 0.31
(GlcNAc)6	0	0	0
(GlcNAc)7	0	0	0
(GlcNAc)8	0	0	0
Total oligosaccharide concn	6.32	15.14	6.88

Previous studies have shown that Rlm1 can directly or indirectly regulate the genes encoding chitin synthases (6, 13, 14). There are seven chitin synthase genes in the genome of C. chrysosperma. The expression levels of seven chitin synthase genes (CcChs1 [GME1769_g], CcChs2 [GME842_g], CcChs3 [GME1925_g], CcChs4 [GME5614_g], CcChs5 [GME1116_g], CcChs6 [GME1115_g], CcChs7 [GME1261_g]) in each strain were examined. The expression levels of three chitin synthase genes (CcChs1, CcChs5, and CcChs6) were significantly decreased in the ΔCcRlm1 strains (Fig. 2E).

To clarify the relationship between CcRlm1 and chitin synthase genes in C. chrysosperma, we performed electrophoretic mobility shift assay (EMSA) for chitin synthase genes. EMSA results showed that the His-CcRlm1 fusion protein only directly bound to the labeled CcChs6 promoter sequence, which produced a dark binding stripe. By comparison, when using His alone, no binding band was detected (Fig. 2F and G). Binding specificity was verified by increasing amounts of the unlabeled competitor probes, rather than mutant probes, which resulted in a progressively lighter complex binding stripe (Fig. 2G). Next, to verify whether CcRlm1 could activate or repress the expression of the target CcChs6, a transient expression assay was conducted in Nicotiana benthamiana leaves. A luciferase reporter assay (LRA) revealed that CcRlm1 activated CcChs6 expression (Fig. 2H). The above results revealed that CcRlm1 activates the transcription of CcChs6 by binding the promoter.

CcChs6 participates in chitin synthesis and virulence.

According to analysis on the InterPro website (http://www.ebi.ac.uk/interpro), CcChs6 is classified as a class V chitin synthase enzyme because it contains an MMD (myosin motor domain) and CHS (chitin synthase) structural domain at its N terminus and C terminus, respectively. Herein, to determine the roles of CcChs6 in C. chrysosperma, we deleted CcChs6 by homologous recombination, then CcChs6 was reintroduced into the ΔCcChs6 strain (Fig. S1C and D). Growth assays revealed that the ΔCcChs6 strains showed irregular growth along with a reduced growth rate compared to that of the wild-type and ΔCcChs6-C strains (Fig. 3A to C). Then, we confirmed the involvement of CcChs6 in cell wall integrity, and the deletion of CcChs6 resulted in increased susceptibility to CFW and sodium dodecyl sulfate (SDS) (Fig. 3D and E). In contrast, the ΔCcChs6 strains showed a slightly higher tolerance to CR (Fig. 3D and E). Additionally, we found only a slight decrease in the chitin content of the ΔCcChs6 strains compared to the wild-type and ΔCcChs6-C strains (Fig. 3F), suggesting a limited effect of CcChs6 on chitin content. Moreover, virulence of the ΔCcChs6 strains was significantly reduced compared to that of the wild-type and ΔCcChs6-C strains (Fig. 3G and H). Therefore, CcChs6 is involved in chitin synthesis and is essential for the virulence of C. chrysosperma.

FIG 3.

CcChs6 is related to growth, cell wall integrity, and virulence in Cytospora chrysosperma. (A) Colony morphology of the wild-type, ΔCcChs6, and ΔCcChs6-C strains cultured on PDA at 24 h and 48 h. Bar, 3 cm. (B) Comparison of hyphal growth rate. (C) Dry biomass in liquid PDB. (D) Sensitivity of the above strains to cell wall stress agents and osmotic stress agents. Bar, 3 cm. (E) Statistical analysis of the growth inhibition ratio. (F) Cell wall chitin content. (G) Infection symptoms on detached poplar twigs. CK represents twigs inoculated with PDA plugs after scalding. (H) Lesion sizes on twigs at 5 dpi. All experiments were performed with three biological repeats, and each biological repeat was performed with three technical repeats. Error bars in the figure, data are represented as the mean ± SE. Lowercase letters indicate significant differences at P < 0.05.

CcRlm1 regulates genes implicated in cell wall biosynthesis and carbohydrate metabolism.

RNA sequencing (RNA-Seq)-based transcriptome analysis of wild-type and ΔCcRlm1 strains was used to further investigate the potential regulatory mechanisms of CcRlm1. The Venn diagram shows that of all predicted genes detected, 622 genes were expressed only in the wild-type strain, and 109 genes were expressed only in the ΔCcRlm1 strain (Fig. 4A). Additionally, 226 differentially expressed genes (DEGs) were identified between the wild-type strain and the ΔCcRlm1 strains in total, of which 191 genes were upregulated and 35 were downregulated with a fold change of ≥2 (Fig. 4B). Among the differentially expressed genes, two putative α-1,3-glucan synthase genes and three genes related to extension or branching of β-1,3-glucan chains were downregulated. Based on this result, we speculated that changes in cell wall-associated gene expression possibly cause composition rearrangements in the cell wall of ΔCcRlm1 strains. Then, phenol and sulfuric acid methods were used to determine changes in the content of other cell wall components of the ΔCcRlm1 strains, and the results showed that the α-glucan content of the cell wall of the ΔCcRlm1 strains was remarkably lower than that of the wild-type and ΔCcRlm1-C strains, while the deletion of CcRlm1 had no effect on the β-glucan content of the cell wall (Table 2). Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) enrichment showed that most differentially expressed genes were related to carbohydrate metabolism, cell wall biogenesis and remodeling, signaling, and stress response (Fig. 4C to E). We observed that genes related to carbohydrate catabolism, specifically, a group of genes encoding cellulases, glucose transporters, glucokinases, glycosyltransferases, and several genes involved in the galactose metabolic pathway, were significantly upregulated (see Fig. S2A in the supplemental material). The growth of the ΔCcRlm1 strains on different carbon source media verified the enrichment (Fig. S2B and C). Among the top 10 upregulated DEGs, five were involved in posttranslational modification, protein turnover, and chaperones; two were related to catalytic activity or cellular components; and the rest were uncharacterized (Table 3). Of the top 10 downregulated DEGs, three belonged to transferases, two were oxidoreductases, one was a kinase, one was a sulfate transporter, one encoded cytochrome synthesis, and two were involved in integral components of the membrane (Table 4). We found that one of these two genes involved in the integral component of the membrane is the chitin synthase gene CcChs6, and the other is a putative glucosamine 6-phosphate N-acetyltransferase gene GME7335_g (S. cerevisiae Gna1 ortholog). In conclusion, transcriptome data showed that CcRlm1 is mainly involved in nutrient utilization and metabolism as well as cell wall biosynthesis.

FIG 4.

RNA-seq analysis between the wild-type and ΔCcRlm1 strains. (A) Global view of expressed genes in the wild-type and ΔCcRlm1 strains. (B) Comparison of up- and downregulated DEGs between the wild-type and ΔCcRlm1 strains. (C) Bubble chart based on the results of KEGG pathway enrichment analysis of significantly upregulated genes. (D) Bubble chart based on the results of GO pathway enrichment analysis of significantly upregulated genes. (E) Bubble chart based on the results of GO pathway enrichment analysis of significantly downregulated genes. The horizontal coordinate is the GeneRatio, which is the ratio of genes of interest annotated in the entry to the number of all differentially expressed genes, and the vertical coordinate is each pathway entry. The size of the dot represents the number of differentially expressed genes annotated in the pathway.

TABLE 2.

Content of main cell wall components in wild-type, ΔCcRlm1, and ΔCcRlm1-C strains

Strain	α-Glucan (μg)	β-Glucan (μg)	Chitin (μg)
WT	75 ± 4	511 ± 17	179 ± 5
ΔCcRlm1-12	38 ± 3	488 ± 10	131 ± 8
ΔCcRlm1-19	40 ± 6	482 ± 9	128 ± 5
ΔCcRlm1-C	71 ± 7	503 ± 12	184 ± 6

TABLE 3.

Top 10 upregulated DEGs in ΔCcRlm1 strains

Gene ID	log2(FC)	Function/description	Putative CcRlm1-binding motif
GME5583	2.69	Hsp20/alpha crystallin family
GME8152	2.57	Glutathione-dependent formaldehyde-activating enzyme	AAATCTCATAATACACCG
GME6392	2.46	AAA domain (Cdc48 subfamily)
GME3472	2.32	Cellular component: integral component of membrane
GME6546	2.26
GME2306	2.26	Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD
GME2665	2.22
GME4213	2.22	Hsp90 protein	TTTTCTAGTAATTGACGA
GME8627	2.16	Hsp70 protein	ATTTGTATTAATTGACTG
GME4692	2.15	Domain of unknown function

TABLE 4.

Top 10 downregulated DEGs in ΔCcRlm1 strains

Gene ID	log2(FC)	Function/description	Putative CcRlm1-binding motif
GME8081	−2.62	Cytochrome P450
GME198	−2.20	Cellular component: integral component of membrane	GTTTCTATTTTTGGTTTC
GME5350	−2.16	Citrate synthase, C-terminal domain
GME127	−2.15	Sulfate permease family	GTTTCTAAAAATAACAAC; AACTCTAAAAAGAGCCAG; GTTGTTATTTTTAGAAAC
GME5348	−2.08	Oxidoreductase R1 OS
GME7335	−2.00	glucosamine-6-phosphate N-acetyltransferase	TTGTCTATAATTAGCATC
GME5349	−1.84	Oxidoreductase R2 OS
GME6990	−1.64	O-methyltransferase domain
GME1115	−1.57	Integral component of membrane	CACTCTAAAAATAGGGAC
GME1313	−1.48	Lipopolysaccharide kinase (Kdo/WaaP) family	AGTACTATATATAGCTAT; ATAGCTATATATAGTACT

CcGna1 is a novel downstream target of CcRlm1.

In fungi, chitin biosynthesis depends on chitin synthases, and the substrate of chitin synthase is UDP-GlcNAc (2). Glucosamine 6-phosphate N-acetyltransferase (Gna1) is a key component of the UDP-GlcNAc biosynthetic pathway. Gna1 belongs to the GNAT (Gcn5-related N-acetyltransferase) family and has a conserved acyltransferase structural domain (15). Due to the potential complexity of the Rlm1 regulatory network, we sought to confirm that CcGna1 may be another downstream target gene of CcRlm1. To test whether CcRlm1 can bind the promoter region of CcGna1 and activate the transcription of CcGna1, we performed EMSA and LRA, and the results confirmed our conjecture (Fig. 5A and B). Then, we obtained CcGna1 deletion strains (ΔCcGna1 strain) and complemented strains (ΔCcGna1-C strain) (Fig. S1E and F). The growth of the ΔCcGna1 strains was severely inhibited on PDA, and the ΔCcGna1 strains exhibited severe growth defects and tended to form dense colonies (Fig. 5C and D). The ΔCcGna1 strains also grew more slowly in PDB (Fig. 5E), and the chitin content was reduced by approximately 75% in the ΔCcGna1 strains, which proved that the deletion of CcGna1 had a great impact on the synthesis of chitin (Fig. 5F). Additionally, the sensitivity of the ΔCcGna1 strains to CR, CFW, SDS, and NaCl was tested. The ΔCcGna1 strains showed significantly increased sensitivity to CFW and CR, with ~38% and 29% inhibition ratios, respectively (Fig. 6A and B).

FIG 5.

Functional characterization of CcGna1. (A) The direct binding of CcRlm1 to the CcGna1 promoter was verified by EMSA. The wild-type probes contain the CcRlm1 binding site CTATAATTAG of the CcGna1 promoter, and the binding site sequences of the mutant probe were replaced with AAAAAAAAAA. Plus (+) and minus (−) symbols represent presence or absence, respectively, and the (+++) symbol means increasing amounts compared to the + symbol. (B) Luciferase luminescence images from N. benthamiana leaves coinfiltrated with A. tumefaciens strains containing CcGna1pro-Luc and CcRlm1-62-SK. (C) Colony morphology of the wild-type, ΔCcGna1, and ΔCcGna1-C strains cultured on PDA at 24 h and 48 h. Bar, 3 cm. (D) Comparison of hyphal growth rate. (E) Dry biomass in liquid PDB. (F) Cell wall chitin content. The above experiments were carried out three times, and the results were similar. Error bars in the figure, data are represented as the mean ± SE. Lowercase letters indicate significant differences at P < 0.05.

FIG 6.

GlcNAc rescues the cell wall and virulence phenotype due to the deletion of Gna1. (A) The wild-type, ΔCcGna1, and ΔCcGna1-C strains were inoculated on PDA media or PDA media appended with CFW, CR, SDS, or NaCl or PDA media supplemented with 10 mM GlcNAc or PDA media supplemented with 10 mM GlcNAc appended with CFW, CR, SDS, or NaCl and cultured at 25°C in darkness. Bar, 3 cm. (B) Statistical analysis of growth inhibition. (C) Infection symptoms on detached poplar twigs inoculated with the wild-type, ΔCcGna1, and ΔCcGna1-C strains. The plus (+) symbol represents the addition of 20 μL of 10 mM GlcNAc at the inoculation point. CK represents twigs inoculated with PDA plugs after scalding. (D) Lesion sizes on twigs at 5 dpi. All experiments were performed with three biological repeats, and each biological repeat was performed with three technical repeats. Error bars in the figure, data are represented as the mean ± SE. Lowercase letters indicate significant differences at P < 0.05.

Considering that Gna1 is responsible for the synthesis of the chitin precursor substance GlcNAc and the importance of this substance for filamentous fungi, we used exogenous supplementation of GlcNAc treatment when performing growth and cell wall integrity assays. The results showed that the cell wall phenotype of the ΔCcGna1 strains was completely rescued by GlcNAc, while the growth defect was partially rescued by GlcNAc (Fig. 6A and B). Furthermore, poplar branches inoculated with the ΔCcGna1 strains exhibited a slight reduction compared with the ΔCcGna1-C strain, and the addition of GlcNAc restored the virulence of the ΔCcGna1 strains (Fig. 6C and D); however, the addition of GlcNAc had no effect on the virulence of the wild-type and ΔCcGna1-C strains (Fig. 6C and D). These results demonstrated that CcGna1 is a novel target of CcRlm1 and plays roles in cell wall integrity and virulence.

The mutants led to a stronger poplar defense response.

To further determine poplar defense responses under challenge with these mutants, we examined typical plant defense response assays. First, the callose deposition assay showed that the ΔCcRlm1 strains triggered more obvious callose deposition compared to the wild-type, ΔCcRlm1-C, ΔCcChs6-C, and ΔCcGna1-C strains (Fig. 7A and B). In the measurement of reactive oxygen species (ROS) burst intensity, the ΔCcRlm1 and ΔCcChs6 strains induced similar ROS intensities, while the ΔCcGna1 strains did not differ from the ΔCcGna1-C strain in terms of ROS accumulation, although these mutants provoked a stronger ROS burst than the wild-type strain (Fig. 7C and D). In addition, the expression patterns of poplar pathogenesis-related (PR) proteins were determined by quantitative PCR (qPCR) (Fig. 8), and their expression of an apoplastic chitinase (PcCHI5 and PcCHI7) and a vacuolar chitinase (PcCHI4) was highly induced after infection by the ΔCcRlm1 strains (Fig. 8D to F). These results suggest that poplar defense responses were induced when inoculated with the mutants defective in cell wall integrity.

FIG 7.

Differences in host defense response after infection by Cytospora chrysosperma three single gene deletion strains. (A) Callose deposition on leaves of poplar inoculated with the wild-type, ΔCcRlm1, ΔCcChs6, ΔCcGna1, ΔCcRlm1-C, ΔCcChs6-C, and ΔCcGna1-C strains. Bar, 40 μm. (B) Quantification of callose intensity with ImageJ. (C) ROS accumulation on leaves of poplar inoculated with the above strains. The ice blue arrow indicates the ROS produced by heat wounds, and the red arrow indicates the ROS activated by the strains. Bar, 20 μm. (D) Quantification of ROS intensity with ImageJ. All experiments were performed with three biological repeats, and each biological repeat was performed with at least three technical repeats. Error bars in the figure, data are represented as the mean ± SE. Lowercase letters indicate significant differences at P < 0.05.

FIG 8.

Expression patterns of Populus canadensis defense-related genes during infection with Cytospora chrysosperma three single gene deletion strains. (A to C) Expression of PR-1 genes in the host at 1 (A), 2 (B), and 5 (C) days after inoculation with the wild-type, ΔCcRlm1, ΔCcChs6, ΔCcGna1, ΔCcRlm1-C, ΔCcChs6-C, and ΔCcGna1-C strains. (D to F) Expression of chitinase genes of the host at 1 (D), 2 (E), and 5 (F) days after inoculation with the above strains. All experiments were performed with three biological repeats, and each biological repeat was performed with at least five technical repeats. For CK treatment, agar plugs taken from PDA were used to inoculate twigs. Error bars in the figure, data are represented as the mean ± SE. Lowercase letters indicate significant differences at P < 0.05.

DISCUSSION

As a MADS-box transcription factor, the contribution of Rlm1 to cell wall integrity and virulence has been demonstrated in several pathogenic fungi (6, 8, 14). Here, we identified CcRlm1 in C. chrysosperma and revealed functional roles of CcRlm1 and the CcRlm1-dependent genes CcChs6 and CcGna1. In this study, the deletion of CcRlm1 resulted in inhibited growth of C. chrysosperma but had no effect on mycelial morphology or sporulation. Consistent with our results, in Fusarium verticillioides, knockout of Rlm1 significantly reduced the growth rate of aerial hyphae and affected the normal development of ascospores (16). However, in Candida albicans, the deletion of the Rlm1 homolog did not affect the biomass accumulation of the strain in liquid culture and filamentous growth in solid culture (17). Our data showed that the ΔCcRlm1 strains have increased sensitivity to the cell wall inhibitors CR and CFW compared to the wild-type strain. Similarly, knockdown of RlmA caused sensitivity to CR, CFW, and SDS in Aspergillus fumigatus (13). In contrast, the Saccharomyces cerevisiae ΔRlm1 strain showed enhanced resistance to CFW but unchanged resistance to CR and caspofungin (18, 19). These results suggest that Rlm1 maintains species-specific function in fungal growth and cell wall integrity.

In several fungal pathogens, α-1,3-glucan accumulation on the cell wall surface has been proven to evade host immunity (20, 21). Deletion of CcRlm1 led to a reduced content of α-glucan by decreasing the expression of α-1,3-glucan synthases, which might trigger plant immunity. ROS accumulation and callose deposition can be triggered by the recognition of multiple pathogen-associated molecular patterns (PAMPs) through plant pattern recognition receptors (22). CTOS is considered a PAMP-produced hydrolytic enzyme such as chitinases (23). The ΔCcRlm1 strain exhibited induced expression of poplar defense response-related genes upon infection; however, deletion of CcRlm1 resulted in a decreased content of cell wall chitin, indicating that the release of CTOS might be far beyond degradation by plant-derived chitinases. Fungal pathogens have evolved multiple ways to escape plant recognition. For example, Cladosporium fulvum Ecp6 interferes with chitin perception by sequestering CTOS, and Verticillium dahliae PDA1 attenuates the induction of plant immunity by deacetylating chitin oligomers into chitosan (24, 25). Due to the complexity of the cell wall structure, the chitin of pathogenic fungi is often difficult to directly sense by host receptors (26). In the ΔCcRlm1 strain, cell wall perturbation leads to an increase in exposed chitin on the surface of the mycelium, which may be the main reason for the increased release of CTOS.

Previous studies have shown that Rlm1 is associated with chitin synthesis by directly or indirectly regulating gene expression (27, 28). CcChs6 encodes a chitin synthase belonging to the class V chitin synthase, and its promoter was predicted to contain putative Rlm1p binding motifs in fungal pathogens such as A. fumigatus and M. oryzae (13, 29). Herein, we verified that CcRlm1 can directly bind to the promoter of CcChs6 to regulate gene expression. CcChs6 is important for the mycelial growth, virulence, and cell wall integrity of C. chrysosperma, but deletion of CcChs6 slightly decreased the content of chitin in the cell wall, indicating that the regulation of CcRlm1 to the content of chitin in the cell wall is dependent on other genes. Gna1 encodes a glucosamine 6-phosphate N-acetyltransferase related to the synthesis of chitin precursor substances (15). It is essential for fungal viability and virulence in C. albicans and A. fumigatus (30, 31). Herein, we revealed that CcGna1 is a novel downstream target gene of CcRlm1, and deletion of CcGna1 severely reduced the content of chitin in the cell wall. Both CcChs6 and CcGna1 are important for mycelial growth, virulence, and cell wall integrity and are involved in chitin synthesis in C. chrysosperma, but CcChs6 likely maintains the normal morphology of mycelium by directly participating in cell wall construction (data not shown), while the role of CcGna1 is relatively indirect by controlling chitin biosynthesis to limit chitin accumulation.

In our study, both the ΔCcChs6 strain and the ΔCcGna1 strain showed reduced virulence, but the mechanisms by which these two strains attenuated their virulence may be completely different. The severely impaired virulence of the ΔCcChs6 strains is likely related to the critical role played by class V chitin synthase in the normal assembly of the cell wall. Our experiments revealed that the most commonly observed phenomenon in ΔCcChs6 strains were the drastic swelling of the hyphae and the massive outflow of intracellular content (data not shown). In fact, the role of class V chitin synthases of plant pathogenic fungi during infection has been extensively studied; for example, class V chitin synthase gene deletion from F. oxysporum, M. oryzae, and Ustilago maydis all cause difficulties in completing the penetration and invasion of host cells (29, 32, 33). In most species of fungi, chitin is vital for cell wall rigidity, and mutants with very low chitin content may be nonviable (34, 35). For ΔCcGna1 strains, although the accumulation of GlcNAc in vivo was inhibited by the deletion of CcGna1 and eventually affected the synthesis of chitin, the virulence of ΔCcGna1 strains was only slightly reduced compared to the wild-type strain. In plants, GlcNAc is present in small amounts as a glycosylated protein (36), and it has been proven that Cryptococcus neoformans is able to metabolize exogenous GlcNAc as a source of carbon (37). Similarly, a GlcNAc transporter protein has been identified in C. albicans, which gives C. albicans the ability to fully utilize exogenous GlcNAc (38). Therefore, the uptake of GlcNAc from the environment during infection may be essential for the survival and pathogenicity of the C. chrysosperma ΔCcGna1 strain.

In summary, our studies revealed that CcRlm1 is involved in chitin synthesis and virulence by binding to the promoters of CcChs6 and CcGna1. This study contributes to further understanding the virulence mechanism of C. chrysosperma and provides insight into the regulatory molecular mechanism of CcRlm1-dependent cell wall integrity and virulence. However, relatively less attention has been given to other components of the cell wall compared to chitin. Therefore, more research is needed to further clarify C. chrysosperma cell wall biosynthesis and modification and to identify more downstream genes directly regulated by CcRlm1 that play key roles in cell wall integrity and plant-pathogen interactions.

MATERIALS AND METHODS

Fungal strains and plant culture conditions.

The wild-type C. chrysosperma strain (CFCC 89981) isolated from Populus was used in this study. The C. chrysosperma wild-type strain, three single gene deletion strains, and all complemented strains were generally grown on PDA at 25°C or PDB (potato dextrose broth) with shaking at 150 rpm and 25°C.

N. benthamiana was grown in a greenhouse at 22°C under long days (16-h light/8-h dark), and 4- to 6-week-old plants were used for the luciferase reporter assay.

Construction of deletion and complemented mutants.

The targeted gene deletion mutants were generated using a split-marker method combined with PEG-mediated protoplast transformation. The upstream (1,571 bp) and downstream (1,071 bp) flanking sequences of target genes were cloned from genomic DNA (gDNA) using primers. Then, both flanking fragments were fused to the hygromycin fragment by fusion PCR. The recombinant DNA fragments were used directly for protoplast transformation after sequencing analysis, and the transformants from TB₃ medium supplemented with 35 μg/mL hygromycin were screened by PCR assays with specific primers. To confirm whether the target gene was correctly replaced, southern blotting was performed with the DIG High Prime DNA labeling and detection starter kit I (Roche, Germany). Two single-copy homologous recombination mutants were obtained per gene.

PCR with the primer pair CcRlm1-CF/CcRlm1-CR, CcChs6-CF/CcChs6-CR, or CcGna1-CF/CcGna1-CR was used to amplify fragments containing the open reading frame and its native promoter and terminator regions to complement the CcRlm1, CcChs6 and CcGna1 knockout strain, respectively. The PCR products were cotransformed with a Geneticin-resistant cassette into protoplasts of the corresponding mutant strain, and the transformants were selected on PDA medium supplemented with 35 μg/mL hygromycin and 50 μg/mL Geneticin. Successful complementary strains were confirmed by PCR with specific primers. All primers used are listed in Table 5 in the supplemental material.

TABLE 5.

Sequences and related information of the primers used in this study

Primer name	Sequence	Purpose
CcRlm1-5Ffor	CGAGCCACTGTTAATGAGCC	CcRlm1 5′ flanking sequence
CcRlm1-5Frev	AGATGCAGGTGGACTCGAAA
CcRlm1-3Ffor	GTATGGCATCGGAGTCAGGA	CcRlm1 3′ flanking sequence
CcRlm1-3Frev	TCTGGGCAGCATACACAAGA
YG-F	CGTTGCAAGACCTGCCTGAA	Hygromycin-resistance cassette
HY-R	GGATGCCTCCGCTCGAAGTA
Combinatorial-CcRlm1for	CGTTGGTAGGACAGAAGGGT	Validation of mutant deletion
Combinatorial-CcRlm1rev	AACGTTAAGTGGATCCCGGT
Internal-CcRlm1for	CTCAACACTTCCAAGGCCAG	Internal sequence used for validation of mutant
Internal-CcRlm1rev	GACTTGGTGCCTGTGAATGG
CcRlm1-CF	TCGAGGAGGGGTCTGAACTA	Amplification of CcRlm1 gene containing its native promoter and terminator regions
CcRlm1-CR	GACTCCGATGCCATACCTCA
ProbeCcRlm1for	CACCGCGACGTCTGTCGAGAAG	Southern blot probe of CcRlm1
ProbeCcRlm1rev	GGACGATTGCGTCGCATCGA
CcGna1-5Ffor	AATCCCCTCTATGATGCCCC	CcGna1 5′ flanking sequence
CcGna1-5Frev	TAGTGCGCATACAGAACCCT
CcGna1-3Ffor	AACCAAGAGAAGTGCGAGGA	CcGna1 3′ flanking sequence
CcGna1-3Frev	CTATACTGTGCGGCAAACCC
External-CcGna1for	GAGCATGTGACGGTGATGAC	External sequence used for validation of mutant
External-CcGna1rev	GTAGGGGCGCTCAGTAGATT
Internal-CcGna1for	CTTCCACCCAGACCACAGAA	Internal sequence used for validation of mutant
Internal-CcGna1rev	CCCCAACAGTAGTGAGGACA
CcGna1-CF	CGATCAGCTCTACTCCTGCA	Amplification of CcGna1 gene containing its native promoter and terminator regions
CcGna1-CR	TTGTTCCAGCTCATTTGCCC
ProbeCcGna1for	GCGCCGATGGTTTCTACAAA	Southern blot probe of CcGna1
ProbeCcGna1rev	CCCAAGCTGCATCATCGAAA
CcChs6-5Ffor	TCGGGAGTGTCTTGAAAGCT	CcChs6 5′ flanking sequence
CcChs6-5Frev	TGCTCATCACTGCCCAAAAC
CcChs6-3Ffor	GCAACCATCTTGTGCTGACA	CcChs6 3′ flanking sequence
CcChs6-3Frev	GAGGTCGACATCAGGCTGTA
External-CcChs6for	CTGACTTGTTGGTGTGGTGG	External sequence used for validation of mutant
External-CcChs6rev	TCAACCCCTTCTCCATCACC
Internal-CcChs6for	TCGTACCGATATGCAGCTGT	Internal sequence used for validation of mutant
Internal-CcChs6rev	CCAACTCCACCTTCTCCCTT
CcChs6-CF	TCGGGAGTGTCTTGAAAGCT	Amplification of CcChs6 gene containing its native promoter and terminator regions
CcChs6-CR	TCAACCCCTTCTCCATCACC
RT-CcRlm1for	CTAACAGCCTACGTGTCGGT	qRT-PCR of CcRlm1
RT-CcRlm1rev	CACCAGGTCGTGTTGTTTGA
RT-CcChs1for	TGGAGGTGTTCTACTGCTGG	qRT-PCR of CcChs1
RT-CcChs1rev	CACATCGTGCCAGTTGTTGA
RT-CcChs2for	ACCAGTTCATCCAGCTCCTC	qRT-PCR of CcChs2
RT-CcChs2rev	GATGGCGAAGATGTACGAGC
RT-CcChs3for	ACTTGTTCTCCAGCGTCGTA	qRT-PCR of CcChs3
RT-CcChs3rev	ACCACGCGAAGATCATGTTG
RT-CcChs4for	GCACCTTCATCCGATCACAC	qRT-PCR of CcChs4
RT-CcChs4rev	TACATGGGATTCGGGTGGAG
RT-CcChs5for	GAGGCAAGCGTGATTCTCAG	qRT-PCR of CcChs5
RT-CcChs5rev	CGGACACATGTATCGGCATC
RT-CcChs6for	TGCGCAAACTTGAATTCCCA	qRT-PCR of CcChs6
RT-CcChs6rev	CTTGACGGTGGTTGTGGTTT
RT-CcChs7for	CGTCATCGTCATGCCTTGTT	qRT-PCR of CcChs7
RT-CcChs7rev	AGCTTCTCGATGGTGGTCAA
RT-CcActinfor	TCGGTATGGGTCAGAAGGAC	qRT-PCR of CcActin
RT-CcActinrev	GGAGCCTCAGTCAACAGGAC
RT-PcCHI4for	AATTATGGGCTATGCGGAGACGA	qRT-PCR of PcCHI4
RT-PcCHI4rev	CCAGTGATGACTGCGTGACAAGA
RT-PcCHI5for	CCTGTGGCTCATGCTTCGGGAT	qRT-PCR of PcCHI5
RT-PcCHI5rev	CCCGTAAGTTTCCCTCCGCTGGT
RT-PcCHI7for	CGGTTTGGTAGGATTGGTTCGGT	qRT-PCR of PcCHI7
RT-PcCHI7rev	CGTCGCAGTAGTCCCTTGATGGT
RT-PcPR1-1for	CCACTAACCTGGGACACC	qRT-PCR of PcPR1-1
RT-PcPR1-1rev	GTAAGCCTTCTCATCAAC
RT-PcPR1-3for	TGTGGGTTGATGAGAAAT	qRT-PCR of PcPR1-3
RT-PcPR1-3rev	CCAGAGGGAGCATAGTTG
RT-PcPR1-4for	TATCCCTAATCCTTCCCTC	qRT-PCR of PcPR1-4
RT-PcPR1-4rev	CTTGCACCGTGTTGTCCC
RT-EF1-alphafor	CCGTTGCTGTGGGAGTTATCAAG	qRT-PCR of EF1-alpha
RT-EF1-alpharev	GGCAGCAGATTTGGTCACCTTAG
CcRlm1-62SKfor	GCGGTGGCGGCCGCTCTAGAATGGGTCGCAGAAAGATTGA	Cloning of CcGna1 cDNA
CcRlm1-62SKrev	TCCTGCAGCCCGGGGGATCCATTCCCAACCTTGAGTCTTT
CcGna1pro-0800for	TCGAATTCCTGCAGCCCGGGGTAGGCAGCCAAGGTTGTTC	Cloning of CcGna1 promoter sequences
CcGna1pro-0800rev	GCTCTAGAACTAGTGGATCCGGACAGCCAACAAAGGGAAA
CcChs6pro-0800for	TCGAATTCCTGCAGCCCGGGCGAAGTGGTGGAGAGAGTGT	Cloning of CcChs6 promoter sequences
CcChs6pro-0800rev	GCTCTAGAACTAGTGGATCCTCCCAGTTCACACCAAGTCA
CcRlm1-PET28afor	AGCAAATGGGTCGCGGATCCATGGGTCGCAGAAAGATTGA	Cloning of CcRlm1 cDNA
CcRlm1-PET28arev	TGTCGACGGAGCTCGAATTCATTCCCAACCTTGAGTCTTT
EMSAProbeCcGna1	CTCTCCTGTGCTTGTCTATAATTAGCATCAACCTTCAGCC	The probe for EMSA
EMSAmutantProbe CcGna1	CTCTCCTGTGCTTGTAAAAAAAAAACATCAACCTTCAGCC
EMSAProbeCcChs6	CCTGCCAGTGCCACTCTAAAAATAGGGACGGACATTGACA
EMSAmutantProbeCcChs6	CCTGCCAGTGCCACTAAAAAAAAAAGGACGGACATTGACA

Growth, conidiation, and sensitivity assays.

Vegetative growth and dry weight assays were performed as previously described to compare differences among several strains (39). Conidia yield was quantified by the number of conidia produced 45 days after inoculation on PDA plates. To investigate glucose and galactose metabolism, four strains were tested in CM (complete medium) or in MM (minimal medium) supplemented with 10 mM glucose or galactose, and colony diameter was measured 3 days after inoculation. To evaluate the sensitivity response, 2-day-old hyphal plugs derived from the leading edge of the colonies were inoculated in the center of PDA plates containing cell wall stressors (CR, CFW, SDS) or hypertonic stress agent (NaCl). The radial diameter of the fungal colonies was measured after incubation at 25°C for 3 days. The inhibition rate is equal to the diameter of the control group minus the diameter of the treatment group as a percentage of the diameter of the control group. To assess the capacity of the ΔCcRlm1 strains to release protoplasts in a lytic cocktail containing cell wall-degrading enzymes (0.1 g of lysing enzyme [Sigma, USA], 0.5 g of Driselase [Sigma, USA], and 20 mL of 1.2 M KCl), the mycelium of the wild-type and other strains cultured in PDB for 2 days were filtered through two layers of Miracloth and dried with filter paper. Then, 0.3 g of mycelium was weighed and incubated in 20 mL of lytic cocktail at 30°C. The released protoplasts were counted by a hemocytometer.

All assays were repeated three times, and all data were analyzed by one-way analysis of variance (ANOVA) and Duncan’s range test in SPSS 26.0 to measure specific differences between strains. A P value of <0.05 or <0.01 was used to determine the differences.

Determination of cell wall structure and components.

To compare differences in cell wall structure, conidia of the wild-type and other strains were collected by centrifugation and prefixed with 2.5% glutaraldehyde at 4°C for 36 h. Conidia were washed four times in 0.1 M phosphate buffer, postfixed in 1% OsO₄ for 2 h at room temperature, then 15 min in ethanol 30, 50, 70, 80, 90, 95, and 100%, followed by pure acetone for 20 min. All samples were transferred to ethylene oxide and embedded in Spurr resin (NSA [Nonenyl Succinic anhydride], 5 g; ERL4224 [cycloaliphatic epoxide resin], 2 g; DER736 [Diglycidyl ether of polypropyleneglycol], 1.6 g; DMAE [Dimethylaminoethanol], 0.06 g) for embedding and polymerization of the samples. The processed samples were thin sectioned with an ultramicrotome to approximately 60 to 90 nm. Thin sections were mounted on copper grids and stained with lead citrate (2%) and uranyl acetate (1%). Digital images were observed and acquired on an FEI Tecnai G2 Twin transmission electron microscope equipped with an Eagle digital camera (EMSIS, Germany). The cell wall thickness of the different conidia sections was measured using ITEM 5.0 software analysis.

To stain exposed chitin on the surface of the cell wall, hyphae were incubated with 30 μg/mL FITC-labeled wheat germ agglutinin (MKbio, China) for 20 min in the dark. To stain for total chitin, hyphae were stained with 20 μg/mL CFW for 15 min in the dark. Fluorescent images were visualized with a Carl Zeiss Imager Z1 fluorescence microscope.

To determine the content of the major components of the cell wall, fungal mycelia harvested from the PDB were ground in liquid nitrogen and added to 50 mM Tris/HCl buffer (containing 80 mM β-mercaptoethanol, 100 mM EDTA, 1 mM phenylmethylsulfonyl fluoride [PMSF], and 2% SDS). The suspension was boiled for 10 min, centrifuged at 13,000 rpm, washed three times with deionized water, and then dried completely in FreeZone 4.5-L freeze dryer (Labconco, USA). Chitin was determined by measuring the acid-released glucosamine from chitin of the cell wall using p-dimethylaminobenzaldehyde as a chromogen. For each 5 mg of the dried cell wall, 1 mL of 6 M HCl was added. After hydrolysis at 100°C for 4 h, the pH of the hydrolysate was adjusted to 7.0 with 10 N NaOH. An aliquot (0.2 mL) of the resulting mixture was added to 0.25 mL of 4% acetylacetone in 1.25 M sodium carbonate and heated for 30 min at 100°C. After cooling the mixture, 2 mL anhydrous ethanol was added, and the mixture was heated for 10 min at 60°C. Then, the mixture was heated for 1 h at 60°C in the dark after adding 0.25 mL of Ehrlich reagent (Solarbio, China). Absorbance readings were taken at 525 nm using a spectrophotometer (Pgeneral, China). Chitin content was quantified using a standard curve of 0 to 200 ng glucosamine (Solarbio, China). The concentrations of β-glucans and α-glucans were quantified from the glucose released using the phenol/sulfuric acid method, as previously described (40). All experiments were carried out in triplicate.

RNA extraction and reverse transcriptase quantitative PCR analysis.

Total RNA was extracted with TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions. Total RNA quality was examined by agarose gel electrophoresis, and total RNA concentration was detected by NanoDrop 2000 (Thermo Scientific, USA). cDNA was synthesized using an ABScript II cDNA fist-strand synthesis kit (ABclonal, China) according to the manufacturer’s instructions. All quantitative real-time PCR assays were conducted with SuperReal Premix Plus (TIANGEN, China) using an ABI 7500 real-time PCR system (Applied Biosystems, USA). Each gene assay was performed in biological triplicate with three independent technical replicates each. The relative expression of genes was calculated by using the 2^−ΔΔCT method.

To examine the expression level of putative chitin synthase genes, hyphae of the wild-type and other derivative strains were cultured in PDB at 25°C for 2 days. All RNA was extracted after filtering through two layers of Miracloth. To investigate how the expression level of CcRlm1 changes during C. chrysosperma infection of poplar, RNA samples were extracted from twig tissues inoculated with the C. chrysosperma wild-type strain at 0, 2, 4, 8, and 12 dpi. The CcActin gene served as an endogenous control for the above two reverse transcriptase quantitative PCR (qRT-PCR) assays.

To verify the expression of two classes of PR genes in Populus canadensis, RNA samples were extracted at 1, 2, and 5 dpi from twig tissues inoculated with wild-type C. chrysosperma and other strains. An EF1-alpha gene was used as an internal control (GenBank accession no. XM_002316315).

Virulence assay.

A virulence assay was performed using healthy twigs of annual poplar of P. canadensis from the nursery garden of Beijing Forestry University. After picking, the fresh twigs were cut into 15-cm segments, the surface was wiped with 75% alcohol, and then the morphological upper ends of the branches were sealed with paraffin. Because C. chrysosperma is a weak parasitic pathogen, wounds need to be artificially created on the twigs before inoculation. In short, twigs were scalded with a 5-mm diameter hot iron rod and then inoculated with 5-mm agar plugs taken from the leading edge of colonies of wild-type and other derivative strains that had been cultured for 2 or 3 days. After inoculation, clean plastic wraps were used to seal the twigs. To maintain appropriate humidity, all twigs were grown in trays containing distilled water at room temperature in the dark and watered three times a day. Lesions were photographed and measured at 5 dpi. The experiments were repeated three times, with at least 25 twigs for each strain.

Transcriptome analysis.

Fungal mycelial plugs of the wild-type and ΔCcRlm1 strains were inoculated into 200 mL PDB and cultured at 150 rpm for 5 days. Fungal mycelia were collected with 2 layers of Miracloth and then sent to Biomarker Technologies (Beijing, China) for RNA extraction and RNA-seq. There were three biological replicates using each strain. For quality control, raw data (raw reads) in fastq format were first processed through in-house perl scripts. In this step, clean data (clean reads) were obtained by removing reads containing adapter, reads containing ploy-N, and low-quality reads from raw data. At the same time, the Q20, Q30, GC content, and sequence duplication level of the clean data were calculated. All downstream analyses were based on clean data with high quality. To screen for differentially expressed genes, differential expression analysis was performed using DESeq2 (41). Genes with a fold change of ≥2 and a P value of <0.05 were considered significant DEGs. GO (http://geneontology.org) and KEGG (https://www.genome.jp/kegg) enrichment analyses of differentially expressed genes were implemented by the clusterProfiler R package. The enrichment results of GO and KEGG were visualized by the ggplot2 R package. In addition, the gene expression heatmap in this study was standardized and made by TBtools (42).

Electrophoretic mobility shift assay.

The cDNAs encoding full-length CcRlm1 were cloned into PET28a to generate His-fusion recombinant vectors, which were then transformed into Escherichia coli BL21(DE3) for prokaryotic expression. Then, 0.6 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) was applied to induce the protein. His-fusion proteins were purified by affinity chromatography using Ni-nitrilotriacetic acid (Ni-NTA) beads (Smart-Lifesciences, China) based on the manufacturer's manual.

The 5′-biotin-labeled oligonucleotides of CcGna1, CcChs1, CcChs2, CcChs3, CcChs4, CcChs5, CcChs6, and CcChs7 were synthesized (Sangon, China) and used as probes in EMSA, while competition assays were performed using 50- and 200-fold molar excess unlabeled probes with the same or mutant sequences. EMSAs were performed according to the manufacturer's protocol in the chemiluminescent EMSA kit (Beyotime Biotechnology, China). Briefly, biotin-labeled probes and fusion proteins were mixed in binding buffer for 20 min at room temperature, and then the reaction products were electrophoresed on 4% polyacrylamide gels in 0.5× Tris-borate-EDTA (TBE) buffer at 4°C and imaged on ChemiDoc MP (Bio-Rad, USA).

Luciferase reporter assay.

The pGreenII 62-SK and pGreenII 0800LUC vectors were used for the luciferase reporter assay. Briefly, the CD region of CcRlm1 and the CcGna1/CcCHS6 promoter region were separately cloned into effectors (pGreen-62-sk) and reporters (pGreen-0800-LUC) in a vector. The reconstructed plasmids were chemically transformed into Agrobacterium tumefaciens strain GV3101, and the recombinant strains were cultured in LB liquid medium with 50 μg/mL kanamycin and rifampin resistance at 200 rpm and 28°C for 48 h, pelleted by centrifugation, and resuspended in MgCl₂ buffer (10 mM MgCl₂, 10 mM morpholineethanesulfonic acid [MES], and 200 μM acetosyringone) in the dark for 4 h at 28°C. The culture solutions were then diluted by adjusting the optical density at 260 nm (OD₂₆₀) to 0.4 with MgCl₂ buffer. The reporter and effector were combined in equal volumes and infiltrated into plant leaves using a 1-mL sterile syringe without a needle. Then, N. benthamiana was incubated for another 48 h in the dark. To detect fluorescence, d-fluorescein potassium salt (0.45 mg/mL) was sprayed onto N. benthamiana leaves and photographed with LB983 NightOwl (Berthold Technologies, Germany).

Detection of reactive oxygen and callosum.

Callose deposition and ROS burst were visualized using the aniline blue and DAB staining approach as described previously (43). A Leica DM2500 microscope (Wetzlar, Germany) was used for the observations. ROS and callose intensity were subsequently quantified with ImageJ (44).

Ion chromatography.

Samples for this experiment were taken from bark at the disease-health junction at 2 days after inoculation with the wild-type, ΔCcRlm1, and ΔCcRlm1-C strains, and then all samples were further freeze-dried and characterized by an ICS5000 chromatograph (Thermo Scientific, USA). The main parameters were as follows: column, Dionex CarboPac TMPA200 (3 × 150); mobile phase A, H₂O; B, 130 mM NaOH; C, 65 mM NaOH and 1,025 mM NaOAC; flow rate, 0.3 mL/min; injection volume, 25 μL; column temperature, 30°C; detector, electrochemical detector. For chromatographic determination, the standard solution and sample solution were injected into the ion chromatograph for determination, and the spectral peak area was recorded. The content of chitin oligosaccharides in the samples was calculated as follows (Fuda Technology, China):

$$W=\frac{A\times m}{a\times M}\times 100$$ (1)

where A is the chromatographic peak area of chitin oligosaccharide in the sample solution, a is the chromatographic peak area of chitin oligosaccharide standard in the standard solution, M is the mass of the sample (mg), m is the mass of chitin oligosaccharide standard in the standard solution (mg), and W is the percentage of chitin oligosaccharide in the sample (%).

Data availability.

The raw RNA-seq reads were submitted to the NCBI SRA database under BioProject number PRJNA956243.