Geometric Remodeling of Nitrilase Active Pocket Based on ALF-Scanning Strategy To Enhance Aromatic Nitrile Substrate Preference and Catalytic Efficiency

Zi-Kai Wang; Jin-Song Gong; Dan-Ting Feng; Chang Su; Hui Li; Zhi-Ming Rao; Zhen-Ming Lu; Jin-Song Shi; Zheng-Hong Xu

doi:10.1128/aem.00220-23

. 2023 May 16;89(6):e00220-23. doi: 10.1128/aem.00220-23

Geometric Remodeling of Nitrilase Active Pocket Based on ALF-Scanning Strategy To Enhance Aromatic Nitrile Substrate Preference and Catalytic Efficiency

Zi-Kai Wang ^a,^c, Jin-Song Gong ^b,^d,^✉, Dan-Ting Feng ^b, Chang Su ^b,^d, Hui Li ^b, Zhi-Ming Rao ^a,^c, Zhen-Ming Lu ^a,^c,^✉, Jin-Song Shi ^b,^d, Zheng-Hong Xu ^a,^c,^d

Editor: Marina Lotti^e

PMCID: PMC10304902 PMID: 37191513

ABSTRACT

Nitrilase can catalyze nitrile compounds to generate corresponding carboxylic acids. Nitrilases as promiscuous enzymes can catalyze a variety of nitrile substrates, such as aliphatic nitriles, aromatic nitriles, etc. However, researchers tend to prefer enzymes with high substrate specificity and high catalytic efficiency. In this study, we developed an active pocket remodeling (ALF-scanning) based on modulating the geometry of the nitrilase active pocket to alter substrate preference and improve catalytic efficiency. Using this strategy, combined with site-directed saturation mutagenesis, we successfully obtained 4 mutants with strong aromatic nitrile preference and high catalytic activity, W170G, V198L, M197F, and F202M, respectively. To explore the synergistic relationship of these 4 mutations, we constructed 6 double-combination mutants and 4 triple-combination mutants. By combining mutations, we obtained the synergistically enhanced mutant V198L/W170G, which has a significant preference for aromatic nitrile substrates. Compared with the wild type, its specific activities for 4 aromatic nitrile substrates are increased to 11.10-, 12.10-, 26.25-, and 2.55-fold, respectively. By mechanistic dissection, we found that V198L/W170G introduced a stronger substrate-residue π-alkyl interaction in the active pocket and obtained a larger substrate cavity (225.66 Å³ to 307.58 Å³), making aromatic nitrile substrates more accessible to be catalyzed by the active center. Finally, we conducted experiments to rationally design the substrate preference of 3 other nitrilases based on the substrate preference mechanism and also obtained the corresponding aromatic nitrile substrate preference mutants of these three nitrilases and these mutants with greatly improved catalytic efficiency. Notably, the substrate range of SmNit is widened.

IMPORTANCE In this study, the active pocket was largely remodeled based on the ALF-scanning strategy we developed. It is believed that ALF-scanning not only could be employed for substrate preference modification but might also play a role in protein engineering of other enzymatic properties, such as substrate region selectivity and substrate spectrum. In addition, the mechanism of aromatic nitrile substrate adaptation we found is widely applicable to other nitrilases in nature. To a large extent, it could provide a theoretical basis for the rational design of other industrial enzymes.

KEYWORDS: nitrilase, active pocket remodeling, substrate preference, biocatalysis, protein engineering, substrate scope

INTRODUCTION

As a member of the carbon-nitrogen hydrolase superfamily, nitrilase (EC 3.5.5.1) can hydrolyze nitrile compounds to the corresponding carboxylic acids. Nitrilase catalytic activity is based on the classical Glu-Lys-Cys catalytic triad mechanism (1, 2). According to the different substrate types, nitrilases can be divided into three categories, aromatic nitrilases, aliphatic nitrilases, and aromatic acetonitrile nitrilases (1). In many cases, some nitrilases can catalyze two types of nitrile compounds and show substrate promiscuity (2, 3). For example, Synechocystis sp. strain PCC6803 nitrilase can catalyze both aliphatic and aromatic nitriles (4). Dhillon et al. utilized Pseudomonas sp. nitrilase to biotransform aliphatic and aromatic nitriles to produce corresponding organic acids (5), and this nitrilase was capable of catalyzing aromatic nitrile, aromatic acetonitrile, and aliphatic nitrile. In addition, the Pseudomonas putida CGMCC3830 nitrilase discovered by Gong et al. (1, 6, 7) in a previous study also possesses the ability to catalyze these 3 types of substrates (8). Many types of enzymes in nature exhibit a promiscuous ability to catalyze multiple types of noncognate substrates (9). Catalyzing multiple types of substrates also means that enzymes have a wider range of applications as biocatalysts. In fact, we could customize this “multicapacity” enzyme to enhance its catalytic performance for a certain type of reaction to enhance its application potential. Nitrilases are capable of catalyzing nitriles to produce the corresponding carboxylic acids. Among them, aromatic nitriles are catalyzed by nitrilase to generate high-value-added aromatic organic acids, which are favored by many researchers (1, 6, 10, 11). However, the enzymatic activity of most reported nitrilases toward various aromatic nitrile compounds is the bottleneck restricting the biocatalytic production of high-value-added aromatic organic acid compounds by nitrilase. Therefore, it may be a potential strategy to enhance the substrate preference of promiscuous nitrilases for aromatic nitriles to enhance their enzymatic activity.

The active pocket of an enzyme plays a crucial role in the enzymatic catalysis of the substrate (12, 13), including enzyme and substrate recognition (14 –17), the entry and release of the substrate (18, 19), the binding of the enzyme protein and the substrate (20 –23), and so on. Given the important role of the enzymatic active pocket in the process of substrate binding, protein engineering targeting the active pocket might be a good choice. Several previous studies have modified enzyme substrate selectivity and substrate scope by remodeling the enzyme activity pocket. The geometric state of the active pocket is an important indicator. Ishikawa et al. successfully expanded the substrate-binding pocket of the arylate adenylation domain in nonribosomal peptide synthases by glycine mutation and broadened its substrate scope (24). Zhou and coworkers resolved the substrate channel of epoxide hydrolase, and then they mutated the methionine residue at position 145 and Phe at position 128 to Ala with less steric hindrance, enabling epoxide hydrolase to catalyze larger substrate molecules (25). In addition, Chen et al. also remodeled the active pocket of amine dehydrogenase to achieve asymmetric synthesis of bulky fatty amines (26). In all of the above-mentioned case studies, the researchers expanded the active pocket size through smaller side chain amino acid mutations (Ala or Gly) to broaden the enzyme substrate spectrum or accept bulky substrates (24 –26). In order to locate the key residues in the active pocket, they utilized a small side chain amino acid, Ala, to perform mutation scanning on the active pocket residues (Ala-mutation strategy). Inspired by these works, we may be able to use the Ala-mutation strategy to scan the active pocket residues of nitrilase that can catalyze multiple types of substrates, find key sites, and then precisely reshape them to obtain specific and efficient enzymes (change the substrate preference). However, since Ala is a representative of a small side chain amino acid, Ala mutation scanning may not be sufficient for enhancing the specificity of the enzyme to catalyze a specific type of a substrate.

Here, we utilized Synechocystis sp. PCC6803 nitrilase (Nit6803) as a research template and made efforts for remodeling the active pocket of Nit6803 to enhance its preference for aromatic nitrile substrates. According to the state of binding of the active pocket of Nit6803 to aromatic/aliphatic nitrile, we developed an upgraded strategy, namely, Ala-Leu-Phe scanning (ALF-scanning). In this study, we first used ALF-scanning and then site-directed saturation mutagenesis and combinatorial mutagenesis (27, 28) to obtain Nit6803 active pocket remodeling mutants. In addition, based on protein-ligand interaction force analysis, active pocket modeling, and molecular dynamics (MD) simulations, the underlying mechanism of the substrate preference after the remodeling of the active pocket of Nit6803 was explored. We believe that the study of the substrate preference of this substrate-promiscuous enzyme in this study provides more options for improving the catalytic efficiency of specific types of substrates. Moreover, the ALF-scanning active pocket remodeling strategy could play a helpful role in the modification of enzyme substrate preference and the improvement of catalytic activity. This strategy may play an important role in the directed evolution and protein engineering studies of substrate preference and substrate selectivity of other enzymes. Besides, our analysis of the substrate aptitude mechanism of nitrilase aliphatic/aromatic nitrile substrates based on the geometric state of the active pocket can provide a theoretical basis for the understanding of the catalytic mechanism and rational design of nitrilase. Furthermore, protein engineering was performed to modify the nitrilases LsNit, RsNit, and SmNit from other species under the substrate preference mechanism. Ls-W165G-V193L, Rs-W164G-V192L, and Sm-W184G-V212L with enhanced aromatic nitrile substrate preference and catalytic activity were obtained. Further, Sm-W184G-V212L has a wider range of aromatic nitrile substrates than the wild type. These fully show that the mechanism we explored can be used in the research work of rational design of other mechanisms of protein engineering.

RESULTS AND DISCUSSION

Analysis of nitrilase active pocket cavity.

In this study, we selected nitrilase from Synechocystis sp. PCC6803 (Nit6803, PDB identifier [ID] 3WUY) as the template. Nit6803 is a promiscuous nitrilase that catalyzes both aliphatic and aromatic nitrile types of substrates. The purpose of our research is to modify the substrate preference of nitrilase, enhance the preference of nitrilase for aromatic substrates, and make nitrilase evolve to be more favorable for catalyzing aromatic nitrile substrates. Therefore, both aromatic nitrile substrates and aliphatic nitrile substrates were docked into the active pocket of Nit6803. We define the composition of amino acid residues within 6 Å of the substrate distance as the active pocket. Through the binding state of nitrile substrates and active pockets, it could be found that the binding of aliphatic nitrile substrates to the active pockets is relatively loose due to the slender chain structure of their molecules (Fig. 1A and B). However, aromatic nitrile substrates have relatively large sterically hindered aromatic ring structures and are relatively compact in binding to the active pocket (Fig. 1C and D). Furthermore, the Nit6803 active pocket cavity forms a substrate channel on the protein surface leading to the catalytic triad (E53, K135, C169) (Fig. 1E). It indicates that the active pocket of Nit6803 could play both the role of substrate binding and that of regulating the entry and release of the substrate. These results suggest that the three-dimensional (3D) geometry of the active pocket cavity of Nit6803 plays a crucial role in the adaptation of aromatic/aliphatic nitrile substrates. In other words, it may be possible to influence the substrate preference of nitrilase aromatic/aliphatic nitrile by tuning the geometry of the active pocket cavity.

FIG 1 — Analysis of active pocket and aromatic/aliphatic nitrile binding state and substrate channel. (A to D) The states of binding of 3-chloropropionitrile (yellow), succinonitrile (yellow), 3-cyanopyridine (green), and benzonitrile (green) to the active pocket (blue), respectively. (E) Substrate channel analysis of Nit6803. The yellow residues are catalytic triad residues, the green residues are active pocket residues, and the blue channel is a substrate channel.

ALF-scanning of the nitrilase active pocket.

Active pocket remodeling is directly reflected in the change of the geometric state of the active pocket cavity. However, the active pocket could directly provide “microspace” for an enzymatic catalysis reaction. This “microspace” contains the complex interaction force relationship between residues and residues and between residues and substrates. Therefore, in the process of remodeling the active pocket, we should avoid mutating these residues that are crucial for catalysis and explore favorable sites for engineering. Researchers generally employed Ala mutation scanning to find favorable mutation sites (24 –26). For the change of the catalytic substrate preference of the promiscuous enzyme, the change of the active pocket geometry does not have to be so drastic, nor is it necessarily to just expand the active pocket cavity. Therefore, Ala mutation scanning may not be sufficient for enhancing the specificity of the enzyme to catalyze a specific type of a substrate.

Most residues in the enzymatic active pocket are hydrophobic amino acids to maintain the overall hydrophobic state of the active pocket cavity. Notably, 8 hydrophobic amino acid side chain lengths could cover the range of 0 to 6 Å (Fig. 2). Coincidentally, we could utilize 8 hydrophobic amino acids as a library to replace the original amino acids in the active pocket to reshape the active pocket in order to change the spatial geometry. It may be a good choice to use this idea to reshape the active pocket to change the spatial geometry of the cavity. The selection of these 8 hydrophobic amino acids for active pocket remodeling has two advantages. First, it preserves the basic hydrophobic state of the active pocket; Second, hydrophobic amino acid side chains have a variety of shapes and sizes, which can largely satisfy the changes in the geometric state of the cavity. However, it is experimentally cumbersome to examine all amino acid residue sites in the active pocket with 8 hydrophobic amino acids. Furthermore, we classified the 8 hydrophobic amino acids according to the size of their residue side chains, i.e., small side chains (Gly, Ala), medium side chains (Val, Leu, Ile), and large side chains (Met, Phe, Trp) (Fig. 2). Among them, Ala, with a single methyl on the side chain, is widely used as the amino acid for scanning mutations (21, 24, 26). Therefore, Ala was selected as the representative amino acid for a small side chain. Among medium side chain amino acids, the side chain of Leu could provide moderate steric hindrance, so Leu was selected as the representative of medium side chain amino acids. It is worth noting that although large side chain amino acids provide significant steric hindrance, Phe has a benzene ring structure in its side chain, which may form a π-π interaction with aromatic nitriles. This is beneficial for the binding of the nitrilase active pocket to aromatic nitrile substrates. Thus, Phe was also chosen as a large side chain amino acid. These 3 representative hydrophobic amino acids (Ala, Leu, Phe) were used as the target for mutation and for scanning the amino acid residues in the active pocket to reshape the geometric state of the cavity. Then, according to the mutation scanning results, the key mutation sites responsible for substrate preference were screened. This semirational design (29) method was named ALF-scanning mutagenesis.

FIG 2 — ALF-scanning mutagenesis of the active pocket of Nit6803. (A) Ala-scanning mutagenesis of the active pocket of Nit6803; (B) Leu-scanning mutagenesis of the active pocket of Nit6803; (C) Phe-scanning mutagenesis of the active pocket of Nit6803.

Next, we utilized this ALF-scanning mutagenesis approach to geometrically reshape the nitrilase active pocket cavity. First, we performed a mutation scanning of 14 residues in the active pocket of Nit6803 with the small side chain amino acid alanine. To explore the altered preference of the mutants for Nit6803 aromatic/aliphatic nitrile substrates, we tested the enzymatic activities of all mutants toward the aromatic nitrile model substrate 3-cyanopyridine and the aliphatic nitrile model substrate succinonitrile. After Ala-scanning mutagenesis, two mutants, W170A and F202A, showed significant potential among all the tested mutants (Fig. 2A). The mutant W170A lost almost all the enzymatic activity toward the aliphatic nitrile substrate succinonitrile but retained about 75% of the enzymatic activity toward the aromatic nitrile substrate 3-cyanopyridine. Similarly, the mutant F202A lost about 85% of succinonitrile activity, but its activity toward 3-cyanopyridine was increased by 25% compared to the wild type. This indicates that Nit6803 may have a significant increase in the preference for aromatic nitrile substrates after mutating the large side chain amino acid residue Trp at position 170 to a small side chain Ala residue. This indicates that mutants W170A and F202A could have improved preference for aromatic nitrile substrates.

Following the Ala-scanning strategy described above, we performed a Leu-scanning mutation of the medium side chain and a Phe-scanning mutation of the large side chain to the active pocket of Nit6803. As a result, four mutants with a significantly improved preference for aromatic nitrile substrates were discovered, namely, V198L (relative enzyme activity: 3-cyanopyridine, 351%; succinonitrile, 59%), F202L (3-cyanopyridine, 119%; succinonitrile, 13%), M197F (3-cyanopyridine, 161%; succinonitrile, 77%), and V198F (3-cyanopyridine, 147%; succinonitrile, 43%) (Fig. 2B and C). Overall, the strategy of ALF-scanning mutagenesis which we designed was applied in the study of the geometric remodeling of the active pocket of Nit6803 to alter substrate preference with desired results. In fact, this strategy enables a systematic examination of the active pocket geometry to a large extent. In this study, 6 mutants were excavated, which were reflected at residues 170 (W170A), 197 (M197F), 198 (V198L, V198F), and 202 (F202L, F202A) of the active pocket of Nit6803, respectively.

Site-directed saturation mutagenesis and enzymatic characterization.

As mentioned above, we unearthed the potential key residues that might determine the aromatic/aliphatic nitrile substrate preference of Nit6803 by ALF-scanning mutagenesis. In order to precisely regulate the geometric state of the active cavity of Nit6803, site-directed saturation mutations were performed on these 4 sites (Fig. 3). After constructing all the saturation mutants, the enzymatic activities of 3-cyanopyridine and succinonitrile for all mutants were tested. The results showed that compared with the mutants from ALF-scanning mutagenesis, other mutants at residues 197 and 198 did not improve the enzymatic activity to the aromatic nitrile substrate 3-cyanopyridine. However, other mutants of interest at residues 170 and 202 were found by saturation mutation. Compared with W170A obtained by Ala-scanning mutation, the mutant W170G also lost its enzymatic activity on the aliphatic nitrile substrate succinonitrile, but its enzymatic activity to the aromatic nitrile substrate 3-cyanopyridine increased to 400%. As expected, Ala is a representative of a small side chain amino acid, and the mutant W170G (3-cyanopyridine, 400%; succinonitrile, not detected [ND]) of the amino acid Gly with a smaller side chain has a better effect on the preference of the aromatic nitrile substrate of Nit6803. Likewise, at residue 202, the mutant F202M also achieved better results than F202L, and there was also a slight increase in the side chain volume of Met compared to Leu. According to the saturation mutation results of residues 170 and 202, after ALF-scanning mutation, the active pocket can be fine-tuned only according to using ALF-scanning mutation of the amino acids with similar side chain sizes to find more suitable mutants. Overall, we identified the corresponding 4 final single point mutants, W170G, M197F, V198L and F202M, through saturation mutations at the 4 sites 170, 197, 198, and 202, respectively.

FIG 3 — Site-directed saturation mutagenesis and characterization of enzymatic activity at residues 170 (A), 197 (B), 198 (C), and 202 (D).

Exploring the synergistic effect of mutants.

To explore the synergistic effect between the four single point mutants, we first constructed 6 double mutants, V198L/W170G, M197F/V198L, V198L/F202M, M197F/F202M, M197F/W170, and W170G/F202M. Through the detection of the enzyme activity of the double mutants, we found that the enzyme activities of the double mutants V198L/W170G, M197F/V198L, and 198L/F202M toward 3-cyanopyridine were significantly higher than those of the single point mutants, showing an obviously synergistic enhancement effect (Fig. 4A and B). Among them, the enzyme activity of V198L/W170G for 3-cyanopyridine was increased to 7.27 times compared with the wild type, and the activity of succinonitrile decreased to 4.5%, showing a strong preference for aromatic nitrile substrates. Next, 4 triple mutants, V198L/W170G/M197F, V198L/W170G/F202M, V198L/M197F/F202M, and V198L/M197F/W170G, were constructed. Although the activities of the four triple mutants on the aromatic nitrile substrate 3-cyanopyridine were improved compared with the wild type, the triple mutants showed an overall downward trend compared with the double mutants (Fig. 4A and B).

FIG 4 — Construction of Nit6803 combinatorial mutants and characterization of substrate preference. (A) Relative enzymatic activity of Nit6803 combinatorial mutants to 3-cyanopyridine; (B) relative enzymatic activity of Nit6803 combinatorial mutants to succinonitrile.

Considering all the mutation results, the double mutant V198L/W170G was selected as the final mutant for further research. To characterize the change in substrate preference of the V198L/W170G mutant in more detail, we measured the specific enzyme activities of V198L/W170G and wild type toward 4 aromatic nitrile substrates (compounds 1 to 4) and 4 aliphatic nitrile substrates (compounds 5 to 8) (Fig. 5; see also Fig. S1 in the supplemental material). It can be seen from the results that compared with the wild type, the specific activities of V198L/W170G for 4 aromatic nitrile substrates are increased to 11.10 (3-cyanopyridine), 12.10 (3-thiophenecarbonitrile), 26.25 (benzonitrile), and 2.55 (2-cyanofuran) times, and up to 301.69 U · mg⁻¹, 30.86 U · mg⁻¹, 41.48 U · mg⁻¹, and 157.70 U · mg⁻¹, respectively. However, the specific activities for the 4 aliphatic nitrile substrates were significantly decreased. Therefore, it could be concluded that the Nit6803 has an enhanced preference for aromatic nitrile substrates after remodeling of the active pocket. And in the process, it was accompanied by the improvement of the activity of aromatic nitrile substrates.

FIG 5 — Specific enzymatic activities of V198L/W170G and wild-type Nit6803 for 8 nitrile substrates.

To demonstrate the ability of conversion of V198L/W170G to aromatic nitrile substrates, a biotransformation experiment on the aromatic nitrile substrate 3-cyanopyridine was conducted. Nitrilase can catalyze 3-cyanopyridine to produce nicotinic acid, which is an important pharmaceutical intermediate and food additive (1, 6, 10, 30). First, 100 mM 3-cyanopyridine was added for whole-cell biocatalytic reactions, and the reaction mixture was collected at different times to quantify residual substrate and product concentration (Fig. 6; see also Fig. S2 and S3). The experimental results showed that the mutant V198L/W170G could achieve complete conversion of 3-cyanopyridine and generate the corresponding product nicotinic acid within 100 min (Fig. 6; Fig. S2). However, the biotransformation of wild-type Nit6803 to 3-cyanopyridine was significantly slow, achieving only about 60% of the biotransformation of 3-cyanopyridine within 100 min (Fig. 6; Fig. S3). To achieve complete conversion of 3-cyanopyridine to nicotinic acid, the wild-type Nit6803 required approximately 250 min (Fig. 6; Fig. S3). It could be seen that V198L/W170G, compared to the wild-type Nit6803, has a significantly enhanced bioconversion ability for aromatic nitrile substrates.

FIG 6 — Biotransformation of 3-cyanopyridine to nicotinic acid by wild-type Nit6803 and mutant V198L/W170G.

Mechanism of V198L/W170G substrate preference change.

The experimental results of ALF-scanning mutation and combined mutation showed that the enhanced preference of mutant V198L/W170G for aromatic nitrile substrates was synergized by the combination of mutants V198L and W170G. Therefore, we first explored the mechanism of the preference for aromatic nitriles of mutants V198L. We mutated the Val at residue 198 to Leu, resulting in a 3.51-fold increase in the activity of Nit6803 on the aromatic nitrile substrate 3-cyanopyridine, and the succinonitrile activity against aliphatic nitrile substrates decreased to 59% of that of the wild type. In fact, the substrate preference of aliphatic/aromatic nitriles was not significantly changed by this mutation, but rather the activity of aromatic nitriles was improved. Through determination of the enzymatic reaction kinetics, it was found that the K_m value of V198L for the aromatic nitrile substrate 3-cyanopyridine decreased from 36.42 mM to 31.25 mM (Table 1). It indicated that the substrate affinity of the mutant V198L for the aromatic nitrile substrate 3-cyanopyridine was improved compared with the wild type. Moreover, we analyzed the interaction force of 3-cyanopyridine with the nitrilase active pocket based on the molecular docking complex structure of 3-cyanopyridine with wild-type Nit6803 and mutant V198L. Overall, 3-cyanopyridine has three main interaction forces in both the wild-type and V198L active pockets. They are the hydrogen bond interaction between Tyr59 and 3-cyanopyridine cyano N atom, the π-cation interaction between His141 and the aromatic pyridine ring, and the π-π stacked interaction between the pyridine ring and Trp170, respectively (Fig. S4). However, Leu has a longer side chain than Val. In the active pocket of Nit6803, the more elongated side chain of the Leu at residue 198 is more accessible to the pyridine ring of the substrate 3-cyanopyridine (Fig. 7A and B). Therefore, compared with the wild type, V198L has an additional π-alkyl interaction force at residue 198 of the 3-cyanopyridine aromatic pyridine ring. This could explain the stronger substrate affinity of V198L with 3-cyanopyridine. Notably, the aliphatic nitrile substrates do not have an aromatic ring structure like the aromatic nitrile substrates; therefore, no improvement effects were observed for the substrate affinities and enzymatic activities of the V198L mutant to the aliphatic nitrile substrates succinonitrile and 3-chloropropionitrile (Table 1).

TABLE 1.

Determination of kinetic parameters for the enzymatic reaction of 3-cyanopyridine and succinonitrile in wild type and mutant of Nit6803^a

Enzyme	Substrate	K_m (mM)	K_cat (s⁻¹)	K_cat/K_m (s⁻¹ · M⁻¹)
WT	3-Cyanopyridine	36.42	1.64	0.045
W170G	3-Cyanopyridine	53.46	10.63	0.20
V198L	3-Cyanopyridine	31.25	4.15	0.13
V198L/W170G	3-Cyanopyridine	656.65	210.81	0.32
WT	3-Chloropropionitrile	61.37	8.31	0.14
W170G	3-Chloropropionitrile	ND
V198L	3-Chloropropionitrile	39.76	5.17	0.13
V198L/W170G	3-Chloropropionitrile	93.90	1.85	0.020

Open in a new tab

WT, wild type; ND, not detected.

FIG 7 — Interaction analysis of wild-type Nit6803 and V198L mutant with 3-cyanopyridine. (A) The distance between the Val198 residue (violet) of wild-type Nit6803 and the centroid of the pyridine ring of 3-cyanopyridine (blue compound). (B) The distance between the Leu198 residue (violet) of the V198L mutant and the centroid of the pyridine ring of 3-cyanopyridine (blue compound).

Then, the effect of W170G mutation on the remodeling of the active pocket of Nit6803 was investigated. Indeed, as seen by the enzymatic activity of mutant W170G toward 3-cyanopyridine and succinonitrile, the W170G mutant became an almost complete aromatic nitrile, preferring nitrilase (it lost almost all enzymatic activity of aliphatic nitriles) (Fig. 3A). The combined mutation of W170G and V198L produces a synergistic effect, namely, the specific enzymatic activity of aromatic nitriles is greatly increased, while the hydrolysis activity of a small part of aliphatic nitriles is retained (Fig. 4 and 5). Therefore, we investigated the structural changes in the active pocket of the combined mutant V198L/W170G compared to the wild type. The W170G mutates the largest amino acid side chain Trp to the smallest amino acid side chain Gly. By analyzing the local structural model of the active pocket, it was found that this mutation drastically changes the spatial geometry of the active pocket. The W170G mutation significantly opened the original compactly packed active pocket, forming a “gap” cavity of the same size as the original pocket (Fig. 8A and B). The formation of this “gap” makes the active cavity of Nit6803 increase dramatically. It was calculated that the volume of the active cavity increased from 225.66 to 307.58 Å³ (Fig. 8C and D). Moreover, it could be clearly observed that the entrance of the active cavity as the substrate channel is also significantly enlarged. This means that it is easier for the substrate to access from the entry into the pocket. Moreover, from the kinetic parameter K_cat, it can be seen that the V198L/W170G mutant increases the turnover number of Nit6803 to aromatic nitrile substrates to 128.54-fold that of the wild type. These findings could explain the experimental results that the W170G single point mutation and the V198L/W170G double mutation greatly improved the activity of aromatic nitrile substrates.

FIG 8 — Geometric state analysis of active cavities in wild-type Nit6803 and V198L/W170G mutant. (A and B) Geometric changes and comparison of active cavities in wild type and V198L/W170G mutant of Nit6803. The violet parts are the 170W residue (wild type) and the 170G residue (V198L/W170G), the blue parts are the 198V residue (wild type) and the 198L residue (V198L/W170G), and the cyan compound is a substrate of 3-cyanopyridine. (C to D) Changes in the volume of active cavities in the wild type and V198L/W170G mutant of Nit6803. The violet sticks are the 170W residue (wild type) and the 170G residue (V198L/W170G), and the blue sticks are the 198V residue (wild type) and the 198L residue (V198L/W170G). The blue grids are the pocket cavities.

The W170G mutation leads to an enlarged substrate channel entrance and an increase in the volume of the active cavity, which could lead to easier entry and exit of the substrate. However, for aliphatic nitrile substrates, the W170G single point mutation loses almost all the enzymatic activity of the aliphatic nitrile, and the K_cat value of the V198L/W170G double mutant for aliphatic nitrile substrates did not increase. Therefore, detailed analysis was further performed. According to the state of binding of aromatic/aliphatic nitrile substrates to the active pocket of Nit6803 (Fig. 1), it was found that aromatic nitrile substrates bind to the wild-type active pocket more compactly, due to the presence of aromatic rings; On the other hand, the aliphatic nitrile substrates exhibit a slender “chain-like” geometry at the geometric level, which binds loosely to the wild-type active pocket. In addition, according to the kinetic parameters of the enzymatic reaction, it could be found that V198L/W170G has a significant increase in the K_m value toward aromatic nitrile 3-cyanopyridine compared to the wild type (Table 1), from 36.42 mM to 656.65 mM. This indicated that the substrate affinity of V198L/W170G to aromatic nitrile substrates is poorer than the wild type. Despite its poor affinity, the K_cat value of V198L/W170G to the aromatic nitrile substrate 3-cyanopyridine has increased 128.54-fold compared to the wild-type Nit6803. This indicates that the reduction of steric hindrance due to the expansion of the active pocket is the fundamental reason for the improvement of catalytic efficiency rather than of affinity. However, wild-type nitrilase binds loosely to the aliphatic nitrile substrate 3-chloropropionitrile, with a larger K_m value (61.37 mM) than that for the aromatic nitrile substrate 3-cyanopyridine, and exhibits poor affinity. After introducing the mutation, although the K_m value of the mutant V198L/W170G to 3-chloropropionitrile increased (93.90 mM), it was not as obvious as that of 3-cyanopyridine. The catalytic efficiency of V198L/W170G to 3-chloropropionitrile also decreased significantly with the decrease of K_cat value. This might indicate that oversized active pockets are not suitable for fatty nitrile substrates with elongated structures. Therefore, we speculate that since the active pocket loosely binds to “chain-like” aliphatic nitrile molecules, the W170G mutation resulted in excessive loose binding of the active pocket to aliphatic nitrile substrate molecules. This makes it more difficult for the active pocket to lock the aliphatic nitrile substrate for catalysis reaction.

To prove the above-mentioned hypothesis, molecular dynamics simulations were performed. We selected 3-chloropropionitrile as the model substrate for aliphatic nitriles and 3-cyanopyridine as the model substrate for aromatic nitriles, and molecular docking was subjected to wild-type Nit6803 and V198L/W170G mutant, respectively. Subsequently, 60-ns molecular dynamics simulations were performed on the structure of the substrate-nitrilase complexes. Nitrilases catalyze nitrile substrates to the corresponding carboxylic acids and ammonia through a catalytic triad of active sites. Among them, the nucleophilic attack of the S_γ atom of the Cys169 residue on the cyano C atom of the substrate to form a regular tetrahedral intermediate is a key step. Therefore, we count the distance between the Cys169 Sγ atom and the substrate cyano C atom during 60-ns molecular dynamics simulation. First, we counted the distance between the 3-cyanopyridine cyano C atom and wild-type Nit6803 and V198L/W170G mutants Cys169 S_γ. From the statistical results, it can be seen that for the wild type, the distance value peaks around 8 Å, and about 83% of the distances are concentrated between 5.5 Å and 10.5 Å (Fig. 9A). For the V198L/W170G mutant, the distance peak showed a tendency to move forward, that is, the peak appeared at 5 Å, and 48% of the distances were concentrated between 3.6 Å and 6.2 Å (Fig. 9B). It can be seen that the V198L/W170G mutation makes it easier for the aromatic nitrile substrates to enter the depth of the active cavity and move toward catalytic neutrality. In this way, aromatic nitrile substrates were more easily nucleophilically attacked by Cys169. This enabled V198L/W170G to have higher catalytic efficiency for aromatic nitriles (Table 1 and Fig. 5). In addition, we explored the distance between the cyano C atom of the aliphatic nitrile model substrate 3-chloropropionitrile and the S_γ atoms of wild-type Nit6803 and V198L/W170G mutant Cys169. It was found that the distance between the wild-type Nit6803 C169 S_γ atom and the 3-chloropropionitrile cyano C atom peaked at 5.6 Å, of which 81% of the distances were distributed between 4.7 Å and 7 Å (Fig. 9C). However, the distance between the V198L/W170G mutant and 3-chloropropionitrile showed another peak at 7.5 Å, and the peak shifted back. Among them, 26% of the distances were concentrated between 6.8 Å to 8 Å (Fig. 9D). This indicates that in the active cavity of the V198L/W170G mutant, the aliphatic nitrile substrates are more likely to move away from the active center than are the wild type. This is consistent with our hypothesis above that, due to the enlarged active pocket of the final mutant V198L/W170G, the relatively more elongated “chain-like” structure of aliphatic nitrile substrates makes it more difficult for aliphatic nitriles to be trapped in the active pocket, compared with aromatic nitrile substrates, which showed a tendency to move away from the active center. These made the cyano group of 3-chloropropionitrile less likely to be attacked by nucleophiles, resulting in a lower catalytic efficiency (Fig. 5 and Table 1).

FIG 9 — Statistical analysis of the distance between the Nit6803 Cys169 residue Sγ atom and the substrate cyano C atom during molecular dynamics simulation. (A) Wild-type Nit6803, 3-cyanopyridine; (B) V198L/W170G mutant, 3-cyanopyridine; (C) wild-type Nit6803, 3-chloropropionitrile; (D) V198L/W170G, 3-chloropropionitrile.

Based on the results of molecular dynamics simulations, after the remodeling of the active pocket of Nit6803, the aliphatic nitrile and aromatic nitrile substrates showed different movement trends in the active cavity. The aromatic nitrile showed a tendency to be closer to the active center (Fig. 9A and B). The loose binding state of the aliphatic nitrile substrate to the active pocket of the V198L/W170G mutant makes it easy to move away from the active center (Fig. 9C and D). These changes in the movement trend in the active cavity leads to a change in the preference of nitrilases to aliphatic/aromatic nitrile substrates and significantly improves the catalytic activity of aromatic nitrile substrates.

Rational design to enhance the substrate preference of LsNit, RsNit, and SmNit toward aromatic nitriles.

Based on the study of the substrate preference of Nit6803 toward aromatic nitrile substrates, we found two vital mechanisms for the adaptation of aromatic nitrile substrates in the active pocket. First, the π-alkyl interaction between the alkyl side chain and the aromatic ring structure of the aromatic nitrile substrate was easier to induce when the valine at residue 198 was mutated to leucine (Fig. 7). More importantly, the geometry of the active pocket was greatly reshaped after the large side chain tryptophan at residue 170 was mutated to glycine with the smallest side chain volume. The steric hindrance at the entrance of the active pocket decreased greatly, and the volume of the substrate cavity increased by 1.36 times (Fig. 8). These led to the catalytic triad contact of aromatic nitrile substrates in the active pocket more easily (Fig. 8). Noteworthily, nitrilases in nature are highly conserved at these two residue positions (Fig. S5). Therefore, we might be able to design the aromatic nitrile substrate preference of nitrilases from other species based on the mechanisms explored. According to the mechanism explored above, we have two rational design principles. (i) The mutation of valine corresponding to Nit6803 position 198 to leucine lengthens the alkyl side chain, resulting in a shorter interaction distance between the side chain end C atom and the aromatic ring of the aromatic nitrile substrate. (ii) After the tryptophan corresponding to Nit6803 position 170 is mutated to glycine, the active cavity volume can be greatly increased after remodeling the active pocket.

Then, we unearthed 3 nitrilase genes from other sources, namely, Limnothrix sp. strain RL_2_0 (LsNit), Rhizobium sp. strain ICMP 5592 (RsNit), and Synechococcus moorigangae CMS01 (SmNit), respectively. Their homologies with the template Nit6803 are 80.06%, 60.11%, and 70.57%, respectively. Using the above two rational design principles, first, we investigated the distance between the side chain end C atom and the aromatic nitrile aromatic ring when LsNit, RsNit, and SmNit were mutated from valine to leucine at the corresponding residue position (Fig. S5). According to the corresponding calculation of the structure of the nitrilase-3-cyanopyridine docking complexes, it was found that the distance between the end C atom of the residue side chain and the pyridine ring on the 3-cyanopyridine was shortened from 6.0 Å to 4.7 Å, 5.9 Å to 5.1 Å, and 5.7 Å to 4.7 Å, respectively, after the mutation of LsNit, RsNit, and SmNit from valine to leucine (Fig. S6 to S8). Thus, Leu and the substrate 3-cyanopyridine form a stronger π-alkyl interaction (Fig. S9 to S11). According to the above-mentioned second principle, we investigated the change of the active cavity volume of LsNit, RsNit, and SmNit, after remodeling the active pocket, after the Trp corresponding to Nit6803 position 170 is mutated to Gly. Based on the above research, we constructed the virtual mutant structure of LsNit, RsNit, and SmNit (Ls-W165G-V193L, Rs-W164G-V192L, and Sm-W184G-V212L) to investigate the changes of active pockets and cavities. After the introduction of the virtual mutation, the active pockets of LsNit, RsNit, and SmNit were significantly reshaped. After the mutation of Trp to Gly, the steric hindrance of the aromatic nitrile substrate 3-cyanopyridine in the active pockets of nitrilase was significantly reduced (Fig. S12 to S14A and B). In addition, due to the reduction of the steric hindrance of the active pocket, the active cavities of LsNit, RsNit, and SmNit increased from 207.04 Å³ to 332.93 Å³, from 208.51 Å³ to 303.36 Å³, and 188.35 Å³ to 241.41 Å³, respectively (Fig. S12 to S14C and D).

Through the above rational calculation of LsNit, RsNit, and SmNit, we found that these 3 nitrilases are highly consistent with the rational design principle of substrate preference proposed in this study. Therefore, the experimental verification was carried out based on the above rational design. LsNit, RsNit, and SmNit were recombined and expressed in Escherichia coli BL21(DE3), and 3 corresponding mutants, Ls-W165G-V193L, Rs-W164G-V192L, and Sm-W184G-V212L, were constructed according to the virtual calculation. Then, these nitrilases were purified to obtain pure enzymes (Fig. S15). We tested the specific activity of these nitrilases toward 8 nitrile substrates (1 to 4, aromatic nitriles; 5 to 8, aliphatic nitriles). The results showed that nitrilase mutants constructed according to the two rational design principles had enhanced aromatic nitrile substrate preferences and significantly increased the enzyme activity against aromatic nitriles (Table 2). In detail, the mutant Ls-W165G-V193L, corresponding to the wild type, increased the specific enzyme activity of the 4 aromatic nitriles to 6.64-, 8.77-, 7.71-, and 1.14-fold, respectively, while it significantly decreased the activity toward the aliphatic nitrile substrates. In the same way, the mutant Rs-W164G-V192L increased the specific enzyme activity of the 4 aromatic nitriles to 6.44-, 20.71-, 30.07-, and 3.77-fold, respectively. Compared with wild-type SmNit, the specific enzyme activity of Sm-W184G-V212L to 3-cyanopyridine increased to 3.74-fold. It is noteworthy that SmNit showed no activity toward 2-thiophenecarbonitrile and benzonitrile, while the mutant Sm-W184G-V212L showed enzyme activity toward these 2 substrates (2-thiophenecarbonitrile, 1.23 U · mg⁻¹; benzonitrile, 0.88 U · mg⁻¹). This also shows that the rational design principle we put forward above, in addition to improving the preference and catalytic efficiency of aromatic nitriles, has the application potential to broaden the aromatic nitrile substrate range of nitrilase.

TABLE 2.

Determination of specific enzyme activities of wild-type LsNit, RsNit, and SmNit and mutants

	Enzyme activity toward substrates (U · mg⁻¹)
	1	2	3	4	5	6	7	8
Nitrilase
LsNit	24.69	5.80	7.06	7.88	64.47	24.09	159.73	26.70
Ls-W165G-V193L	164.02	50.87	54.42	9.01	16.57	11.40	12.73	7.38
RsNit	9.97	1.02	0.27	0.13	0.22	0.0065	0.00075	0.00016
Rs-W164G-V192L	64.29	21.13	8.66	0.49	0.049	0.00085	0.000027	0
SmNit	1.91	0	0	0	1.88	0	5.75	0
Sm-W184G-V212L	7.14	1.23	0.88	0	0.80	0	0.91	0

Open in a new tab

Conclusion.

In order to break through the bottleneck of nitrilase in the hydrolysis of aromatic nitrile, in this study, an ALF-scanning active pocket remodeling strategy was developed and employed to mine 4 key residue sites that determine substrate preference. Combining site-directed saturation mutagenesis and combinatorial mutagenesis, we obtained a synergistic combinatorial mutant, V198L/W170G, with a significant aromatic nitrile substrate preference. Compared with the wild type, the specific activities of the V198L/W170G mutant against the four tested aromatic nitrile substrates were increased to 11.10-, 12.10-, 26.25-, and 2.55-fold, respectively. In addition, interaction force analysis showed that the V198L mutation added a π-alkyl interaction with aromatic nitrile substrates to the Nit6803 active pocket. Since there is no aromatic ring structure in the molecular structure of aliphatic nitrile substrates, this π-alkyl interaction does not exist when the aliphatic nitrile substrate binds to the active pocket. This could explain why the V198L mutation enhanced the catalytic activity only of aromatic nitrile substrates. Notably, the W170G mutation creates a “gap” in the active pocket, which results in a significant increase in the volume of the active cavity. Through molecular dynamics simulations, it can be found that the larger active cavity makes it easier for aromatic nitrile substrates to enter deep into the active pocket, thus facilitating aromatic nitrile access to catalytic residues in the active center. However, the aliphatic nitrile substrate tends to move away from the active center due to its elongated structure in the larger active pocket. Finally, we carried out rational design of substrate preference of LsNit, RsNit, and SmNit based on the mechanism explored and also obtained the corresponding aromatic nitrile substrate preference mutants of these three nitrilases and these mutants with greatly improved catalytic efficiency. Notably, the substrate range of SmNit is widened. The results show that the mechanism we explored in this study, in addition to improving the preference and catalytic efficiency of aromatic nitriles, also has the application potential to broaden the aromatic nitrile substrate range of nitrilase. Overall, this study systematically remodels the geometry of the active pocket of nitrilase. We believe that ALF-scanning not only plays a role in substrate preference but may also play a role in locating key residues in the transformation of substrate selectivity, regioselectivity, and substrate range.

MATERIALS AND METHODS

Strains and reagents.

E. coli JM109 and E. coli BL21(DE3) were used as the host for gene cloning and recombinant expression, respectively. The expression plasmid pET-3b was stored in our group. Both seed medium and fermentation medium were LB. All other reagents were of analytical grade and purchased from commercial sources.

Cloning and protein expression and purification.

For protein expression in E. coli, Nit6803 genes (PDB ID 3WUY) from Synechocystis sp. PCC6803, Limnothrix sp. RL_2_0 (GenBank NJN72632.1), Rhizobium sp. ICMP 5592 (GenBank MQB40503.1), and Synechococcus moorigangae CMS01 (GenBank MBV5262123.1) were codon optimized, synthesized, and inserted into the pET-3b vector between the NdeI and BamHI sites with a 6×His tag attached to the N terminus by Genewiz.

Plasmids were transformed into E. coli BL21(DE3). The recombinant E. coli was cultured in 10 mL LB at 37°C, 220 rpm, for 10 to 14 h. Then, it was transferred to 30 mL LB at a 1% inoculum and cultured for 8 h to express nitrilase.

The E. coli cells were collected by centrifugation at 8,000 × g for 10 min at 4°C. Cells were resuspended in phosphate-buffered saline (PBS) buffer (100 mM, pH 7.2) and lysed by sonication at 4°C for 45 min with 10-s on/off cycles. The cell lysate was stratified by centrifugation at 8,000 × g for 15 min at 4°C. The supernatant was applied to a nickel-nitrilotriacetic acid (Ni-NTA) agarose column equilibrated with the dialysis buffer. After thorough washing of the column using the dialysis buffer, the target protein was eluted with the elution buffer (100 mM Tris-HCl, 250 mM imidazole, pH 8.0). After protein purification, protein purity was assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels stained with Coomassie brilliant blue. The protein concentration was determined by the bicinchoninic acid (BCA) detection kit (Beyotime).

Nitrilase assay and analytical methods.

In this study, the standard enzyme activity assays were implemented by mixing the substrate solution (50 mM final concentration) and the nitrilase in PBS (100 mM, pH 7.2). The 1-mL mixture reacted at 30°C, 1,500 rpm, for 20 min after 5 min of preincubation in a metal bath (Thermo Fisher) of 30°C. Then, the reaction was terminated by centrifugation at 12,000 × g for 1 min. The enzyme activity was determined by measuring the generated ammonia in the reaction mixture. This assay is based on the phenol-hypochlorite method. One unit of the enzyme activity (1 U) was defined as the amount of enzyme producing 1 μmol of ammonia per minute under the standard conditions described above. All assays were performed in triplicate (1, 6, 7).

The products and substrates of the nitrilase-catalyzed reaction were detected by high-pressure liquid chromatography (HPLC) (Ultimate 3000; Dionex 3000, USA) using an Xterra MS C₁₈ column (5 μm, 4.5 mm by 250 mm; Waters, USA) at a wavelength of 254 nm. The mobile phase was acetonitrile and 0.01% formic acid (gradient elution) at a flow rate of 1 mL/min at 30°C.

Site-directed mutagenesis.

The recombinant plasmid pET-3b-Nit was used as a template for site-directed mutagenesis using Phanta (Vazyme, Nanjing, China). Site-directed mutagenesis primers are listed in Table 3. The PCR program was set as follows: 95°C for 10 min, 95°C for 30 s, 60°C for 30 s, 72°C for 5 min, for 34 cycles, and a final extension time of 10 min. After digesting the PCR product with endonuclease DpnI (TaKaRa) at 37°C for 2 h, the mixture was transformed into E. coli JM109, and the positive mutants were confirmed by sequencing (Genewiz). The positive mutant plasmids were then transformed into E. coli BL21(DE3) for expression.

TABLE 3.

Primers used in this study

Primer name	Sequence (5′–3′)
6803-Y59A-F	GTACCGTATGCACCCTATTTTTCATTTGTAGAGCCCCCGGTC
6803-Y59A-R	AAAATAGGGTGCATACGGTACGAAGGTCTCGGGGAACACG
6803-T139A-F	ATCACCCCAGCATATCACGAACGCATGGTATGGGGTCAGGG
6803-T139A-R	TTCGTGATATGCTGGGGTGATTTTGCGACGCTTTAACAC
6803-Y140A-F	ACCCCAACCGCACACGAACGCATGGTATGGGGTCAGGGAG
6803-Y140A-R	GCGTTCGTGTGCGGTTGGGGTGATTTTGCGACGCTTTAAC
6803-H141A-F	CCAACCTATGCAGAACGCATGGTATGGGGTCAGGGAGATG
6803-H141A-R	CATGCGTTCTGCATAGGTTGGGGTGATTTTGCGACGCTTTAAC
6803-W170A-F	TTAGCCTGTGCAGAGCACTACAACCCGCTGGCCCGCTAC
6803-W170A-R	GTAGTGCTCTGCACAGGCTAATGCCCCCAGACGCCCTACTG
6803-P194A-F	GGCCAGTTTGCAGGTTCTATGGTTGGACAGATTTTTGCCG
6803-P194A-R	CATAGAACCTGCAAACTGGCCGCAATGGATCTGCTCGTGC
6803-M197A-F	CCGGGTTCTGCAGTTGGACAGATTTTTGCCGATCAAATGG
6803-M197A-R	CTGTCCAACTGCAGAACCCGGAAACTGGCCGCAATGGATC
6803-V198A-F	GGTTCTATGGCAGGACAGATTTTTGCCGATCAAATGGAAG
6803-V198A-R	AATCTGTCCTGCCATAGAACCCGGAAACTGGCCGCAATGG
6803-F202A-F	GGACAGATTGCAGCCGATCAAATGGAAGTAACTATGCGTC
6803-F202A-R	TTGATCGGCTGCAATCTGTCCAACCATAGAACCCGGAAAC
6803-Q205A-F	TTTGCCGATGCAATGGAAGTAACTATGCGTCATCATGCTC
6803-Q205A-R	TACTTCCATTGCATCGGCAAAAATCTGTCCAACCATAGAAC
S63A-6803-F	CCCTATTTTGCATTTGTAGAGCCCCCGGTCCTTATGGG
S63A-6803-R	CTCTACAAATGCAAAATAGGGGTAATACGGTACGAAGGTC
F64A-6803-F	TATTTTTCAGCAGTAGAGCCCCCGGTCCTTATGGGTAAATC
F64A-6803-R	GGGCTCTACTGCTGAAAAATAGGGGTAATACGGTACGAAG
P138A-6803-F	AAAATCACCGCAACCTATCACGAACGCATGGTATGGGGTC
P138A-6803-R	GTGATAGGTTGCGGTGATTTTGCGACGCTTTAACACTAATG
M206A-6803-F	GCCGATCAAGCAGAAGTAACTATGCGTCATCATGCTCTG
M206A-6803-R	AGTTACTTCTGCTTGATCGGCAAAAATCTGTCCAACCATAG
Y59L-6803-F	GTACCGTATCTTCCCTATTTTTCATTTGTAGAGCCCCCGG
Y59L-6803-R	AAAATAGGGAAGATACGGTACGAAGGTCTCGGGGAACACG
S63L-6803-F	CCCTATTTTCTTTTTGTAGAGCCCCCGGTCCTTATGGG
S63L-6803-R	CTCTACAAAAAGAAAATAGGGGTAATACGGTACGAAGGTC
F64L-6803-F	TATTTTTCACTTGTAGAGCCCCCGGTCCTTATGGGTAAATC
F64L-6803-R	GGGCTCTACAAGTGAAAAATAGGGGTAATACGGTACGAAG
P138L-6803-F	AAAATCACCCTTACCTATCACGAACGCATGGTATGGGGTC
P138L-6803-R	GTGATAGGTAAGGGTGATTTTGCGACGCTTTAACACTAATG
T139L-6803-F	ATCACCCCACTTTATCACGAACGCATGGTATGGGGTCAGG
T139L-6803-R	TTCGTGATAAAGTGGGGTGATTTTGCGACGCTTTAACAC
Y140L-6803-F	ACCCCAACCCTTCACGAACGCATGGTATGGGGTCAGGGAG
Y140L-6803-R	GCGTTCGTGAAGGGTTGGGGTGATTTTGCGACGCTTTAAC
H141L-6803-F	CCAACCTATCTTGAACGCATGGTATGGGGTCAGGGAGATG
H141L-6803-R	CATGCGTTCAAGATAGGTTGGGGTGATTTTGCGACGC
W170L-6803-F	TTAGCCTGTTTAGAGCACTACAACCCGCTGGCCCGCTAC
W170L-6803-R	GTAGTGCTCTAAACAGGCTAATGCCCCCAGACGCCCTAC
P194L-6803-F	GGCCAGTTTCTTGGTTCTATGGTTGGACAGATTTTTGCCG
P194L-6803-R	CATAGAACCAAGAAACTGGCCGCAATGGATCTGCTCGTGC
M197L-6803-F	CCGGGTTCTCTTGTTGGACAGATTTTTGCCGATCAAATGG
M197L-6803-R	CTGTCCAACAAGAGAACCCGGAAACTGGCCGCAATGGATC
V198L-6803-F	GGTTCTATGCTTGGACAGATTTTTGCCGATCAAATGGAAG
V198L-6803-R	AATCTGTCCAAGCATAGAACCCGGAAACTGGCCGCAATG
F202L-6803-F	GGACAGATTCTTGCCGATCAAATGGAAGTAACTATGCG
F202L-6803-R	TTGATCGGCAAGAATCTGTCCAACCATAGAACCCGGAAAC
Q205L-6803-F	TTTGCCGATCTTATGGAAGTAACTATGCGTCATCATGCTC
Q205L-6803-R	TACTTCCATAAGATCGGCAAAAATCTGTCCAACCATAGAAC
M206L-6803-F	GCCGATCAACTTGAAGTAACTATGCGTCATCATGCTCTGG
M206L-6803-R	AGTTACTTCAAGTTGATCGGCAAAAATCTGTCCAACCATAG
Y59F-6803-F	GTACCGTATTTCCCCTATTTTTCATTTGTAGAGCCCCCGG
Y59F-6803-R	AAAATAGGGGAAATACGGTACGAAGGTCTCGGGGAACAC
S63F-6803-F	CCCTATTTTTTCTTTGTAGAGCCCCCGGTCCTTATGGG
S63F-6803-R	CTCTACAAAGAAAAAATAGGGGTAATACGGTACGAAGGTC
P138F-6803-F	AAAATCACCTTCACCTATCACGAACGCATGGTATGGGG
P138F-6803-R	GTGATAGGTGAAGGTGATTTTGCGACGCTTTAACACTAATG
T139F-6803-F	ATCACCCCATTCTATCACGAACGCATGGTATGGGGTCAG
T139F-6803-R	TTCGTGATAGAATGGGGTGATTTTGCGACGCTTTAACAC
Y140F-6803-F	ACCCCAACCTTCCACGAACGCATGGTATGGGGTCAG
Y140F-6803-R	GCGTTCGTGGAAGGTTGGGGTGATTTTGCGACGCTTTAAC
H141F-6803-F	CCAACCTATTTCGAACGCATGGTATGGGGTCAGGGAG
H141F-6803-R	CATGCGTTCGAAATAGGTTGGGGTGATTTTGCGACGC
W170F-6803-F	TTAGCCTGTTTTGAGCACTACAACCCGCTGGCCCGCTAC
W170F-6803-R	GTAGTGCTCAAAACAGGCTAATGCCCCCAGACGCCCTAC
P194F-6803-F	GGCCAGTTTTTCGGTTCTATGGTTGGACAGATTTTTGC
P194F-6803-R	CATAGAACCGAAAAACTGGCCGCAATGGATCTGCTCGTG
M197F-6803-F	CCGGGTTCTTTCGTTGGACAGATTTTTGCCGATCAAATG
M197F-6803-R	CTGTCCAACGAAAGAACCCGGAAACTGGCCGCAATGGATC
V198F-6803-F	GGTTCTATGTTCGGACAGATTTTTGCCGATCAAATGG
V198F-6803-R	AATCTGTCCGAACATAGAACCCGGAAACTGGCCGCAATG
Q205F-6803-F	TTTGCCGATTTCATGGAAGTAACTATGCGTCATCATGC
Q205F-6803-R	TACTTCCATGAAATCGGCAAAAATCTGTCCAACCATAGAAC
M206F-6803-F	GCCGATCAATTCGAAGTAACTATGCGTCATCATGCTCTG
M206F-6803-R	AGTTACTTCGAATTGATCGGCAAAAATCTGTCCAACCATAG
W170C-6803-F	TTAGCCTGTTGCGAGCACTACAACCCGCTGGCCCGCTAC
W170C-6803-R	GTAGTGCTCGCAACAGGCTAATGCCCCCAGACGCCCTAC
W170D-6803-F	TTAGCCTGTGATGAGCACTACAACCCGCTGGCCCGCTAC
W170D-6803-R	GTAGTGCTCATCACAGGCTAATGCCCCCAGACGCCCTAC
W170E-6803-F	TTAGCCTGTGAAGAGCACTACAACCCGCTGGCCCGCTAC
W170E-6803-R	GTAGTGCTCTTCACAGGCTAATGCCCCCAGACGCCCTAC
W170G-6803-F	TTAGCCTGTGGAGAGCACTACAACCCGCTGGCCCGCTAC
W170G-6803-R	GTAGTGCTCTCCACAGGCTAATGCCCCCAGACGCCCTAC
W170H-6803-F	TTAGCCTGTCATGAGCACTACAACCCGCTGGCCCGCTAC
W170H-6803-R	GTAGTGCTCATGACAGGCTAATGCCCCCAGACGCCCTAC
W170I-6803-F	TTAGCCTGTATCGAGCACTACAACCCGCTGGCCCGCTAC
W170I-6803-R	GTAGTGCTCGATACAGGCTAATGCCCCCAGACGCCCTAC
W170K-6803-F	TTAGCCTGTAAAGAGCACTACAACCCGCTGGCCCGCTAC
W170K-6803-R	GTAGTGCTCTTTACAGGCTAATGCCCCCAGACGCCCTAC
W170M-6803-F	TTAGCCTGTATGGAGCACTACAACCCGCTGGCCCGCTAC
W170M-6803-R	GTAGTGCTCCATACAGGCTAATGCCCCCAGACGCCCTAC
W170N-6803-F	TTAGCCTGTAACGAGCACTACAACCCGCTGGCCCGCTAC
W170N-6803-R	GTAGTGCTCGTTACAGGCTAATGCCCCCAGACGCCCTAC
W170P-6803-F	TTAGCCTGTCCGGAGCACTACAACCCGCTGGCCCGCTAC
W170P-6803-R	GTAGTGCTCCGGACAGGCTAATGCCCCCAGACGCCCTAC
W170Q-6803-F	TTAGCCTGTCAGGAGCACTACAACCCGCTGGCCCGCTAC
W170Q-6803-R	GTAGTGCTCCTGACAGGCTAATGCCCCCAGACGCCCTAC
W170R-6803-F	TTAGCCTGTCGCGAGCACTACAACCCGCTGGCCCGCTAC
W170R-6803-R	GTAGTGCTCGCGACAGGCTAATGCCCCCAGACGCCCTAC
W170S-6803-F	TTAGCCTGTAGCGAGCACTACAACCCGCTGGCCCGCTAC
W170S-6803-R	GTAGTGCTCGCTACAGGCTAATGCCCCCAGACGCCCTAC
W170T-6803-F	TTAGCCTGTACCGAGCACTACAACCCGCTGGCCCGCTAC
W170T-6803-R	GTAGTGCTCGGTACAGGCTAATGCCCCCAGACGCCCTAC
W170V-6803-F	TTAGCCTGTGTAGAGCACTACAACCCGCTGGCCCGCTAC
W170V-6803-R	GTAGTGCTCTACACAGGCTAATGCCCCCAGACGCCCTAC
W170Y-6803-F	TTAGCCTGTTATGAGCACTACAACCCGCTGGCCCGCTAC
W170Y-6803-R	GTAGTGCTCATAACAGGCTAATGCCCCCAGACGCCCTAC
M197C-6803-F	CCGGGTTCTTGCGTTGGACAGATTTTTGCCGATCAAATG
M197C-6803-R	CTGTCCAACGCAAGAACCCGGAAACTGGCCGCAATGGATC
M197D-6803-F	CCGGGTTCTGATGTTGGACAGATTTTTGCCGATCAAATG
M197D-6803-R	CTGTCCAACATCAGAACCCGGAAACTGGCCGCAATGGATC
M197E-6803-F	CCGGGTTCTGAAGTTGGACAGATTTTTGCCGATCAAATG
M197E-6803-R	CTGTCCAACTTCAGAACCCGGAAACTGGCCGCAATGGATC
M197G-6803-F	CCGGGTTCTGGTGTTGGACAGATTTTTGCCGATCAAATG
M197G-6803-R	CTGTCCAACACCAGAACCCGGAAACTGGCCGCAATGGATC
M197H-6803-F	CCGGGTTCTCATGTTGGACAGATTTTTGCCGATCAAATG
M197H-6803-R	CTGTCCAACATGAGAACCCGGAAACTGGCCGCAATGGATC
M197I-6803-F	CCGGGTTCTATCGTTGGACAGATTTTTGCCGATCAAATG
M197I-6803-R	CTGTCCAACGATAGAACCCGGAAACTGGCCGCAATGGATC
M197K-6803-F	CCGGGTTCTAAGGTTGGACAGATTTTTGCCGATCAAATG
M197K-6803-R	CTGTCCAACCTTAGAACCCGGAAACTGGCCGCAATGGATC
M197N-6803-F	CCGGGTTCTAACGTTGGACAGATTTTTGCCGATCAAATG
M197N-6803-R	CTGTCCAACGTTAGAACCCGGAAACTGGCCGCAATGGATC
M197P-6803-F	CCGGGTTCTCCAGTTGGACAGATTTTTGCCGATCAAATG
M197P-6803-R	CTGTCCAACTGGAGAACCCGGAAACTGGCCGCAATGGATC
M197Q-6803-F	CCGGGTTCTCAGGTTGGACAGATTTTTGCCGATCAAATG
M197Q-6803-R	CTGTCCAACCTGAGAACCCGGAAACTGGCCGCAATGGATC
M197R-6803-F	CCGGGTTCTCGTGTTGGACAGATTTTTGCCGATCAAATG
M197R-6803-R	CTGTCCAACACGAGAACCCGGAAACTGGCCGCAATGGATC
M197S-6803-F	CCGGGTTCTAGTGTTGGACAGATTTTTGCCGATCAAATG
M197S-6803-R	CTGTCCAACACTAGAACCCGGAAACTGGCCGCAATGGATC
M197T-6803-F	CCGGGTTCTACCGTTGGACAGATTTTTGCCGATCAAATG
M197T-6803-R	CTGTCCAACGGTAGAACCCGGAAACTGGCCGCAATGGATC
M197V-6803-F	CCGGGTTCTGTGGTTGGACAGATTTTTGCCGATCAAATG
M197V-6803-R	CTGTCCAACCACAGAACCCGGAAACTGGCCGCAATGGATC
M197W-6803-F	CCGGGTTCTTGGGTTGGACAGATTTTTGCCGATCAAATG
M197W-6803-R	CTGTCCAACCCAAGAACCCGGAAACTGGCCGCAATGGATC
M197Y-6803-F	CCGGGTTCTTATGTTGGACAGATTTTTGCCGATCAAATG
M197Y-6803-R	CTGTCCAACATAAGAACCCGGAAACTGGCCGCAATGGATC
V198C-6803-F	GGTTCTATGTGTGGACAGATTTTTGCCGATCAAATGGAAG
V198C-6803-R	AATCTGTCCACACATAGAACCCGGAAACTGGCCGCAATGG
V198D-6803-F	GGTTCTATGGACGGACAGATTTTTGCCGATCAAATGGAAG
V198D-6803-R	AATCTGTCCGTCCATAGAACCCGGAAACTGGCCGCAATGG
V198E-6803-F	GGTTCTATGGAAGGACAGATTTTTGCCGATCAAATGGAAG
V198E-6803-R	AATCTGTCCTTCCATAGAACCCGGAAACTGGCCGCAATGG
V198G-6803-F	GGTTCTATGGGTGGACAGATTTTTGCCGATCAAATGGAAG
V198G-6803-R	AATCTGTCCACCCATAGAACCCGGAAACTGGCCGCAATGG
V198H-6803-F	GGTTCTATGCATGGACAGATTTTTGCCGATCAAATGGAAG
V198H-6803-R	AATCTGTCCATGCATAGAACCCGGAAACTGGCCGCAATGG
V198I-6803-F	GGTTCTATGATCGGACAGATTTTTGCCGATCAAATGGAAG
V198I-6803-R	AATCTGTCCGATCATAGAACCCGGAAACTGGCCGCAATGG
V198K-6803-F	GGTTCTATGAAGGGACAGATTTTTGCCGATCAAATGGAAG
V198K-6803-R	AATCTGTCCCTTCATAGAACCCGGAAACTGGCCGCAATGG
V198L-6803-F	GGTTCTATGTTAGGACAGATTTTTGCCGATCAAATGGAAG
V198L-6803-R	AATCTGTCCTAACATAGAACCCGGAAACTGGCCGCAATGG
V198M-6803-F	GGTTCTATGATGGGACAGATTTTTGCCGATCAAATGGAAG
V198M-6803-R	AATCTGTCCCATCATAGAACCCGGAAACTGGCCGCAATGG
V198N-6803-F	GGTTCTATGAACGGACAGATTTTTGCCGATCAAATGGAAG
V198N-6803-R	AATCTGTCCGTTCATAGAACCCGGAAACTGGCCGCAATGG
V198P-6803-F	GGTTCTATGCCAGGACAGATTTTTGCCGATCAAATGGAAG
V198P-6803-R	AATCTGTCCTGGCATAGAACCCGGAAACTGGCCGCAATGG
V198Q-6803-F	GGTTCTATGCAGGGACAGATTTTTGCCGATCAAATGGAAG
V198Q-6803-R	AATCTGTCCCTGCATAGAACCCGGAAACTGGCCGCAATGG
V198R-6803-F	GGTTCTATGCGTGGACAGATTTTTGCCGATCAAATGGAAG
V198R-6803-R	AATCTGTCCACGCATAGAACCCGGAAACTGGCCGCAATGG
V198S-6803-F	GGTTCTATGAGTGGACAGATTTTTGCCGATCAAATGGAAG
V198S-6803-R	AATCTGTCCACTCATAGAACCCGGAAACTGGCCGCAATGG
V198T-6803-F	GGTTCTATGACTGGACAGATTTTTGCCGATCAAATGGAAG
V198T-6803-R	AATCTGTCCAGTCATAGAACCCGGAAACTGGCCGCAATGG
V198W-6803-F	GGTTCTATGTGGGGACAGATTTTTGCCGATCAAATGGAAG
V198W-6803-R	AATCTGTCCCCACATAGAACCCGGAAACTGGCCGCAATGG
V198Y-6803-F	GGTTCTATGTACGGACAGATTTTTGCCGATCAAATGGAAG
V198Y-6803-R	AATCTGTCCGTACATAGAACCCGGAAACTGGCCGCAATGG
F202C-6803-F	GGACAGATTTGCGCCGATCAAATGGAAGTAACTATGCGTC
F202C-6803-R	TTGATCGGCGCAAATCTGTCCAACCATAGAACCCGGAAAC
F202D-6803-F	GGACAGATTGACGCCGATCAAATGGAAGTAACTATGCGTC
F202D-6803-R	TTGATCGGCGTCAATCTGTCCAACCATAGAACCCGGAAAC
F202E-6803-F	GGACAGATTGAAGCCGATCAAATGGAAGTAACTATGCGTC
F202E-6803-R	TTGATCGGCTTCAATCTGTCCAACCATAGAACCCGGAAAC
F202G-6803-F	GGACAGATTGGAGCCGATCAAATGGAAGTAACTATGCGTC
F202G-6803-R	TTGATCGGCTCCAATCTGTCCAACCATAGAACCCGGAAAC
F202H-6803-F	GGACAGATTCATGCCGATCAAATGGAAGTAACTATGCGTC
F202H-6803-R	TTGATCGGCATGAATCTGTCCAACCATAGAACCCGGAAAC
F202I-6803-F	GGACAGATTATCGCCGATCAAATGGAAGTAACTATGCGTC
F202I-6803-R	TTGATCGGCGATAATCTGTCCAACCATAGAACCCGGAAAC
F202K-6803-F	GGACAGATTAAGGCCGATCAAATGGAAGTAACTATGCGTC
F202K-6803-R	TTGATCGGCCTTAATCTGTCCAACCATAGAACCCGGAAAC
F202L-6803-F	GGACAGATTTTGGCCGATCAAATGGAAGTAACTATGCGTC
F202L-6803-R	TTGATCGGCCAAAATCTGTCCAACCATAGAACCCGGAAAC
F202M-6803-F	GGACAGATTATGGCCGATCAAATGGAAGTAACTATGCGTC
F202M-6803-R	TTGATCGGCCATAATCTGTCCAACCATAGAACCCGGAAAC
F202N-6803-F	GGACAGATTAACGCCGATCAAATGGAAGTAACTATGCGTC
F202N-6803-R	TTGATCGGCGTTAATCTGTCCAACCATAGAACCCGGAAAC
F202P-6803-F	GGACAGATTCCAGCCGATCAAATGGAAGTAACTATGCGTC
F202P-6803-R	TTGATCGGCTGGAATCTGTCCAACCATAGAACCCGGAAAC
F202Q-6803-F	GGACAGATTCAGGCCGATCAAATGGAAGTAACTATGCGTC
F202Q-6803-R	TTGATCGGCCTGAATCTGTCCAACCATAGAACCCGGAAAC
F202R-6803-F	GGACAGATTCGCGCCGATCAAATGGAAGTAACTATGCGTC
F202R-6803-R	TTGATCGGCGCGAATCTGTCCAACCATAGAACCCGGAAAC
F202S-6803-F	GGACAGATTAGCGCCGATCAAATGGAAGTAACTATGCGTC
F202S-6803-R	TTGATCGGCGCTAATCTGTCCAACCATAGAACCCGGAAAC
F202V-6803-F	GGACAGATTGTAGCCGATCAAATGGAAGTAACTATGCGTC
F202V-6803-R	TTGATCGGCTACAATCTGTCCAACCATAGAACCCGGAAAC
F202T-6803-F	GGACAGATTACCGCCGATCAAATGGAAGTAACTATGCGTC
F202T-6803-R	TTGATCGGCGGTAATCTGTCCAACCATAGAACCCGGAAAC
F202W-6803-F	GGACAGATTTGGGCCGATCAAATGGAAGTAACTATGCGTC
F202W-6803-R	TTGATCGGCCCAAATCTGTCCAACCATAGAACCCGGAAAC
F202Y-6803-F	GGACAGATTTACGCCGATCAAATGGAAGTAACTATGCGTC
F202Y-6803-R	TTGATCGGCGTAAATCTGTCCAACCATAGAACCCGGAAAC

Open in a new tab

Determination of kinetic parameters of enzymatic reaction.

Purified wild-type nitrilase and mutants were used to evaluate the kinetics of the enzymatic reaction, and 10 mM, 20 mM, 30 mM, 40 mM, and 50 mM final substrate concentrations were added to the reaction system, respectively (an equal volume of PBS buffer was used as a blank control). Then, the enzyme activities of nitrilase under different substrate concentrations were detected. All the activities were measured in triplicate. The double-reciprocal method was used to fit the kinetic equation of the enzymatic reaction and to calculate K_m and K_cat.

Computational methods.

(i) Molecular docking. The nitrilase Nit6803 structure file (PDB ID 3wuy) was obtained from the PDB database. The structures of LsNit, RsNit, and SmNit were predicted by AlphaFold 2.0 (31). The SDF file of the 3D structure of the substrates was obtained from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/) and converted to PDB format by PyMOL. AutoDock 4.2 (32) was used to dock substrate molecules to nitrilase proteins, and the Lamarckian genetic algorithm was utilized as a search engine. During the docking process, the substrates were used as a ligand and were set to be flexible, and the nitrilase proteins were used as a receptor and were set to be rigid.

(ii) Analysis of active pocket and substrate pocket. In this study, according to the structure of the enzyme-substrate complex generated by molecular docking, the amino acid residues within the 6-Å range of the substrate molecule were defined as the active pocket. Then, the CAVER (33) plugin was used for computational analysis of enzyme activity pocket substrate channels. The ProteinsPlus (34) (https://proteins.plus/) online server was used to calculate the volume of active cavity.

(iii) Molecular dynamics simulation. The GROMACS 2021.3 (35, 36) software package was utilized for molecular dynamics (MD) simulations, using the AMBER99SB-ILDN (37) (protein) and GAFF (substrate small molecule) force field at 300 K. The protein was set in a cubic box and solvated with water. Then, the charge of the system was neutralized by Na⁺ and Cl⁻ to make it neutral. Before molecular dynamics simulation, the system had been energy minimized and NVT (canonical ensemble) and NPT (constant-pressure, constant-temperature) equilibrated. The root mean square deviation (RMSD) was detected during the MD process, and the stability of the RMSD value of the backbone atoms of nitrilases was used as the criterion for MD convergence. After the molecular dynamics simulation, the VMD 1.9.3 (38) (http://www.ks.uiuc.edu/Research/vmd/) program was used for dynamic simulation trajectory analysis and statistical calculation.

ACKNOWLEDGMENTS

This work was financially supported by the National Natural Science Foundation of China (no. 32171261), the National Key Research and Development Program of China (no. 2021YFC2100900), the Natural Science Foundation of Jiangsu Province (no. BK20221082) the Fundamental Research Funds for the Central Universities (no. JUSRP21940), and the Postgraduate Research & Practice Innovation Program of Jiangsu Province (no. KYCX22_2368).

Footnotes

Supplemental material is available online only.

Supplemental file 1

Supplemental material. Download aem.00220-23-s0001.docx, DOCX file, 10.0 MB^{(10MB, docx)}

Contributor Information

Jin-Song Gong, Email: jinsonggong.bio@hotmail.com.

Zhen-Ming Lu, Email: zmlu@jiangnan.edu.cn.

Marina Lotti, University of Milano-Bicocca.

REFERENCES

1.Gong JS, Shi JS, Lu ZM, Li H, Zhou ZM, Xu ZH. 2017. Nitrile-converting enzymes as a tool to improve biocatalysis in organic synthesis: recent insights and promises. Crit Rev Biotechnol 37:69–81. doi: 10.3109/07388551.2015.1120704. [DOI] [PubMed] [Google Scholar]
2.Brunner S, Eppinger E, Fischer S, Groning J, Stolz A. 2018. Conversion of aliphatic nitriles by the arylacetonitrilase from Pseudomonas fluorescens EBC191. World J Microbiol Biotechnol 34:91. doi: 10.1007/s11274-018-2477-9. [DOI] [PubMed] [Google Scholar]
3.Chauhan S, Wu S, Blumerman S, Fallon RD, Gavagan JE, DiCosimo R, Payne MS. 2003. Purification, cloning, sequencing and over-expression in Escherichia coli of a regioselective aliphatic nitrilase from Acidovorax facilis 72W. Appl Microbiol Biotechnol 61:118–122. doi: 10.1007/s00253-002-1192-4. [DOI] [PubMed] [Google Scholar]
4.Zhang L, Yin B, Wang C, Jiang S, Wang H, Yuan YA, Wei D. 2014. Structural insights into enzymatic activity and substrate specificity determination by a single amino acid in nitrilase from Synechocystis sp. PCC6803. J Struct Biol 188:93–101. doi: 10.1016/j.jsb.2014.10.003. [DOI] [PubMed] [Google Scholar]
5.Dhillon J, Chhatre S, Shanker R, Shivaraman N. 1999. Transformation of aliphatic and aromatic nitriles by a nitrilase from Pseudomonas sp. Can J Microbiol 45:811–815. doi: 10.1139/cjm-45-10-811. [DOI] [Google Scholar]
6.Gong JS, Zhang Q, Gu BC, Dong TT, Li H, Li H, Lu ZM, Shi JS, Xu ZH. 2018. Efficient biocatalytic synthesis of nicotinic acid by recombinant nitrilase via high density culture. Bioresour Technol 260:427–431. doi: 10.1016/j.biortech.2018.03.109. [DOI] [PubMed] [Google Scholar]
7.Gong JS, Dong TT, Gu BC, Li H, Dou WF, Lu ZM, Zhou ZM, Shi JS, Xu ZH. 2017. Semirational engineering accelerates the laboratory evolution of nitrilase catalytic efficiency for nicotinic acid biosynthesis. ChemCatChem 9:3395–3401. doi: 10.1002/cctc.201700665. [DOI] [Google Scholar]
8.Zhu XY, Gong JS, Li H, Lu ZM, Zhou ZM, Shi JS, Xu ZH. 2013. Characterization and functional cloning of an aromatic nitrilase from Pseudomonas putida CGMCC3830 with high conversion efficiency toward cyanopyridine. J Mol Catal B Enzym 97:175–183. doi: 10.1016/j.molcatb.2013.08.012. [DOI] [Google Scholar]
9.Copley SD. 2017. Shining a light on enzyme promiscuity. Curr Opin Struct Biol 47:167–175. doi: 10.1016/j.sbi.2017.11.001. [DOI] [PubMed] [Google Scholar]
10.Gong JS, Li H, Lu ZM, Zhang XJ, Zhang Q, Yu JH, Zhou ZM, Shi JS, Xu ZH. 2016. Engineering of a fungal nitrilase for improving catalytic activity and reducing by-product formation in the absence of structural information. Catal Sci Technol 6:4134–4141. doi: 10.1039/C5CY01535A. [DOI] [Google Scholar]
11.Liu ZQ, Zhang XH, Xue YP, Xu M, Zheng YG. 2014. Improvement of Alcaligenes faecalis nitrilase by gene site saturation mutagenesis and its application in stereospecific biosynthesis of (R)-(−)-mandelic acid. J Agric Food Chem 62:4685–4694. doi: 10.1021/jf405683f. [DOI] [PubMed] [Google Scholar]
12.Meng MS, Bagdasarian M, Zeikus JG. 1993. The role of active-site aromatic and polar residues in catalysis and substrate discrimination by xylose isomerase. Proc Natl Acad Sci USA 90:8459–8463. doi: 10.1073/pnas.90.18.8459. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Streltsov VA, Luang S, Peisley A, Varghese JN, Cairns JRK, Fort S, Hijnen M, Tvaroska I, Arda A, Jimenez-Barbero J, Alfonso-Prieto M, Rovira C, Mendoza F, Tiessler-Sala L, Sanchez-Aparicio JE, Rodriguez-Guerra J, Lluch JM, Marechal JD, Masgrau L, Hrmova M. 2019. Discovery of processive catalysis by an exo-hydrolase with a pocket-shaped active site. Nat Commun 10:2222. doi: 10.1038/s41467-019-09691-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Ivry SL, Meyer NO, Winter MB, Bohn MF, Knudsen GM, O'Donoghue AJ, Craik CS. 2018. Global substrate specificity profiling of post-translational modifying enzymes. Protein Sci 27:584–594. doi: 10.1002/pro.3352. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Yang J, Xu YQ, Miyakawa T, Long LJ, Tanokura M. 2020. Molecular basis for substrate recognition and catalysis by a marine bacterial laminarinase. Appl Environ Microbiol 86:e01796-20. doi: 10.1128/AEM.01796-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Salii I, Szaleniec M, Zein AA, Seyhan D, Sekuła A, Schühle K, Kaplieva-Dudek I, Linne U, Meckenstock RU, Heider J. 2021. Determinants for substrate recognition in the glycyl radical enzyme benzylsuccinate synthase revealed by targeted mutagenesis. ACS Catal 11:3361–3370. doi: 10.1021/acscatal.0c04954. [DOI] [Google Scholar]
17.Joiner CM, Li H, Jiang JY, Walker S. 2019. Structural characterization of the O-GlcNAc cycling enzymes: insights into substrate recognition and catalytic mechanisms. Curr Opin Struct Biol 56:97–106. doi: 10.1016/j.sbi.2018.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Rossjohn J, McKinstry WJ, Oakley AJ, Verger D, Flanagan J, Chelvanayagam G, Tan KL, Board PG, Parker MW. 1998. Human theta class glutathione transferase: the crystal structure reveals a sulfate-binding pocket within a buried active site. Structure 6:309–322. doi: 10.1016/s0969-2126(98)00034-3. [DOI] [PubMed] [Google Scholar]
19.Choutko A, van Gunsteren WF. 2012. Molecular dynamics simulation of the last step of a catalytic cycle: product release from the active site of the enzyme chorismate mutase from Mycobacterium tuberculosis. Protein Sci 21:1672–1681. doi: 10.1002/pro.2143. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Dundas J, Adamian L, Liang J. 2011. Structural signatures of enzyme binding pockets from order-independent surface alignment: a study of metalloendopeptidase and NAD binding proteins. J Mol Biol 406:713–729. doi: 10.1016/j.jmb.2010.12.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Meng MH, Lee CY, Bagdasarian M, Zeikus JG. 1991. Switching substrate preference of thermophilic xylose isomerase from D-xylose to D-Glucose by redesigning the substrate binding pocket. Proc Natl Acad Sci USA 88:4015–4019. doi: 10.1073/pnas.88.9.4015. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Sandstrom AG, Wikmark Y, Engstrom K, Nyhlen J, Backvall JE. 2012. Combinatorial reshaping of the Candida antarctica lipase A substrate pocket for enantioselectivity using an extremely condensed library. Proc Natl Acad Sci USA 109:78–83. doi: 10.1073/pnas.1111537108. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Mehrabi P, Di Pietrantonio C, Kim TH, Sljoka A, Taverner K, Ing C, Kruglyak N, Pomes R, Pai EF, Prosser RS. 2019. Substrate-based allosteric regulation of a homodimeric enzyme. J Am Chem Soc 141:11540–11556. doi: 10.1021/jacs.9b03703. [DOI] [PubMed] [Google Scholar]
24.Ishikawa F, Miyanaga A, Kitayama H, Nakamura S, Nakanishi I, Kudo F, Eguchi T, Tanabe G. 2019. An engineered aryl acid adenylation domain with an enlarged substrate binding pocket. Angew Chem Int Ed Engl 58:6906–6910. doi: 10.1002/anie.201900318. [DOI] [PubMed] [Google Scholar]
25.Kong XD, Yuan SG, Li L, Chen S, Xu JH, Zhou JH. 2014. Engineering of an epoxide hydrolase for efficient bioresolution of bulky pharmaco substrates. Proc Natl Acad Sci USA 111:15717–15722. doi: 10.1073/pnas.1404915111. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Chen FF, Zheng GW, Liu L, Li H, Chen Q, Li FL, Li CX, Xu JH. 2018. Reshaping the active pocket of amine dehydrogenases for asymmetric synthesis of bulky aliphatic amines. ACS Catal 8:2622–2628. doi: 10.1021/acscatal.7b04135. [DOI] [Google Scholar]
27.Qu G, Li A, Acevedo-Rocha CG, Sun Z, Reetz MT. 2020. The crucial role of methodology development in directed evolution of selective enzymes. Angew Chem Int Ed Engl 59:13204–13231. doi: 10.1002/anie.201901491. [DOI] [PubMed] [Google Scholar]
28.Sun Z, Lonsdale R, Kong XD, Xu JH, Zhou J, Reetz MT. 2015. Reshaping an enzyme binding pocket for enhanced and inverted stereoselectivity: use of smallest amino acid alphabets in directed evolution. Angew Chem Int Ed Engl 54:12410–12415. doi: 10.1002/anie.201501809. [DOI] [PubMed] [Google Scholar]
29.Lutz S. 2010. Beyond directed evolution-semi-rational protein engineering and design. Curr Opin Biotechnol 21:734–743. doi: 10.1016/j.copbio.2010.08.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Dong TT, Gong JS, Gu BC, Zhang Q, Li H, Lu ZM, Lu ML, Shi JS, Xu ZH. 2017. Significantly enhanced substrate tolerance of Pseudomonas putida nitrilase via atmospheric and room temperature plasma and cell immobilization. Bioresour Technol 244:1104–1110. doi: 10.1016/j.biortech.2017.08.039. [DOI] [PubMed] [Google Scholar]
31.Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, Tunyasuvunakool K, Bates R, Zidek A, Potapenko A, Bridgland A, Meyer C, Kohl SAA, Ballard AJ, Cowie A, Romera-Paredes B, Nikolov S, Jain R, Adler J, Back T, Petersen S, Reiman D, Clancy E, Zielinski M, Steinegger M, Pacholska M, Berghammer T, Bodenstein S, Silver D, Vinyals O, Senior AW, Kavukcuoglu K, Kohli P, Hassabis D. 2021. Highly accurate protein structure prediction with AlphaFold. Nature 596:583–589. doi: 10.1038/s41586-021-03819-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Morris GM, Huey R, Lindstrom W, Sanner MF, Belew RK, Goodsell DS, Olson AJ. 2009. AutoDock4 and AutoDockTools4: automated docking with selective receptor flexibility. J Comput Chem 30:2785–2791. doi: 10.1002/jcc.21256. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Petřek M, Otyepka M, Banáš P, Košinová P, Koča J, Damborský J. 2006. CAVER: a new tool to explore routes from protein clefts, pockets and cavities. BMC Bioinformatics 7:316. doi: 10.1186/1471-2105-7-316. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Schoning-Stierand K, Diedrich K, Fahrrolfes R, Flachsenberg F, Meyder A, Nittinger E, Steinegger R, Rarey M. 2020. ProteinsPlus: interactive analysis of protein-ligand binding interfaces. Nucleic Acids Res 48:W48–W53. doi: 10.1093/nar/gkaa235. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Berendsen HJC, van der Spoel D, van Drunen R. 1995. GROMACS - a message-passing parallel molecular-dynamics implementation. Comput Phys Commun 91:43–56. doi: 10.1016/0010-4655(95)00042-E. [DOI] [Google Scholar]
36.Van der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE, Berendsen HJC. 2005. GROMACS: fast, flexible, and free. J Comput Chem 26:1701–1718. doi: 10.1002/jcc.20291. [DOI] [PubMed] [Google Scholar]
37.Lindorff-Larsen K, Piana S, Palmo K, Maragakis P, Klepeis JL, Dror RO, Shaw DE. 2010. Improved side-chain torsion potentials for the Amber ff99SB protein force field. Proteins 78:1950–1958. doi: 10.1002/prot.22711. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Humphrey W, Dalke A, Schulten K. 1996. VMD: visual molecular dynamics. J Mol Graph 14:33–38. doi: 10.1016/0263-7855(96)00018-5. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

Supplemental material. Download aem.00220-23-s0001.docx, DOCX file, 10.0 MB^{(10MB, docx)}

[B1] 1.Gong JS, Shi JS, Lu ZM, Li H, Zhou ZM, Xu ZH. 2017. Nitrile-converting enzymes as a tool to improve biocatalysis in organic synthesis: recent insights and promises. Crit Rev Biotechnol 37:69–81. doi: 10.3109/07388551.2015.1120704. [DOI] [PubMed] [Google Scholar]

[B2] 2.Brunner S, Eppinger E, Fischer S, Groning J, Stolz A. 2018. Conversion of aliphatic nitriles by the arylacetonitrilase from Pseudomonas fluorescens EBC191. World J Microbiol Biotechnol 34:91. doi: 10.1007/s11274-018-2477-9. [DOI] [PubMed] [Google Scholar]

[B3] 3.Chauhan S, Wu S, Blumerman S, Fallon RD, Gavagan JE, DiCosimo R, Payne MS. 2003. Purification, cloning, sequencing and over-expression in Escherichia coli of a regioselective aliphatic nitrilase from Acidovorax facilis 72W. Appl Microbiol Biotechnol 61:118–122. doi: 10.1007/s00253-002-1192-4. [DOI] [PubMed] [Google Scholar]

[B4] 4.Zhang L, Yin B, Wang C, Jiang S, Wang H, Yuan YA, Wei D. 2014. Structural insights into enzymatic activity and substrate specificity determination by a single amino acid in nitrilase from Synechocystis sp. PCC6803. J Struct Biol 188:93–101. doi: 10.1016/j.jsb.2014.10.003. [DOI] [PubMed] [Google Scholar]

[B5] 5.Dhillon J, Chhatre S, Shanker R, Shivaraman N. 1999. Transformation of aliphatic and aromatic nitriles by a nitrilase from Pseudomonas sp. Can J Microbiol 45:811–815. doi: 10.1139/cjm-45-10-811. [DOI] [Google Scholar]

[B6] 6.Gong JS, Zhang Q, Gu BC, Dong TT, Li H, Li H, Lu ZM, Shi JS, Xu ZH. 2018. Efficient biocatalytic synthesis of nicotinic acid by recombinant nitrilase via high density culture. Bioresour Technol 260:427–431. doi: 10.1016/j.biortech.2018.03.109. [DOI] [PubMed] [Google Scholar]

[B7] 7.Gong JS, Dong TT, Gu BC, Li H, Dou WF, Lu ZM, Zhou ZM, Shi JS, Xu ZH. 2017. Semirational engineering accelerates the laboratory evolution of nitrilase catalytic efficiency for nicotinic acid biosynthesis. ChemCatChem 9:3395–3401. doi: 10.1002/cctc.201700665. [DOI] [Google Scholar]

[B8] 8.Zhu XY, Gong JS, Li H, Lu ZM, Zhou ZM, Shi JS, Xu ZH. 2013. Characterization and functional cloning of an aromatic nitrilase from Pseudomonas putida CGMCC3830 with high conversion efficiency toward cyanopyridine. J Mol Catal B Enzym 97:175–183. doi: 10.1016/j.molcatb.2013.08.012. [DOI] [Google Scholar]

[B9] 9.Copley SD. 2017. Shining a light on enzyme promiscuity. Curr Opin Struct Biol 47:167–175. doi: 10.1016/j.sbi.2017.11.001. [DOI] [PubMed] [Google Scholar]

[B10] 10.Gong JS, Li H, Lu ZM, Zhang XJ, Zhang Q, Yu JH, Zhou ZM, Shi JS, Xu ZH. 2016. Engineering of a fungal nitrilase for improving catalytic activity and reducing by-product formation in the absence of structural information. Catal Sci Technol 6:4134–4141. doi: 10.1039/C5CY01535A. [DOI] [Google Scholar]

[B11] 11.Liu ZQ, Zhang XH, Xue YP, Xu M, Zheng YG. 2014. Improvement of Alcaligenes faecalis nitrilase by gene site saturation mutagenesis and its application in stereospecific biosynthesis of (R)-(−)-mandelic acid. J Agric Food Chem 62:4685–4694. doi: 10.1021/jf405683f. [DOI] [PubMed] [Google Scholar]

[B12] 12.Meng MS, Bagdasarian M, Zeikus JG. 1993. The role of active-site aromatic and polar residues in catalysis and substrate discrimination by xylose isomerase. Proc Natl Acad Sci USA 90:8459–8463. doi: 10.1073/pnas.90.18.8459. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13.Streltsov VA, Luang S, Peisley A, Varghese JN, Cairns JRK, Fort S, Hijnen M, Tvaroska I, Arda A, Jimenez-Barbero J, Alfonso-Prieto M, Rovira C, Mendoza F, Tiessler-Sala L, Sanchez-Aparicio JE, Rodriguez-Guerra J, Lluch JM, Marechal JD, Masgrau L, Hrmova M. 2019. Discovery of processive catalysis by an exo-hydrolase with a pocket-shaped active site. Nat Commun 10:2222. doi: 10.1038/s41467-019-09691-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B14] 14.Ivry SL, Meyer NO, Winter MB, Bohn MF, Knudsen GM, O'Donoghue AJ, Craik CS. 2018. Global substrate specificity profiling of post-translational modifying enzymes. Protein Sci 27:584–594. doi: 10.1002/pro.3352. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15.Yang J, Xu YQ, Miyakawa T, Long LJ, Tanokura M. 2020. Molecular basis for substrate recognition and catalysis by a marine bacterial laminarinase. Appl Environ Microbiol 86:e01796-20. doi: 10.1128/AEM.01796-20. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 16.Salii I, Szaleniec M, Zein AA, Seyhan D, Sekuła A, Schühle K, Kaplieva-Dudek I, Linne U, Meckenstock RU, Heider J. 2021. Determinants for substrate recognition in the glycyl radical enzyme benzylsuccinate synthase revealed by targeted mutagenesis. ACS Catal 11:3361–3370. doi: 10.1021/acscatal.0c04954. [DOI] [Google Scholar]

[B17] 17.Joiner CM, Li H, Jiang JY, Walker S. 2019. Structural characterization of the O-GlcNAc cycling enzymes: insights into substrate recognition and catalytic mechanisms. Curr Opin Struct Biol 56:97–106. doi: 10.1016/j.sbi.2018.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 18.Rossjohn J, McKinstry WJ, Oakley AJ, Verger D, Flanagan J, Chelvanayagam G, Tan KL, Board PG, Parker MW. 1998. Human theta class glutathione transferase: the crystal structure reveals a sulfate-binding pocket within a buried active site. Structure 6:309–322. doi: 10.1016/s0969-2126(98)00034-3. [DOI] [PubMed] [Google Scholar]

[B19] 19.Choutko A, van Gunsteren WF. 2012. Molecular dynamics simulation of the last step of a catalytic cycle: product release from the active site of the enzyme chorismate mutase from Mycobacterium tuberculosis. Protein Sci 21:1672–1681. doi: 10.1002/pro.2143. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20.Dundas J, Adamian L, Liang J. 2011. Structural signatures of enzyme binding pockets from order-independent surface alignment: a study of metalloendopeptidase and NAD binding proteins. J Mol Biol 406:713–729. doi: 10.1016/j.jmb.2010.12.005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21.Meng MH, Lee CY, Bagdasarian M, Zeikus JG. 1991. Switching substrate preference of thermophilic xylose isomerase from D-xylose to D-Glucose by redesigning the substrate binding pocket. Proc Natl Acad Sci USA 88:4015–4019. doi: 10.1073/pnas.88.9.4015. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22.Sandstrom AG, Wikmark Y, Engstrom K, Nyhlen J, Backvall JE. 2012. Combinatorial reshaping of the Candida antarctica lipase A substrate pocket for enantioselectivity using an extremely condensed library. Proc Natl Acad Sci USA 109:78–83. doi: 10.1073/pnas.1111537108. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23.Mehrabi P, Di Pietrantonio C, Kim TH, Sljoka A, Taverner K, Ing C, Kruglyak N, Pomes R, Pai EF, Prosser RS. 2019. Substrate-based allosteric regulation of a homodimeric enzyme. J Am Chem Soc 141:11540–11556. doi: 10.1021/jacs.9b03703. [DOI] [PubMed] [Google Scholar]

[B24] 24.Ishikawa F, Miyanaga A, Kitayama H, Nakamura S, Nakanishi I, Kudo F, Eguchi T, Tanabe G. 2019. An engineered aryl acid adenylation domain with an enlarged substrate binding pocket. Angew Chem Int Ed Engl 58:6906–6910. doi: 10.1002/anie.201900318. [DOI] [PubMed] [Google Scholar]

[B25] 25.Kong XD, Yuan SG, Li L, Chen S, Xu JH, Zhou JH. 2014. Engineering of an epoxide hydrolase for efficient bioresolution of bulky pharmaco substrates. Proc Natl Acad Sci USA 111:15717–15722. doi: 10.1073/pnas.1404915111. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26.Chen FF, Zheng GW, Liu L, Li H, Chen Q, Li FL, Li CX, Xu JH. 2018. Reshaping the active pocket of amine dehydrogenases for asymmetric synthesis of bulky aliphatic amines. ACS Catal 8:2622–2628. doi: 10.1021/acscatal.7b04135. [DOI] [Google Scholar]

[B27] 27.Qu G, Li A, Acevedo-Rocha CG, Sun Z, Reetz MT. 2020. The crucial role of methodology development in directed evolution of selective enzymes. Angew Chem Int Ed Engl 59:13204–13231. doi: 10.1002/anie.201901491. [DOI] [PubMed] [Google Scholar]

[B28] 28.Sun Z, Lonsdale R, Kong XD, Xu JH, Zhou J, Reetz MT. 2015. Reshaping an enzyme binding pocket for enhanced and inverted stereoselectivity: use of smallest amino acid alphabets in directed evolution. Angew Chem Int Ed Engl 54:12410–12415. doi: 10.1002/anie.201501809. [DOI] [PubMed] [Google Scholar]

[B29] 29.Lutz S. 2010. Beyond directed evolution-semi-rational protein engineering and design. Curr Opin Biotechnol 21:734–743. doi: 10.1016/j.copbio.2010.08.011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B30] 30.Dong TT, Gong JS, Gu BC, Zhang Q, Li H, Lu ZM, Lu ML, Shi JS, Xu ZH. 2017. Significantly enhanced substrate tolerance of Pseudomonas putida nitrilase via atmospheric and room temperature plasma and cell immobilization. Bioresour Technol 244:1104–1110. doi: 10.1016/j.biortech.2017.08.039. [DOI] [PubMed] [Google Scholar]

[B31] 31.Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, Tunyasuvunakool K, Bates R, Zidek A, Potapenko A, Bridgland A, Meyer C, Kohl SAA, Ballard AJ, Cowie A, Romera-Paredes B, Nikolov S, Jain R, Adler J, Back T, Petersen S, Reiman D, Clancy E, Zielinski M, Steinegger M, Pacholska M, Berghammer T, Bodenstein S, Silver D, Vinyals O, Senior AW, Kavukcuoglu K, Kohli P, Hassabis D. 2021. Highly accurate protein structure prediction with AlphaFold. Nature 596:583–589. doi: 10.1038/s41586-021-03819-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B32] 32.Morris GM, Huey R, Lindstrom W, Sanner MF, Belew RK, Goodsell DS, Olson AJ. 2009. AutoDock4 and AutoDockTools4: automated docking with selective receptor flexibility. J Comput Chem 30:2785–2791. doi: 10.1002/jcc.21256. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33.Petřek M, Otyepka M, Banáš P, Košinová P, Koča J, Damborský J. 2006. CAVER: a new tool to explore routes from protein clefts, pockets and cavities. BMC Bioinformatics 7:316. doi: 10.1186/1471-2105-7-316. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34.Schoning-Stierand K, Diedrich K, Fahrrolfes R, Flachsenberg F, Meyder A, Nittinger E, Steinegger R, Rarey M. 2020. ProteinsPlus: interactive analysis of protein-ligand binding interfaces. Nucleic Acids Res 48:W48–W53. doi: 10.1093/nar/gkaa235. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35.Berendsen HJC, van der Spoel D, van Drunen R. 1995. GROMACS - a message-passing parallel molecular-dynamics implementation. Comput Phys Commun 91:43–56. doi: 10.1016/0010-4655(95)00042-E. [DOI] [Google Scholar]

[B36] 36.Van der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE, Berendsen HJC. 2005. GROMACS: fast, flexible, and free. J Comput Chem 26:1701–1718. doi: 10.1002/jcc.20291. [DOI] [PubMed] [Google Scholar]

[B37] 37.Lindorff-Larsen K, Piana S, Palmo K, Maragakis P, Klepeis JL, Dror RO, Shaw DE. 2010. Improved side-chain torsion potentials for the Amber ff99SB protein force field. Proteins 78:1950–1958. doi: 10.1002/prot.22711. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38.Humphrey W, Dalke A, Schulten K. 1996. VMD: visual molecular dynamics. J Mol Graph 14:33–38. doi: 10.1016/0263-7855(96)00018-5. [DOI] [PubMed] [Google Scholar]

PERMALINK

Geometric Remodeling of Nitrilase Active Pocket Based on ALF-Scanning Strategy To Enhance Aromatic Nitrile Substrate Preference and Catalytic Efficiency

Zi-Kai Wang

Jin-Song Gong

Dan-Ting Feng

Chang Su

Hui Li

Zhi-Ming Rao

Zhen-Ming Lu

Jin-Song Shi

Zheng-Hong Xu

Roles

ABSTRACT

INTRODUCTION

RESULTS AND DISCUSSION

Analysis of nitrilase active pocket cavity.

FIG 1.

ALF-scanning of the nitrilase active pocket.

FIG 2.

Site-directed saturation mutagenesis and enzymatic characterization.

FIG 3.

Exploring the synergistic effect of mutants.

FIG 4.

FIG 5.

FIG 6.

Mechanism of V198L/W170G substrate preference change.

TABLE 1.

FIG 7.

FIG 8.

FIG 9.

Rational design to enhance the substrate preference of LsNit, RsNit, and SmNit toward aromatic nitriles.

TABLE 2.

Conclusion.

MATERIALS AND METHODS

Strains and reagents.

Cloning and protein expression and purification.

Nitrilase assay and analytical methods.

Site-directed mutagenesis.

TABLE 3.

Determination of kinetic parameters of enzymatic reaction.

Computational methods.

ACKNOWLEDGMENTS

Footnotes

Contributor Information

REFERENCES

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases