Occurrence of canine parvovirus type 2c in diarrhoeic faeces of dogs in Kolkata, India

Abstract

Canine parvovirus-2(CPV-2) causes a highly contagious disease of dogs characterised by acute hemorrhagic gastroenteritis, lethargy, vomiting, fever and usually bloody or mucoid diarrhoea. In the present study, 41 faecal samples collected from dogs exhibiting the signs of fever, vomition, bloody or mucoid diarrhoea in Kolkata, India were screened by haemagglutination test and PCR for detection of capsid protein coding VP2 gene. The viral genotype was detected by multiplex PCR and analysis of partial VP2 gene nucleotide sequences of selected PCR products with bioinformatics tool. Thirteen (31.71%) samples were found positive with HA titre ≥ 32 whereas 28 (68.29%) samples were positive by PCR of VP2 gene indicating higher sensitivity of PCR. Highest occurrence of CPV-2 was observed in the age group of 1–6 months (80.65%) and non-descript breeds with no history of vaccination (85%). Three samples were antigenic type CPV-2a, rest were CPV-2b/CPV 2c. Six CPV sequences were found to be highly similar to published CPV 2c sequences in BLAST analysis revealing a maximum identity of 99–100% with other CPV-2c strains and clustered together with CPV-2c strains of India and other countries in phylogenetic analysis. The present study highlights the need for continuous monitoring of samples to detect gradual changes in circulating CPV-2 genotypes in India.

Canine parvovirus-2(CPV-2) causes a highly contagious and often fatal disease in pups. It is often characterized by vomition and hemorrhagic gastroenteritis in dogs of all ages and neonatal myocarditis in pups. Widespread outbreaks of canine haemorrhagic enteritis occurred throughout the world and emerged as an important disease of dogs [36]. CPV-2 is distributed globally with genetic and antigenic changes in the VP2 gene leading to the formation of new variants like CPV-2a, CPV-2b and CPV-2c. The CPV-2a was first reported in 1979, whereas CPV-2b was first recorded in 1984. The first report of CPV-2c was from Italy in the year 2000 [17, 6] and later reported from western European countries, Asia and South America. Few outbreaks of CPV-2c have also been reported in Vietnam and Spain [13], in North America [14], also in India [22]. The genetic and antigenic changes in the variants have also been correlated with changes in their host range; particularly the ability to replicate in cats and also host range differences in canine and other tissue culture cells [18]. Diagnostic assays like virus isolation and faecal haemagglutination (HA) followed by haemagglutination-inhibition (HI) assays have limitations like time requirement, lower senstivity, or interference with non-specific agglutinin in faeces [12]. Therefore, the polymerase chain reaction (PCR) technique has been increasingly used as a tool for the diagnosis of canine parvovirus infections.

The first report of canine parvo virus from India was recorded from Madras in 1981 [3]. Thereafter, several occurrence of the virus were reported from most of the states of India including West Bengal [2, 34]. Vaccination is the most effective of control measures but canine parvovirus (CPV-2) still remains a leading infectious cause of canine mortality, especially among juveniles due to vaccination failure or insufficient vaccination coverage in our country. Molecular characterization and CPV-2 genotyping are crucial in epidemiological studies for outlining prevention and control strategies of the disease. In the present study, detection and characterization of canine parvovirus by haemagglutination test (HA) and polymerase chain reaction (PCR) was performed from diarrhoeic faecal samples of dogs in Kolkata, India.

In the present study, faecal swab samples were collected during December, 2020 to March, 2021 from Teaching Veterinary Clinical Complex, West Bengal University of Animal and Fishery Sciences (WBUAFS) and 6 private pet clinics in Kolkata, West Bengal, India. Pure breed, cross breed or non- descript stray puppies were clinically presented with fever, lethergy, vomition, bloody/mucoid diarrhoea. Kolkata has a large population of stray dogs and majority of these non- descript stray dogs had no history of vaccination or had incomplete vaccination (single dose) schedule. Most puppies had a history of hemorrhagic diarrhoea and a few had mucoid yellowish diarrhoea. A total of 41 faecal samples collected using sterilized swabs were homogenised in 10% (w/v) suspension with PBS (pH 7.2), centrifuged at 1500 ×g for 15 min at 4 °C and sample supernatants were preserved at low temperature with ice and immediately transferred to laboratory refrigerator at 4–8 °C till further processing.

The haemagglutination test was performed as described previously [7] with slight modification. Briefly, the samples were serially diluted twofold in PBS (0.2 M, pH 7.2) in U-bottom microtitre plates (Tarsons, India). The eleventh well was maintained as RBC control and 12th well as antigen control. Then, 50 µl of 0.5% RBC was added to each well. The HA test was performed using porcine erythrocytes (0.5%). The corners of the plate were tapped four or five times to mix the erythrocytes. The plates were covered with lids and incubated at 4 to 8 °C, checked after 2 and 4 h. Positive agglutination was indicated by mat formation and the highest dilution of the sample showing complete haemagglutination was considered as the haemagglutination titre. A HA titre of 1:32 or more is considered positive for CPV-2 infection [25].

The faecal sample suspension (10% w/v in PBS) of 100 µl was used for template DNA preparation. The samples were boiled for 10 min and immediately chilled in ice [9]. Then the samples were centrifuged at 12,000 × g for 10 min at 4 °C.The supernatants were diluted 1:5 in distilled water to reduce residual inhibitors of DNA polymerase activity [10] and used as template for PCR. A commercial CPV vaccine Nobivac Puppy DP® was used as a positive control and distilled water as negative. Oligonucleotide primers (Table 1) targeting VP2 gene described earlier [26] were custom synthesized from Integrated DNA Technologies (IDT), USA for PCR. The amplifications were performed in a PCR thermocycler (T-100, Bio-Rad). A 50 µl PCR reaction mixture was prepared containing 5 X PCR buffer, 1.5 mM MgCl_2, 0.2 mM each deoxynucleoside triphosphate (dNTP), 0.25 mM of each primer, 1 U of GoTaq Flexi DNA polymerase (Promega,USA) and 5 µl of template viral DNA samples in nuclease free water up to 50 µl. The amplification conditions were: initial denaturation at 94 °C for 5 min followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 2 min, and elongation at 72 °C for 2 min and final extension at 72 °C for 5 min. The PCR products were electrophoresed in 1.5% agarose gel with 0.5 µl/ml ethidium bromide in 1X TBE buffer at 8 V/cm for 1 h. The amplicons were observed under UV transilluminator (UVP, UK) and were photographed.

Table 1.

Details of primers used in PCR for VP2 gene of CPV-2

Primers	Sequence of Primers (5′-3′)	Product size	Position of the genome (CPV-2, Accession no. M38245 )
Pabs(F) Pabas(R)	GAAGAGTGGTTGTAAATAATT CCTATATAACCAAAGTTAGTAC	681 bp	3025–3045 3706–3685
Pbs (F) Pbas(R)	CTTTAACCTTCCTGTAACAG CATAGTTAAATTGGTTATCTAC	427 bp	4043–4062 4470 –4449

The purified PCR products (Wizard® SV Gel and PCR clean-up system, Promega, USA) of six PCR positive samples selected randomly were subjected to custom sequencing by AgriGenome Labs Pvt.Ltd., Kochi, Kerala using Pbs/Pbas primer pair. The sequences were deposited in the GenBank database under accession numbers: MZ368749-MZ368754. Phylogenetic analysis was conducted in MEGA 7 using the Maximum Likelihood method and Tamura 3—parameter model [15] with eighteen variant strains including some Indian strains and six reference sequences available in Genbank. The confidence level of branching in the phylogenetic tree was evaluated with the bootsrap test (1000 replicates). A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories).

Thirteen (31.71%) faecal samples were positive with HA titre ≥ 32 and rest samples could not agglutinate pig RBC (n = 26) or weak HA positive (n = 2).Whereas, PCR was found more sensitive with 28(68.29%) samples were positive for CPV-2 including all the samples that were HA postive and 15 HA-negative samples. Based on PCR, CPV-2 infections were higher in 1 month- 6 month age group (Table 2) and less in dogs above 6 months-1 year age. Although very limited numbers of samples were studied, the result was in accordance with the previous findings [5]. Low sensitivity of HA test was also reported earlier [25, 29]. Low sensitivity of HA could be due to absence of the haemagglutination protein in some CPV-2 strains [8] and less virion voided in the faeces that could not produce optimum HA reaction [20]. Also another reason for low sensitivity was most likely due to antibodies in the intestinal lumen of infected dogs which may bind virions and prevent both HA and viral attachment to cell receptors [12].

Table 2.

Analysis of PCR positive samples based on age, gender, breed and vaccination status of dogs in Kolkata

Variables	Category	Total No. of sample	No. of sample positive	Percent positivity (%)
Age	1–6 month	31	25	25/31(80.65%)
	> 6 month-1year	5	3	3/5(60.00%)
	> 1year	5	0	0
Gender	Male	23	16	16/23(69.57%)
	Female	18	12	12/18(66.67%)
Breed	Non-descript	23	18	18/23(78.26%)
	Labrador	9	5	5/9(55.56%)
	Spitz	2	2	2/2(100%)
	Pug	3	2	2/3(66.67%)
	German Shepard	1	1	1/1(100%)
	Pomerian	1	0	0
	Dachshund	1	0	0
	Cross bred	1	0	0
Vaccination history	Non descript non-vaccinated Pure breed/cross bred non-vaccinated	20 6	17 4	17/20(85%) 4/6(66.67%)
	Non descript vaccinated Pure breed/cross bred vaccinated	3 12	1 6	1/3(33.33%) 6/12(50%)

Age wise, the highest prevalence was observed at 1–6 months of age group by many workers [34, 32], followed by 6–12 months of age group and above 12 months age group. Dogs being seasonal breeder, most puppies born in winter season and younger age groups are most susceptible. The highest occurrence of CPV-2 among the younger dogs might be coinciding with the fall of maternal antibodies and the affinity of the virus towards the actively growing cells [4]. Sex-wise frequency in the present study was in accordance to the many earlier studies [34, 35]. The high incidence of CPV-2 in male dogs in some studies might be due to more chance of exposure due to certain behavioral pattern and selective preference of keeping male dogs by pet owners [11].

In the present study, more positive cases were observed in non-descript or native breeds than pure/cross breeds. In accordance with the present study, most CPV positive faecal samples were reported from Deshi/local breeds in Odisha state of India [4]. This was contradicted in some studies where Labrador breed was found to be the most susceptible breed to CPV-2 in Cauvery Delta Region of Tamilnadu [28] and south Gujarat [31]. Based on the vaccination history, CPV-2 was higher in samples of unvaccinated dogs (80.77%, 21/26) than the vaccinated dogs (46.67%, 7/15) in the present study. This finding was similar with many earlier studies [16, 33]. Some vaccinated dogs can get infection probably as a consequence of inadequate immunity or lack of protective immunity [30, 1].

Multiplex PCR was sucessful for simultaneous detection of CPV-2a and CPV-2b/2c types utilizing primer pairs, Pabs /Pabas and Pbs /Pbas. Three samples were CPV type 2a, rest 25 samples yielded two products of 681 bp and 427 bp (Fig. 1) and therefore categorized as type CPV-2b or CPV-2c. There was scanty literature to compare the results with earlier studies of canine parvovirus in West Bengal. However, proportion of canine parvovirus genotypes differed in many previous studies of Indian states with CPV-2b was found the most prevalent strain in Pondicherry [24] and either CPV-2b [21] or new CPV- 2a [19] was more prevalent in Uttar Pradesh.

Fig. 1.

Multiplex PCR of faecal samples of dogs for VP 2 gene of Canine parvovirus-2. Lane 1: 100 bp DNA ladder. Lane 2–7: PCR positive samples with amplification of 681 bp and 427 bp products (CPV 4/KOL/21, CPV10/KOL/21, CPV11/KOL/21, CPV13/KOL/21, CPV17/KOL/21, CPV24/KOL/21 respectively). Lane 8: negative

The six nucleotide sequences of VP2 gene from CPV 9/KOL/2021, CPV 12/ KOL/2021, CPV 14/ KOL/2021, CPV 16/ KOL/2021, CPV 17/ KOL/2021, CPV 18/ KOL/2021 strains (Table 3) were CPV type 2c, matched 99% with CPV-2 (GenBank accession no. M38245) with only three variations at positions 4062(A→G), 4064(T→A), 4295(G→A). Hundred per cent similarity was observed with many CPV-2c strains viz. China (accession no. OK649761) and Vietnam (accession no. OK094443). They were clustered together with other retrieved CPV genotype 2c NCBI Genbank sequences whereas commercial vaccines and other variants were clustered in different groups (Fig. 2). Similar findings were observed in Bareilly,Uttar Pradesh with six CPV-2b sequence and 3 isolates CPV-2c having T to A substitution at the third codon of 4064 position of VP2 gene and aspartic acid in CPV-2b has been replaced by glutamic acid at amino acid sequence position of 426 [22]. In contrast, in a study from a kennel in Meerut, India all the eleven isolates belonged to either new CPV-2a (2012 isolates) or new CPV-2b (2008 and 2011 isolates) and no CPV 2c was detected [19]. Similar to the present study, CPV-2c type JD3 (Jabalpur) formed a different subcluster with CPV-2a and CPV-2b types but was found closely related to the CPV-2c isolates from Italy and Uruguay [23]. The wide spread prevalence of type CPV-2c was reported in countries like Germany, Vietnam, Italy and Uruguay of South America [27]. As per the available literature, CPV-2c mutants detected in this study for the first time emerge as major genotype of CPV-2 of dogs in Kolkata, India. This phylogenetic study added valuable information to the evolution and prevalence of CPV-2 genotypes in India.

Table 3.

Nucleotide and amino acid variation of VP2 gene of CPV-2 of dogs with reference strains

CPV strains	Genbank accession no.	VP2 amino acid (nucleotide) in CPV geneome*
		426(4062-64)	503(4294–4296)
CPV-2	M38245	Asn(AAT)	Arg(CGC)
CPV-2a	M24003	Asn(AAT)	Arg(CGC)
CPV-2b	M74849	Asp(GAT)	Arg(CGC)
New CPV2a	AY742953	Asn(AAT)	Arg(CGC)
New CPV2b	AY742955	Asp(GAT)	Arg(CGC)
CPV- 2c	OK649761	Glu(GAA)	His(CAC)
CPV 9/KOL/2021	MZ368749	Glu(GAA)	His(CAC)
CPV 12/ KOL/2021	MZ368750	Glu(GAA)	His(CAC)
CPV 14/ KOL/2021	MZ368751	Glu(GAA)	His(CAC)
CPV 16/ KOL/2021	MZ368752	Glu(GAA)	His(CAC)
CPV 17/ KOL/2021	MZ368753	Glu(GAA)	His(CAC)
CPV 18/ KOL/2021	MZ368754	Glu(GAA)	His(CAC)

*Amino acid and nucleotide (in bracket) positions according to CPV-2 strain (GenBank accession no. M38245)

Fig. 2.

Phylogenetic analysis of CPV-2 of partial VP2 sequences developed by Maximum Likelihood method. Each isolate obtained in this study is indicated by special symbol (▲) followed by CPV strain identity and year of isolation. The GenBank accession numbers of the retrieved sequences under study were provided

Conclusions

Highest incidence of CPV-2 was found in non-descript breeds with no history of vaccination in dogs with the age up to 6 months. Six samples with genotype of CPV-2c were detected for the first time in dogs of Kolkata. Continuous monitoring is needed to detect changing pattern of canine parvoviral disease epidemiology in India.

Author contributions

Abhiram, SD and DPI: Conceived and designed the study; TM, SS: Data acquisition, Abhiram: Conducted the experiments; IS, KB, SNJ and SD: Performed data analysis and interpretation. All authors contributed to the draft and approved the final manuscript.

Declarations

Ethical approval

As no invasive technique was followed, ethical approval was not required. However, best practices of veterinary clinical care for the individual patient were always followed. Informed verbal consent was obtained from the owner or legal custodian of all animals described in this work (nonexperimental animals) for the collection of sample for the tests.