Skip to main content
NCBI home page
Parasitology logoLink to Parasitology
. 2020 Jun 3;147(10):1149–1157. doi: 10.1017/S0031182020000906

Mitochondrial DNA dataset suggest that the genus Sphaerirostris Golvan, 1956 is a synonym of the genus Centrorhynchus Lühe, 1911

Nehaz Muhammad 1, Suleman 2, Munawar Saleem Ahmad 2, Liang Li 3,✉, Qing Zhao 3, Hanif Ullah 4, Xing-Quan Zhu 1,5, Jun Ma 1
PMCID: PMC10317752  PMID: 32487273

Abstract

Our present genetic data of Acanthocephala, especially the mitochondrial (mt) genomes, remains very limited. In the present study, the nearly complete mt genome sequences of Sphaerirostris lanceoides (Petrochenko, 1949) was sequenced and determined for the first time based on specimens collected from the Indian pond heron Ardeola grayii (Sykes) (Ciconiiformes: Ardeidae) in Pakistan. The mt genome of S. lanceoides is 13 478 bp in size and contains 36 genes, including 12 protein-coding genes (PCGs), 22 transfer RNA genes (tRNAs) and two ribosomal RNA genes (rRNAs). Moreover, in order to clarify the phylogenetic relationship of the genera Centrorhynchus and Sphaerirostris, and to test the systematic position of S. lanceoides in the Centrorhynchidae, the phylogenetic analyses were performed using Bayesian inference and maximum likelihood methods, based on concatenated nucleotide sequences of 12 PCGs, rRNAs and tRNAs. The phylogenetic results further confirmed the monophyly of the order Polymorphida and the paraphyly of the order Echinorhynchida in the class Palaeacanthocephala. Our results also challenged the validity of the genus Sphaerirostris (Polymorphida: Centrorhynchidae) and showed a sister relationship between S. lanceoides and S. picae (Rudolphi, 1819).

Key words: Acanthocephala, Centrorhynchidae, mitochondrial genome, phylogeny, Sphaerirostris, systematics

Introduction

The phylum Acanthocephala (spiny-headed worms) is a small group of endoparasites with approximately 1300 species, commonly occurring in the intestine of various fishes, amphibians, reptiles, birds and mammals (Amin, 2013; Lisitsyna et al., 2019). In the past few decades, large numbers of new taxa of acanthocephalans have been reported worldwide (Pichelin and Cribb, 2001; Amin and Ha, 2008), which contributed useful material for understanding the evolutionary history and reconstructing the classification of the phylum Acanthocephala. In contrast, our present genetic knowledge of Acanthocephala, especially the mitochondrial genomes, are still very limited. To date, only 17 acanthocephalan species with their mt-genomes are available in the NCBI database (Steinauer et al., 2005; Gazi et al., 2012; 2015; 2016; Pan and Nie, 2013; Weber et al., 2013; Song et al., 2016; 2019; Pan and Jiang, 2018; Muhammad et al., 2019a, b, 2020a, b). The current classifications of Acanthocephala are established mainly based on morphological characters and ecological traits (Amin, 2013). The systematic status of many genera or families of Acanthocephala remains controversial.

The family Centrorhynchidae currently including approximately 120 species are placed in three genera, Centrorhynchus Lühe, (1911), Sphaerirostris Golvan (1956) and Neolacunisoma Amin and Canaris (1997) (Amin, 2013). However, the phylogenetic relationships of these three genera have not been solved. Golvan (1956) established the subgenus Sphaerirostris in the genus Centrorhynchus. Later, Golvan (1969) raised the subgenus Sphaerirostris to full genus rank. This proposal was accepted by most of the subsequent studies, i.e. Dimitrova et al. (1995, 1997), Amin and Canaris (1997), Amin et al. (2010), and Amin (2013). The genus Sphaerirostris can be distinguished from Centrorhynchus mainly based on the shape and size of trunk and testes, the pattern of the lacunar system and the morphology and armature of proboscis. However, due to the paucity of genetic data of the Centrorhynchidae, there was no phylogenetic study using molecular data to clarify the relationships of the two genera before 2020. Recently, Muhammad et al. (2020a, b) provided a phylogenetic analysis of Acanthocephala using mitogenomic data that displayed S. picae nested in some species of Centrorhynchus, but there was only one species of Sphaerirostris included in the phylogeny. However, a more rigorous phylogeny including more species from Sphaerirostris and Centrorhynchus with their mitogenomics are required to solve the phylogenetic relationships of these two genera.

In the present study, the nearly complete mitochondrial (mt) genome of S. lanceoides was sequenced and annotated for the first time, based on specimens collected from the Indian pond heron Ardeola grayii (Sykes) (Ciconiiformes: Ardeidae) in Pakistan. Moreover, in order to clarify the phylogenetic relationships of Centrorhynchus and Sphaerirostris, and to test the systematic position of S. lanceoides in the Centrorhynchidae, the phylogenetic analyses were performed using Bayesian inference (BI) and maximum likelihood (ML) methods based on concatenated nucleotide sequences of 12 protein-coding genes (PCGs), rRNAs and tRNAs genes.

Materials and methods

Parasites collection

The specimens of S. lanceoides (Petrochenko, 1949) were isolated from the intestine of the Indian pond heron Ardeola grayii (Sykes) (Ciconiiformes: Ardeidae) in the district Swabi (34°07′07.23″ N, 72°36′32.38″ E), Khyber Pakhtunkhwa Province, Pakistan, and then stored in 75% ethanol at −20°C for molecular studies. The specimens were identified as the cystacanths of S. lanceoides using morphological characters and genetic data (cox1 sequences) according to Sato et al. (2005, 2006), Torracca et al. (2010), and Kang and Li (2018).

Molecular procedures

The genomic DNA was extracted from the specimens using sodium dodecyl sulfate/proteinase K solution and column purification (Wizard® SV Genomic DNA Kit, Promega, Madison, USA) following the protocol (Gasser et al., 2006). Five short fragments (cox1, rrnL, nad5, cytb and rrnS) of the mt genome of S. lanceoides were amplified using a primer sets of NLF1/NLR1, NLF3/NLR3, NLF5/NLR5, NLF8/NLR8 and NLF11/NLR11 (Muhammad et al., 2019a). For amplification of the remaining sequences of the S. lanceoides mt genome, seven pairs of primers were designed from the amplified short fragments. The detailed information of primers was shown in Table 1. Polymerase chain reactions (PCR) were organized in a 50 μL reaction mixture, containing 2 μL DNA template, 1.5 μL of each primer, 22.5 μL dd H2O and 22.5 μL PrimeSTAR Max DNA polymerase (Takara, Dalian, China). Amplification was carried out under the following conditions: initial denaturation at 98°C for 3 min followed by 30 cycles at 96°C for 10 s, 45–60°C for 15 s, 65°C for 1 min/kb, and final extension for 10 min at 68°C. The obtained PCR products were sequenced at Genewiz company (Beijing, China) using primer walking strategy Table 2.

Table 1.

PCR primers used for the amplification of nearly complete mt genome of S. lanceoides

Primers Sequence (5′ → 3′) Gene/Region Size (bp) Reference
NLF1 GACTCCTTTACTGGTTTGATCG cox1 602 Muhammad et al. (2019a)
NLR1 GCACATAATGAAAATGAGCC
NLF3 CAGTAAGTTGACTGTGCTAAG 16S 335 Muhammad et al. (2019a)
NLR3 CCGATCTAAACTCAGATCAC
SLF4 GTTTCAGATTCGGAGTTACTC 16S-trnW 2522 This study
SLR4 CCAAAGCCCACACCCACAAC
SLF5 GGTTACATAGGTGATTGCCTAAG trnK-nad5 4000 This study
SLR5 CCGAAGAATACGCAACAAGC
NLF5 GGATTGTATTCTTTGTTGGTG nad5 302 Muhammad et al. (2019a)
NLR5 GGCGTTGGAGCTGCCATCGC
SLF7 GAAGGGGTTTGTATAGGTTG nad5-cytb 1830 This study
SLR7 CTAACGCAGATACAGGCGTAGG
NLF8 TTGGGTTATGTATTGCCGTG cytb 407 Muhammad et al. (2019a)
NLR8 GTTTTCATGAACCTTACCTC
SLF9 TGGGTTATGTATTGCTGTGG cytb-nad1 630 This study
SLR9 ATCACTCAGGCTTAATGTG
SLF10 GTTTTAGTTTTGCCTTATGG nad1 520 This study
SLR10 ATCCTCCCTACACAGGTATC
SLF11 ATCGTGCCAGCAGCTGCGGTT nad1–12S 1078 This study
SLR11 GTAGAGTCACTGTGTTACGAC
NLF11 CCAGCAGCTGCGGTTATACG 12S 450 Muhammad et al. (2019a)
NLR11 GACGGGCGATATGTACTCGC
SLF13 ATGGATTGCATTCCTGGACG 12S-cox1 3550 This study
SLR13 CACTTCAGGATGTCCAAAAAATC
Open in a new tab

Table 2.

The species, taxonomy and GenBank accession numbers for acanthocephalan used in the phylogenetic analysis in this study

Species Systematic position GenBank accession no.
Sphaerirostris lanceoides Palaeacanthocephala; Polymorphida MT476588
Centrorhynchus aluconis Palaeacanthocephala; Polymorphida KT592357
Centrorhynchus milvus Palaeacanthocephala; Polymorphida MK922344
Centrorhynchus clitorideus Palaeacanthocephala; Polymorphida MT113355
Southwellina hispida Palaeacanthocephala; Polymorphida KJ869251
Sphaerirostris picae Palaeacanthocephala; Polymorphida MK471355
Plagiorhynchus transversusvs Palaeacanthocephala; Polymorphida KT447549
Leptorhynchoides thecatus Palaeacanthocephala; Echinorhynchida NC_006892
Echinorhynchus truttae Palaeacanthocephala; Echinorhynchida FR856883
Cavisoma magnum Palaeacanthocephala; Echinorhynchida MN562586
Brentisentis yangtzensis Palaeacanthocephala; Echinorhynchida MK651258
Oncicola luehei Archiacanthocephala; Oligacanthorhynchida NC_016754
Macracanthorhynchus hirudinaceus Archiacanthocephala; Oligacanthorhynchida FR856886
Hebesoma violentum Eoacanthocephala; Neoechinorhynchida KC415004
Acanthogyrus cheni Eoacanthocephala; Gyracanthocephala KX108947
Paratenuisentis ambiguus Eoacanthocephala; Neoechinorhynchida FR856885
Pallisentis celatus Eoacanthocephala; Gyracanthocephala JQ943583
Polyacanthorhynchus caballeroi Polyacanthocephala; Polyacanthorhynchida KT592358
Open in a new tab

Newly sequenced species is shown in bold.

The chromatograms were examined using Chromas v.1.62. The complete mt genome sequences of S. lanceoides were assembled manually using the program DNAstar v7.1 (Burland, 2000). The MEGA7 (Kumar et al., 2016) was used to analyse the nucleotide composition and codon usage. The boundaries of two ribosomal RNA genes (rrnL and rrnS) and 12 PCGs were identified by comparison with S. picae (MK471355) and Centrorhynchus aluconis (KT592357). The sequences alignment was performed using MAFFT 7.130. The 12 PCGs amino acid sequences were obtained with the help of MEGA7, while invertebrate mt code was chosen. The transfer RNA genes (tRNAs) were identified using ARWEN (Laslett and Canback, 2008) and MITOS web server (Bernt et al., 2013) or by alignment with other centrorhynchid species. The 12 PCGs codon usage and relative synonymous codon usage (RSCU) were determined using PhyloSuite v1.1.15 (Zhang et al., 2020). RSCU figure was drawn by ggplot2 plugin (Wickham, 2016).

Phylogenetic analysis

Phylogenetic analyses were conducted using the newly sequenced S. lanceoides and 17 other acanthocephalans mitogenome based on 12 PCGs, two rRNAs and 22 tRNAs sequences. Two species of Bdelloidea Rotaria rotatoria (NC013568.1) and Philodina citrina (FR856884.1) were chosen as the out-groups according to the previous studies (García-Varela et al., 2002; García-Varela and Nadler, 2006; Gazi et al., 2012, 2015, 2016). The nucleotide sequences of 12 PCGs, 22 tRNAs and two rRNAs of all included mitogenomes were collected from GenBank files, using PhyloSuite (Zhang et al., 2020). Phylogenetic analyses were operated using the codon-based alignment of nucleotide sequences of PCGs + Q-INS-i strategy of alignment for tRNAs and rRNAs. The nucleotide sequences of each gene were aligned in batches using MAFFT Ver 7.122, poorly aligned regions were excluded using Gblocks 0.91b (Talavera and Castresana, 2007).

The sequences were finally concatenated into a single alignment used to generate nexus files in PhyloSuite. Phylogenetic analyses were conducted using BI and ML methods. Based on the Akaike's information criterion, as implemented in ModelFinder (Kalyaanamoorthy et al., 2017), GTR + F + I + G4 and GTR + F + R5 were selected as best-fitting models for nucleotide evolution for the BI and ML analyses, respectively. Phylogenetic analysis was done based on the ML method using IQ-Tree (Nguyen et al., 2015) by carrying out ultrafast bootstraps (Minh et al., 2013) with 5000 replicates. Phylogenies based on BI were constructed using MrBayes 3.2.6 (Ronquist et al., 2012) with default setting and BI analysis was run for 3 × 106 metropolis-coupled Markov chain Monte Carlo generations and sampling a tree with every 1000 generations. The first 25% (750) trees were treated as ‘burn-in’. Finally, the phylograms were viewed and annotated by iTOL (Letunic and Bork, 2016) and Adobe Illustrator® with the help of PhyloSuite generated dataset files.

Results and discussion

Identification of S. lanceoides

Small, whitish worms, trunk spindle-shaped, 3.07 mm long (posterior end retracted), with maximum width 0.84 mm. Proboscis is divided into two parts separated by constriction; anterior proboscis nearly spherical, 0.48 × 0.42 mm2, with 34 longitudinal rows of 11 hooks each. Posterior proboscis cylindrical, 0.18 × 0.41 mm2, with 30 longitudinal rows of 4 hooks each. Proboscis receptacle and lemnisci not clear. Uterus 0.10 × 0.06 mm2; vagina 0.17–0.10 mm. Eggs absent.

The morphology and morphometrics of our specimens are almost identical with the descriptions of the cystacanths of S. lanceoides by Sato et al. (2005, 2006), Torracca et al. (2010) and Kang and Li (2018), including the size and morphology of the trunk and proboscis, the number of the longitudinal rows of proboscis hooks and the hooks per longitudinal row (Fig. 1). Moreover, pairwise comparison of the cox1 sequences of our specimens with that of S. lanceoides (MG931942.1) available in GenBank provided by Kang and Li (2018), displayed 98.21% of nucleotide similarity. The morphological and genetic evidence both supported that our present specimens collected from A. grayii in Pakistan to be the species S. lanceoides.

Fig. 1.

Fig. 1.

Open in a new tab

Photomicrographs of cystacanths of Sphaerirostris lanceoides. A, sample collected from A. grayii (Ciconiiformes: Ardeidae) in Pakistan (posterior end of trunk retracted); B, sample collected from Bufo gargarizans (Amphibia: Anura) in China; C, proboscis of sample collected from Pakistan. Scale bars: A,B = 0.5 mm, C = 0.1 mm. B, anterior part of female; C, region of testes; D, posterior part of male; E, posterior end of male (arrow indicated gonopore); F, posterior end of female (arrow indicated gonopore). B, bursa; C, cement glands; G, gonopore; L, lemnisci; N, neck; R, proboscis receptacle; T, testes.

General characterization of S. lanceoides mt genome

The nearly complete mt genome (excluding NCR1) of S. lanceoides was 13 478 bp in length, containing 12 PCGs (missing atp8) (cox1–3, atp6, nad1–6, nad4L and cytb), 22 tRNAs and two rRNA (rrnL or 16S and rrnS or 12S) (Table 3). The 12 PCGs were 10 302 bp in length, excluding termination codons, which encoded 3434 amino acids (Table 4). The component and usages of codons in the S. lanceoides mt genome were shown in Fig. 2 and Table 5. GTG and ATG were used as start codons in 12 PCGs of mt genome of S. lanceoides, whereas TAA, TAG and T were used as termination codons (Table 3). The gene arrangement of all 36 genes and NCRs (Fig. 3) was the same as that in the mitogenome of S. picae (Muhammad et al., 2019a).

Table 3.

Organization of the nearly complete mitochondrial genome of Sphaerirostris lanceoides

Gene/Region Positions Size (bp) No. of aa Ini/Ter codons tRNA anti-codon Int. seq.
cox1 1–1533 1533 510 GTG/TAG +2
trnG 1536–1589 54 TCC −7
trnQ 1583–1643 61 TTG −4
trnY 1640–1693 54 GTA −5
rrnL 1689–2591 903 0
trnL1 2592–2642 51 TAG +11
nad6 2654–3077 424 141 GTG/T +1
trnD 3079–3132 54 GTC +63
trnS2 3196–3245 50 TGA −7
atp6 3239–3805 567 188 ATG/TAA 0
nad3 3806–4151 346 115 ATG/T 0
trnW 4152–4210 59 TCA 0
trnV 4211–4271 61 TAC +10
trnK 4282–4339 58 CTT −5
trnE 4335–4391 57 TTC +8
trnT 4400–4459 60 TGT +57
nad4L 4517–4789 273 90 GTG/TAA +16
nad4 4806–6107 1302 433 ATG/TAG 0
trnH 6108–6158 51 GTG 0
nad5 6159–7799 1641 546 GTG/TAA +5
trnL2 7805–7857 53 TAA 0
trnP 7858–7910 53 TGG 0
cytb 7911–9047 1137 378 GTG/TAG +17
nad1 9065–9931 867 289 GTG/TAA +2
trnI 9934–9987 54 GAT 0
NCR2 9988– 10 275 288 0
trnM 10 276– 10 329 54 CAT 0
rrnS 10 330– 10 908 579 −8
trnF 10 901– 10 951 51 GAA 0
cox2 10 952– 11 581 630 209 GTG/TAG +8
trnC 11 590– 11 642 53 GCA +16
cox3 11 659– 12 370 712 237 GTG/T +1
trnA 12 372– 12 424 53 TGC 0
trnR 12 425– 12 476 49 TCG −5
trnN 12 472– 12 526 55 GTT +3
trnS1 12 530– 12 584 55 ACT −1
nad2 12 584– 13 478 895 298 GTG/T 0
Open in a new tab

NCR, non-coding region; bp, base pair; aa, amino acid; Ini/Ter, initial/terminal codons; Int. seq, intergenic sequences.

Table 4.

Nucleotide composition of the mitochondrial genome of Sphaerirostris lanceoides

Nucleotide sequence Size (bp) A (%) C (%) T (%) G (%) A + T (%) G + C (%)
Entire (Exclude NCR1) 13 478 21.6 7.9 36.5 34.0 58.0 41.9
Protein coding 10 299 19.3 7.3 37.5 35.9 56.8 43.2
Codon positiona
1st 3433 21.5 7.6 29.5 41.4 51.0 49.0
2nd 3433 14.3 10.2 48.2 27.3 62.5 37.5
3rd 3433 22.2 4.3 34.8 38.8 57.0 43.1
Ribosomal RNA gene 1482 30.6 10.2 31.6 27.7 62.2 37.9
Transfer RNA gene 1200 26.2 10.0 35.0 28.8 61.2 38.8
Non-coding region 2 288 30.6 7.6 34.0 27.8 64.6 35.4
Open in a new tab
a

Termination codons are excluded.

Fig. 2.

Fig. 2.

Open in a new tab

Relative Synonymous Codon Usage (RSCU) of 12 PCGs of S. lanceoides, on the x-axis the codon families are labelled. Amino acid usage in percentage is represented by values on the top of each bar.

Table 5.

Genetic code and codon usage for the 12 mitochondrial protein-coding genes of Sphaerirostris lanceoides

Codon aa No. % Codon aa No. %
TTT Phe 187 5.45 TAT Tyr 111 3.23
TTC Phe 14 0.41 TAC Tyr 12 0.35
TTA Leu 159 4.63 TAA * 0 0.00
TTG Leu 260 7.57 TAG * 0 0.00
CTT Leu 31 0.90 CAT His 36 1.04
CTC Leu 4 0.12 CAC His 5 0.15
CTA Leu 17 0.50 CAA Gln 8 0.23
CTG Leu 32 0.93 CAG Gln 19 0.55
ATT Ile 126 3.67 AAT Asn 41 1.19
ATC Ile 9 0.26 AAC Asn 2 0.06
ATA Met 64 1.86 AAA Lys 21 0.61
ATG Met 132 3.84 AAG Lys 39 1.14
GTT Val 229 6.67 GAT Asp 60 1.75
GTC Val 26 0.76 GAC Asp 7 0.20
GTA Val 126 3.67 GAA Glu 39 1.14
GTG Val 238 6.93 GAG Glu 91 2.65
TCT Ser 40 1.16 TGT Cys 32 0.93
TCC Ser 11 0.32 TGC Cys 5 0.15
TCA Ser 18 0.52 TGA Trp 54 1.57
TCG Ser 16 0.47 TGG Trp 93 2.71
CCT Pro 32 0.93 CGT Arg 13 0.41
CCC Pro 7 0.20 CGC Arg 1 0.03
CCA Pro 11 0.32 CGA Arg 19 0.55
CCG Pro 10 0.29 CGG Arg 16 0.47
ACT Thr 29 0.84 AGT Ser 44 1.28
ACC Thr 4 0.12 AGC Ser 8 0.23
ACA Thr 15 0.44 AGA Ser 59 1.72
ACG Thr 18 0.52 AGG Ser 127 3.70
GCT Ala 60 1.75 GGT Gly 122 3.55
GCC Ala 10 0.29 GGC Gly 21 0.61
GCA Ala 30 0.87 GGA Gly 121 3.52
GCG Ala 38 1.11 GGG Gly 204 5.94
Open in a new tab

No., number of copies; *, stop (termination) codon; aa, amino acid.

Fig. 3.

Fig. 3.

Open in a new tab

Linearized comparison of the mitochondrial gene arrangement for 18 acanthocephalan species and two rotifer species. Genome and Gene size are not to the scale. All genes are encoded from left to right in the same direction. The tRNAs are labelled by single-letter code for the corresponding amino acid. The red colour indicates the newly complete mtDNA sequenced species in this study.

Phylogenetic analyses

The phylogenetic trees were built using BI and ML methods. The phylogenetic tree using BI analysis showed nearly identical topology to the ML tree (Fig. 4a and b). Both phylogenetic trees showed that the class Archiacanthocephala, including representatives O. luehei and M. herudinaceus (Oligacanthorynchida: Oligacanthorynchidae), was a monophyletic group, which represented a basal clade of Acanthocephala. The present results agreed well with the previous molecular phylogenetic studies (Near et al., 1998; García-Varela et al., 2000; Near, 2002; García-Varela and Nadler, 2005; Verweyen et al., 2011; Weber et al., 2013; Gazi et al., 2015). Our phylogenetic results also revealed that the representative of the class Polyacanthocephala (P. caballeroi) nested within the class Eoacanthocephala, which seems to suggest that the members of the class Polyacanthocephala should be considered as members of the class Eoacanthocephala (Fig. 4a and b). The interrelationships among the four classes of Acanthocephala revealed by the present phylogenetic analysis are consistent with the previous phylogenomic studies (Gazi et al., 2016; Muhammad et al., 2019a, b, 2020a, b; Song et al., 2019).

Fig. 4.

Fig. 4.

Open in a new tab

(A) Phylogenetic analysis of Acanthocephala using Bayesian inference based on concatenated amino acid sequences of 12 protein-coding genes. Philodina citrina (FR856884.1) and Rotaria rotatoria (GQ304898.1) (Bdelloidea: Rotifera) treated as out-groups. (B) Phylogeny of Acanthocephala based on available mitochondrial genome data. The phylogram was constructed based on maximum likelihood (ML) methods using concatenated nucleotide sequences of protein-coding genes, rRNAs and tRNAs of 18 acanthocephalan mitogenomes. The newly sequenced species is indicated by red colour. Rotaria rotatoria (GQ304898.1) and Philodina citrina (FR856884.1) (Bdelloidea: Rotifera) was used as outgroup.

In Palaeacanthocephala, the order Polymorphida with only 7 representatives was supported to be a monophyletic clade in the phylogenetic tree, in contrast, the order Echinorhynchida was displayed to be a paraphyletic group. The phylogenetic results agreed well with the recent phylogenetic study (Muhammad et al., 2020a, b) and some previous molecular studies based on some nuclear and mitochondrial genetic markers i.e. SSU/LSU + SSU/SSU + LSU + cox1 (García-Varela et al., 2002; García-Varela and Nadler, 2005, 2006; García-Varela and González-Oliver, 2008; Verweyen et al., 2011). In our phylogenetic trees, the species S. lanceoides grouped together with S. picae, and they both nested in the representatives of the genus Centrorhynchus in the family Centrorhynchidae with strong nodal support (BPP = 1). The results indicated that the validity of the genus Sphaerirostris seems to be challenged. It seems that these morphological characters for differentiating the genera Sphaerirostris and Centrorhynchus, i.e. the shape and size of trunk and testes, the pattern of the lacunar system and the morphology and armature of proboscis, have restricted taxonomic value of generic importance. However, we do not make any immediate change on the systematic status of Sphaerirostris, because only a few species of Sphaerirostris were included in the present phylogenetic analyses. A more rigorous phylogenetic study with broader representatives of the family Centrorhynchidae based on the nuclear and mt genomic data is required to further clarify the systematic status of Sphaerirostris in the future.

Concluding remarks

In the present study, the characterization of the nearly complete mt genome of S. lanceoides was reported for the first time based on specimens collected from the Indian pond heron (Ardeola grayii, Ardeidae) in Pakistan. The nearly complete mt genome (excluding NCR1) of S. lanceoides is 13 478 bp in length. Phylogenetic analyses using concatenated nucleotide sequences of 12 PCGs, rRNAs and tRNAs further confirmed the monophyly of the order Polymorphida and the paraphyly of the order Echinorhynchida in the class Palaeacanthocephala. Our phylogenetic results also challenged the validity of the genus Sphaerirostris (Polymorphida: Centrorhynchidae) and showed the sister relationship between S. lanceoides and S. picae.

Financial support

This study was supported by the National Natural Science Foundation of China (Grant nos. 31872197 and 31702225), the International Science and Technology Cooperation Project of Gansu Provincial Key Research and Development Program (Grant No. 17JR7WA031), the Elite Program of Chinese Academy of Agricultural Sciences, and the Agricultural Science and Technology Innovation Program (ASTIP) (Grant No. CAAS-ASTIP-2016-LVRI-03) and the Strategic Priority Research Program of the Chinese Academy of Sciences (XDB26000000).

Conflict of interest

The authors declare that there are no conflicts of interest.

Ethical standards

The collection of parasite specimens from the Indian pond heron (Ardeola grayii) was approved by the Animal Ethics Committee of the University of Swabi, Pakistan. All animals were handled in strict accordance with good animal practice according to the Animal Ethics Procedures and Guidelines of Pakistan.

References

  1. Amin OM (2013) Classification of the Acanthocephala. Folia Parasitologica 60, 273–305. [DOI] [PubMed] [Google Scholar]
  2. Amin OM and Canaris A (1997) Description of Neolacunisoma Geraldschmidti gen. n., sp. n., (Acanthocephala: Centrorhynchidae) from South African shorebirds. Journal of Helminthological Society of Washington 64, 275–280. [Google Scholar]
  3. Amin OM and Ha NV (2008) On a new acanthocephalan family and a new order, from birds in Vietnam. Journal of Parasitology 94, 1305–1310. [DOI] [PubMed] [Google Scholar]
  4. Amin OM, Heckmann RA, Halajian A and Eslami A (2010) Redescription of Sphaerirostris Picae (Acanthocephala: Centrorhynchidae) from magpie, Pica pica, in northern Iran, with special reference to unusual receptacle structures and notes on histopathology. Journal of Parasitology 96, 561–568. [DOI] [PubMed] [Google Scholar]
  5. Bernt M, Donath A, Juhling F, Externbrink F, Florentz C, Fritzsch G, Putz M, Middendorf M and Stadler PF (2013) MITOS: improved de novo metazoan mitochondrial genome annotation. Molecular Phylogenetics and Evolution 69, 313–319. [DOI] [PubMed] [Google Scholar]
  6. Burland (2000) DNASTAR's Lasergene sequence analysis software. Methods Molecular Biology 132, 71–91. [DOI] [PubMed] [Google Scholar]
  7. Dimitrova ZM, Murai E and Genov T (1995) Some species of the family Centrorhynchidae Van Cleave, 1916 (Acanthocephala) from Hungarian birds. Parasitologia Hungarica 28, 89–99. [Google Scholar]
  8. Dimitrova ZM, Georgiev BB and Genov T (1997) Acanthocephalans of the family Centrorhynchidae (Palaeacanthocephala) from Bulgaria. Folia Parasitologica 44, 224–232. [Google Scholar]
  9. García-Varela M and González-Oliver A (2008) The systematic position of Leptorhynchoides (Kostylew, 1924) and Pseudoleptorhynchoides (Salgado-Maldonado, 1976), inferred from nuclear and mitochondrial DNA gene sequences. Journal of Parasitology 94, 959–962. [DOI] [PubMed] [Google Scholar]
  10. García-Varela M and Nadler SA (2005) Phylogenetic relationships of Palaeacanthocephala (Acanthocephala) inferred from SSU and LSU rDNA gene sequences. Journal of Parasitology 91, 1401–1409. [DOI] [PubMed] [Google Scholar]
  11. García-Varela M and Nadler SA (2006) Phylogenetic relationships among Syndermata inferred from nuclear and mitochondrial gene sequences. Molecular Phylogenetics and Evolution 40, 61–72. [DOI] [PubMed] [Google Scholar]
  12. García-Varela M, Perez-Ponce de Leon G, De la Torre P, Cummings MP, Sarma SS and Laclette JP (2000) Phylogenetic relationships of Acanthocephala based on analysis of 18S ribosomal RNA gene sequences. Journal of Molecular Evolution 50, 532–540. [DOI] [PubMed] [Google Scholar]
  13. García-Varela M, Cummings MP, Perez-Ponce de Leon G, Gardner SL and Laclette JP (2002) Phylogenetic analysis based on 18S ribosomal RNA gene sequences supports the existence of class Polyacanthocephala (Acanthocephala). Molecular Phylogenetics and Evolution 23, 288–292. [DOI] [PubMed] [Google Scholar]
  14. Gasser RB, Hu M, Chilton NB, Campbell BE, Jex AJ, Otranto D, Cafarchia C, Beveridge I and Zhu XQ (2006) Single strand conformation polymorphism (SSCP) for the analysis of genetic variation. Nature Protocols 1, 3121–3128. [DOI] [PubMed] [Google Scholar]
  15. Gazi M, Sultana T, Min GS, Park YC, García-Varela M, Nadler SA and Park JK (2012) The complete mitochondrial genome sequence of Oncicola Luehei (Acanthocephala: Archiacanthocephala) and its phylogenetic position within Syndermata. Parasitology International 61, 307–316. [DOI] [PubMed] [Google Scholar]
  16. Gazi M, Kim J and Park JK (2015) The complete mitochondrial genome sequence of Southwellina hispida supports monophyly of Palaeacanthocephala (Acanthocephala: Polymorphida). Parasitology International 6, 64–68. [DOI] [PubMed] [Google Scholar]
  17. Gazi M, Kim J, García-Varela M, Park C, Littlewood DTJ and Park JK (2016) Mitogenomic phylogeny of Acanthocephala reveals novel Class relationships. Zoological Scripta 45, 437–454. [Google Scholar]
  18. Golvan YJ (1956) Le genre Centrorhynchus Lühe 1911 (Acanthocephala-Polymorphidae). Révision des espèces européennes et description dune nouvelle espèce africaine parasite de rapace diurne. Bulletin de l'Institut Fondamental d'Afrique Noire (Ser. A) 18, 732–785. [Google Scholar]
  19. Golvan YJ (1969) Systematique des acanthocephales (Acanthocephala Rudolphi 1801). Premiere partie. L'ordre des Palaeacanthocephala Meyer 1931. Premier fascicule. La super-famille des Echinorhynchoidea (Cobbold 1876) Golvan et Houin 1963. Memoires du Museum National d'Histoire Naturelle, Nouvelle Serie, Serie A, Zoologie 57, 1–373. [Google Scholar]
  20. Kalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A and Jermiin LS (2017) Modelfinder: fast model selection for accurate phylogenetic estimates. Nature Methods 6, 587–589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kang J and Li L (2018) First report on cystacanths of Sphaerirostris lanceoides (Petrochenko, 1949) (Acanthocephala: Centrorhynchidae) from the Asiatic toad Bufo gargarizans Cantor (Amphibia: Anura) in China. Systematics Parasitology 95, 447–454. [DOI] [PubMed] [Google Scholar]
  22. Kumar S, Stecher G and Tamura K (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33, 1870–1874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Laslett D and Canback B (2008) ARWEN: a program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics (Oxford, England) 24, 172–175. [DOI] [PubMed] [Google Scholar]
  24. Letunic I and Bork P (2016) Interactive tree of life (iTOL) v3: an online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Research 44, 242–245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lisitsyna OI, Kudlai O, Cribb TH and Smit NJ (2019) Three new species of acanthocephalans (Palaeacanthocephala) from marine fishes collected off the East Coast of South Africa. Folia Parasitol (Praha) 6, 012.. [DOI] [PubMed] [Google Scholar]
  26. Minh BQ, Nguyen MAT and Von Haeseler A (2013) Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution 30, 1188–1195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Muhammad N, Ma J, Khan MS, Li L, Zhao Q, Ahmad MS and Zhu XQ (2019a) Characterization of the complete mitochondrial genome of Sphaerirostris picae (Rudolphi, 1819) (Acanthocephala: Centrorhynchidae), representative of the genus Sphaerirostris. Parasitology Research 118, 2213–2221. [DOI] [PubMed] [Google Scholar]
  28. Muhammad N, Ma J, Khan MS, Wu SS, Zhu XQ and Li L (2019b) Characterization of the complete mitochondrial genome of Centrorhynchus Milvus (Acanthocephala: Polymorphida) and its phylogenetic implications. Infection, Genetics, and Evolution 75, 103946. [DOI] [PubMed] [Google Scholar]
  29. Muhammad N, Khan MS, Li L, Zhao Q, Ullah H, Zhu XQ and Ma J (2020a) Characterization of the complete mitogenome of Centrorhynchus clitorideus (Meyer, 1931) (Palaeacanthocephala: Centrorhynchidae), the largest mitochondrial genome in Acanthocephala, and its phylogenetic implications. Molecular and Biochemical Parasitology 237, 111274. [DOI] [PubMed] [Google Scholar]
  30. Muhammad N, Li L, Zhao Q, Bannai MA, Mohammad ET, Khan MS and Ma J (2020b) Characterization of the complete mitochondrial genome of Cavisoma magnum (Acanthocephala: Palaeacanthocephala), first representative of the family Cavisomidae, and its phylogenetic implications. Infection, Genetics, and Evolution 80, 104173. [DOI] [PubMed] [Google Scholar]
  31. Near TJ (2002) Acanthocephalan phylogeny and the evolution of parasitism. Integrative Comparative Biology 42, 668–677. [DOI] [PubMed] [Google Scholar]
  32. Near TJ, Garey JR and Nadler SA (1998) Phylogenetic relationships of the Acanthocephala inferred from 18S ribosomal DNA sequences. Molecular Phylogenetics and Evolution 10, 287–298. [DOI] [PubMed] [Google Scholar]
  33. Nguyen LT, Schmidt HA, Von Haeseler A and Minh BQ (2015) IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32, 268–274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pan T and Jiang H (2018) The complete mitochondrial genome of Hebesoma Violentum (Acanthocephala). Mitochondrial DNA Part B 3, 582–583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pan TS and Nie P (2013) The complete mitochondrial genome of Pallisentis celatus (Acanthocephala) with phylogenetic analysis of acanthocephalans and rotifers. Folia Parasitologica 60, 181–191. [DOI] [PubMed] [Google Scholar]
  36. Pichelin S and Cribb TH (2001) The status of the Diplosentidae (Acanthocephala: Palaeacanthocephala) and a new family of acanthocephalans from Australian wrasses (Pisces: Labridae). Folia Parasitologica 48, 289–303. [DOI] [PubMed] [Google Scholar]
  37. Ronquist F, Teslenko M, Van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA and Huelsenbeck JP (2012) Mrbayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61, 539–542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sato H, Suzuki K, Uni S and Kamiya H (2005) Recovery of the everted cystacanth of seven acanthocephalan species of birds from feral raccoons (Procyon lotor) in Japan. Journal of Veterinary Medical Science 67, 1203–1206. [DOI] [PubMed] [Google Scholar]
  39. Sato H, Suzuki K and Aoki M (2006) Juvenile bird acanthocephalans recovered incidentally from raccoon dogs Nyctereutes procyonoides viverrinus on Yakushima Island, Japan. Journal of Veterinary Medical Science 68, 689–692. [DOI] [PubMed] [Google Scholar]
  40. Song R, Zhang D, Deng S, Ding D, Liao F and Liu L (2016) The complete mitochondrial genome of Acanthosentis Cheni (Acanthocephala: Quadrigyridae). Mitochondrial DNA Part B Resources 1, 797–798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Song R, Zhang D, Gao JW, Cheng XF, Xie M, Li H and Wu YA (2019) Characterization of the complete mitochondrial genome of Brentisentis yangtzensis Yu and Wu, 1989 (Acanthocephala, Illiosentidae). Zoo Keys 861, 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Steinauer ML, Nickol BB, Broughton R and Ortí G (2005) First sequenced mitochondrial genome from the phylum Acanthocephala (Leptorhynchoides Thecatus) and its phylogenetic position within Metazoa. Journal of Molecular Evolution 60, 706–715. [DOI] [PubMed] [Google Scholar]
  43. Talavera G and Castresana J (2007) Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology 56, 564–577. [DOI] [PubMed] [Google Scholar]
  44. Torracca B, Macchioni F, Masetti M, Gabrielli S, Guardone L, Prati MC and Magi M (2010) First recovery of bird acanthocephalan Sphaerirostris lanceoides In an Eurasian badger (Meles meles) in Italy. Hystrix the Italian Journal of Mammalogy 21, 195–198. [Google Scholar]
  45. Verweyen L, Klimpel S and Palm HW (2011) Molecular phylogeny of the Acanthocephala (class Palaeacanthocephala) with a paraphyletic assemblage of the orders Polymorphida and Echinorhynchida. PloS One 6, e28285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Weber M, Wey-Fabrizius AR, Podsiadlowski L, Witek A, Schill RO, Sugár L and Hankeln T (2013) Phylogenetic analyses of endoparasitic Acanthocephala based on mitochondrial genomes suggest secondary loss of sensory organs. Molecular Phylogenetics and Evolution 66, 182–189. [DOI] [PubMed] [Google Scholar]
  47. Wickham (2016) ggplot2: Elegant Graphics for Data Analysis. NewYork: Springer-Verlag. [Google Scholar]
  48. Zhang D, Gao F, Jakovlić I, Zou H, Zhang J, Li WX and Wang GT (2020) Phylosuite: an integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20, 348–355. [DOI] [PubMed] [Google Scholar]

Articles from Parasitology are provided here courtesy of Cambridge University Press

RESOURCES