Skip to main content
NCBI home page
Prostate International logoLink to Prostate International
. 2022 Nov 11;11(2):76–82. doi: 10.1016/j.prnil.2022.11.002

The impact of conventional smoking versus electronic cigarette on the expression of VEGF, PEMPA1, and PTEN in rat prostate

Alireza Namazi Shabestari a, Seyed Saeed Tamehri Zadeh b, Parisa Zahmatkesh b, Leila Zareian Baghdadabad b, Akram Mirzaei b, Rahil Mashhadi b, Gholamreza Mesbah b, Alireza Khajavi c, Milad Akbarzadehmoallemkolaei d, Mahdi Khoshchehreh e, Ramin Rahimnia f, Seyed Mohammad Kazem Aghamir b,∗
PMCID: PMC10318331  PMID: 37409091

Abstract

Background

The use of electronic cigarettes (e-cigarettes), the alternative to conventional smoking, is increasing considerably worldwide; however, their safety is a matter of debate. Several studies have demonstrated their toxic effects, but no study assessed their effects on the prostate.

Objective

The current study aimed at evaluating e-cigarettes and conventional smoking prostate toxicity and effects on the expression of vascular endothelial growth factor A (VEGFA), phosphatase and tensin (PTEN), and prostate transmembrane protein androgen induced 1 (PMEPA1).

Method

30 young Wistar rats were categorized into three groups (n = 10) as follows: the control group, the conventional smoking group, and the e-cigarette group. The case groups were exposed to cigarettes or e-cigarettes for 40 minutes, 3 times a day for four months. Serum parameters, prostate pathology, and gene expression were measured at the end of the intervention. Data were analyzed by Graph Pad prism 9.

Results

Histopathological findings presented that both types of cigarette-induced hyperemia and induced inflammatory cell infiltration and hypertrophy of smooth muscle of the vascular wall in the e-cigarette group. Expression of PMEPA1, and VEGFA genes significantly increased in conventional (2.67-fold; P = 0.0108, 1.80-fold; P = 0.0461 respectively) and e-cigarettes (1.98-fold; P = 0.0127, 1.34-fold; P = 0.938, respectively) groups compared to the control group. Expression of the PTEN gene non-significantly decreased in the case of groups compared to the control group.

Conclusion

We found no significant differences between the two groups in terms of PTEN and PMEPA1 expression, whereas VEGFA was significantly more expressed in a conventional smoking group compared to the e-cigarette group. Therefore, it seems that e-cigarettes could not be taken into account as a better option than conventional smoking, and quitting smoking still is the optimal option.

Keywords: Cancer, Electronic cigarettes, Gene expression, Wistar rat

1. Introduction

Prostate cancer (PCa) is taken into account as the most common cancer and the second leading cause of cancer-related death among men globally.1, 2, 3 To date, several modifiable and non-modifiable risk factors, such as but not limited to, age, ethnicity, family history, and nutritional, and hormonal factors for PCa have been identified.4 Although it has been estimated that smoking is the cause of approximately 30% of malignancies; there is controversy concerning its role in PCa.5 However, a meta-analysis revealed a high risk of PCa only among heavy smokers and a positive association between smoking and PCa-related mortality.6

Electronic cigarettes (e-cigarettes) also called e-cigarettes, are proposed as a treatment for smoking dependence.7 E-cigarettes first were patented in China and then, were launched in the U.S.8 They were introduced as a cheaper and safer alternative to conventional cigarettes.7 Although e-cigarettes were designed for conventional smokers who want to quit, there is a growing usage of e-cigarettes among non-smoker adolescents and young adults.9 It has been shown that nearly 4.5% of American adults are using e-cigarettes and 15% of users were never-cigarette smokers.10

Quite an amount of effort has been made to understand the safety of e-cigarettes; nevertheless, there is yet a scarcity of knowledge in this regard. Their effects on urological health have been investigated in several studies. Experimental investigations have found the deleterious effects of e-cigarettes on the kidney,11 bladder,12 and reproductive systems.13 A very recent systematic review demonstrated that several bladder carcinogens can be found in the urine of e-cigarette users.14

To our knowledge, no study to date has examined the effects of e-cigarettes on the prostate. Thus, we designed an in vivo study to evaluate and compare the effects of conventional cigarettes and e-cigarettes on the prostate and the expression of several PCa-related genes, including vascular endothelial growth factor A (VEGFA), phosphatase and tensin (PTEN), and prostate transmembrane protein androgen induced 1 (PMEPA1).

2. Material and method

This research was accomplished in the Animal Laboratory of Urology Research Center of Tehran Medical University, Tehran, Iran, from June 2021 to October 2022, and by the Ethics Research Committee of Tehran University of Medical Sciences (IR.TUMS.MEDICINE.REC.1399.986) was approved. Ethical principles of working with rats were considered in all phases of the research.

2.1. Animal caring

Thirty young male Wistar rats, (4 weeks, weighing 210 ± 20 g), ten rats in each group, from the Pasteur Institute, Tehran, Iran (standard place for breeding laboratory animals) were prepared. Rats were kept in three clean plastic cages (20 × 25 × 35 cm), cleaned, and disinfected every three days. All rats were fed protein and fat diets, and had free access to tap water. Before the start of the research, to adapt to the environment and relieve the rats' stress, we kept them for two weeks at the Animal laboratory. The room temperature was 25 ± 2°C with 55 ± 5% humidity, and the same light and darkness. At the beginning and the end of the research, the weights of the Wistar rats were documented.

2.2. Exposure of rats to cigarette smoke

Consequently, the smoke of cigarettes or e-cigarette enters the rat cages via a specially designed suction device from the aquarium pump. The rats were exposed to cigarette smoke and e-cigarettes three times a day for forty minutes each, with a break of at least one hour for sixteen weeks. The amounts of nicotine used in this plan were as follows: Group A: Control (n = 10, no exposure), Group B: Case-1, conventional smoking (n = 10, 3 Cigarette contains 0.6 mg, 1.8 mg nicotine/day), Group C: Case-2, e-cigarette (n = 10, 3 Cigarette contains 24 μL, 72 μL nicotine/day). Also, each month of a mouse's lifespan is approximately 2.5–3 human years.15,16 Therefore, four months of rats' exposure to cigarettes and e-cigarette equals ten to twelve years of smoking in humans.

2.3. Investigation of serum parameters and prostate pathology examination

Blood samples were taken before starting the study and immediately after the completion of the project and exposed to cigarette smoke or e-cigarettes. Nihon kohden MEK-1305 Celltac α+ cell counter device (automated hematology and ESR analyzer) was used for complete blood count (CBC) examination. The prostate tissue was removed from the Wistar rats and placed in 10% neutral-buffered formalin. After prostate tissue fixation, the prostate specimens were sent to the comparative histopathology laboratory in the pathology department of the Tehran Medicine University, Urology Research Center. According to the standard method, after molding, the paraffin blocks of the rat's prostate of both control and case groups were processed by an automated autotechnicon tissue processor, and five-micron microscopic incisions from diverse sections were prepared and stained according to the H & E (combination of two histological stains contain hematoxylin and eosin) standard protocol, and observations were performed by Olympus light microscope with × 200 and × 400 magnifications.

2.4. RNA isolation and real-time PCR

All total RNA of Wistar rat prostate tissues was extracted in the General Laboratory by High Pure RNA Isolation Kit (Cat. No. 11 828 665 001), and cDNAs were then synthesized from it by Takara Kit (Cat. #RR014A/B). Finally, we evaluate the relative expression of genes by using the 2−ΔΔCT method is used for calculating the relative expression. The primers used for the ABI real-time PCR cycler of VEGFA mRNA were as follows: forward primer, 5′- CAGCTATTGCCGTCCAATTGA-3′ and reverse primer: 5′- CCAGGGCTTCATCATTGCA -3′(product length: 131 bp), PTEN mRNA were as follows: forward primer, 5′- GGAAAGGACGGACTGGTGTAA-3′ and reverse primer: 5′- AGTGCCACTGGTCTGTAATCC -3′ (product length: 199 bp), PMEPA1 mRNA were as follows: forward primer, 5′-TGGTGATGGTGGTGATGATC-3′ and reverse primer: 5′- CTGTGTCGGCTGATGAAGG-3′(product length: 202 bp), and finally The forward primer sequence for B2M mRNA quantification as house kipping gene was 5′- TACGTGTCTCAGTTCCACCC-3′; the reverse primer sequence was 5′-TTGATTACATGTCTCGGTCCCA-3′ (product length: 229 bp).

2.5. Statistical analysis

At the end of the study, the data achieved from the graph pad prism 9 program and one-way analysis of variance were examined for CBC analysis, and a t-test was evaluated for gene relative expression. Statistical significance was defined at ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001.

3. Results

3.1. Weight and serum parameters

In both the conventional smoking and e-cigarette groups, Wistar rats significantly gained weight at the end of the study. Weight at the beginning of the study, at the end of the second month, and at the end of the fourth month of the Control male group, was 180.78, 241.78, and 259.64 respectively (P values = 0.0214). In the conventional smoking group, was 192.21, 215.47, 232.26 respectively (P values = 0.0245) and finally, in the e-cigarette group, was 185.22, 210.35, and 246.94 respectively (P values = 0.0328).

The levels of WBC (5.5 × 103/UL to 13.2 × 103/UL, P = 0.0168) and PLT (937 × 103/UL to 960 × 103/UL, P = 0.0347) increased significantly in the conventional smoking group at the end of the study, while PLT in e-cigarette groups increased significantly in rats (937 × 103/UL to 981 × 103/UL, P = 0.0275) at the end of the study. The WBC, RBC, HGB, HCT, MCV, and MCHC increased non-significantly in both conventional smoking and e-cigarette groups at the end of the study (Fig. 1).

Fig. 1.

Figure 1

Open in a new tab

Smoke clean plastic cages with designing the suction device. In the first picture (a), Wistar rats are placed in a specially designed box, and the device designed to suck cigarette smoke is shown in the third picture (c).

3.2. Histopathology finding

In the conventional smoking and e-cigarette groups compared to the control group, pathological findings based on congestion, hyperemia, inflammatory cell infiltration, and finally hypertrophy of smooth muscle of the vascular wall indicates possible tissue cancer. We demonstrated Hyperemia in the Anterior lobe (four times higher than the control group), in the dorsal lobe (three times higher than the control group), in the lateral lobe (higher than the control group), in the ventral lobe (twice as much as the control group) in conventional smoking group, congestion in Lateral lobe (higher than the control group) in conventional smoking group, inflammatory cells/infiltration in Ventral lobe (higher than the control group) in conventional smoking group, Hyperemia in anterior lobe (twice as much as the control group), in dorsal lobe (higher than the control group) and hypertrophy of smooth muscle of the vascular wall Dorsal lobe (in 2:1 ratio, approximately) in e-cigarette group compared to the control group (Fig. 2, Fig. 3, Fig. 4, Fig. 5).

Fig. 2.

Figure 2

Open in a new tab

Histopathological sections of the anterior lobe of the prostate gland, rats, H&E staining. Panel b ( × 400) shows a higher magnification of photomicrographs than panel a ( × 200). Hyperemia is exposed by a star. Arrow demonstrates the inflammatory cells.

Fig. 3.

Figure 3

Open in a new tab

Histopathological sections of the dorsal lobe of the prostate gland, rats, H&E staining. Panel b ( × 400) demonstrations a higher magnification of photomicrographs than panel a ( × 200). Hyperemia is revealed by a star. Hypertrophy of smooth muscle of the vascular wall is highlighted by an arrow head. A thick arrow shows inflammatory cell infiltration.

Fig. 4.

Figure 4

Open in a new tab

Histopathological sections of the lateral lobe of the prostate gland, rats, H&E staining. Panel b ( × 400) shows a higher magnification of photomicrographs than panel a ( × 200). Thick arrows indicate mild congestion.

Fig. 5.

Figure 5

Open in a new tab

Histopathological sections of the ventral lobe of the prostate gland, rats, H&E staining. Panel b ( × 400) displays higher magnification of photomicrographs than panel a ( × 200). Stars illustration hyperemia.

3.3. The effect of cigarette smoke on the expression of tumor suppressor gene and angiogenesis pathway

PTEN was decreased in both conventional smoking (0.6-fold) and e-cigarette (0.9-fold) groups of rats compared to the control group, while between the two conventional smoking and e-cigarette groups these changes were not significant (P = 0.6018).

PMEPA1 gene was significantly increased in both conventional smoking (2.67-fold; P = 0.0108) and e-cigarette groups (1.98-fold; P = 0.0127) compared to the control group in the rats. In contrast, these changes were not significant in rats between the two case groups (P = 0.7081).

VEGFA significantly increased in conventional smoking (1.80-fold; P = 0.0461) and non-significantly increased in e-cigarette (1.34-fold; P = 0.938) groups of rats, and there was a significant difference between the two conventional smoking and e-cigarette groups (P = 0.0419) (Fig. 6, Fig. 7).

Fig. 6.

Figure 6

Open in a new tab

The results of three groups, Control, Conventional smoking, and electronic cigarette on gene expression (mRNA fold change). Values are given as mean ± SD of three independent experiments.

Fig. 7.

Figure 7

Open in a new tab

Relative expression levels of three target genes in Control, Conventional smoking and electronic cigarette. Values are given as mean ± SD of three independent experiments. Statistical significance was defined at ∗P < 0.05, ∗∗P < 0.01, and ∗∗∗P < 0.001.

4. Discussion

Cigarette smoking, one of the major leading and preventable causes of health issues, accounted for approximately 6 million deaths per year around the world.17 E-cigarettes, an alternative to conventional smoking, have become increasingly popular globally among users, in particular among adolescents.18 The US National Health Interview Survey reported that about 3.8% of working adults used e-cigarettes in 2014.19 Conventional cigarette smoking has been linked with many malignancies in particular lung cancer20; nonetheless, there is an ongoing debate on the role of smoking as a cause of PCa.6 Emerging preclinical evidence has revealed that e-cigarettes through activation of the nervous system have the potential to be implicated in cancer development and growth.21 No study by far has investigated the effect of e-cigarettes on the prostate; hence, for the first time, we examined and compared the effect of e-cigarette and conventional smoking on prostate tissue and the expression of VEGFA, PTEN, and PMEPA1 genes, which were shown to be participating in PCa initiation and development. First, hematological changes were found in both groups. Histopathological findings showed the presence of congestion, hyperemia, and inflammatory cell infiltration in both groups and hypertrophy of smooth muscle of the vascular wall in e-cigarette group. Furthermore, both conventional smoking and e-cigarette were shown to be able to prompt PCa progression via overexpressing VEGFA and PMEPA1 expression and down-regulating PTEN expression. We found no differences between the two groups in terms of PMEPA1 and PTEN expression, whereas higher levels of VEGFA expression were found in conventional smoking.

PTEN, a tumor suppressor gene, is postulated to be mutated in a variety of malignancies particularly PCa.22 There is a bulk of evidence in support of the fact that loss and inactivation of PTEN are common in PCa and its loss is associated with unfavorable clinical outcomes in patients with PCa.23 A recent in vitro study found that exposure to cigarette extract smoke increases intracellular reactive oxygen species (ROS) primarily derived from DUOX1 and 2, leading to the inactivation of PTEN.24 Baron et al. demonstrated that PTEN was expressed at lower levels in benign prostate tissues of smokers compared to non-smokers.25 In the present study, we found lower, but not significant levels of PTEN in cigarette and e-cigarette groups compared to the control group. Furthermore, we did not detect any difference between the two groups in terms of PTEN expression.

VEGFA is known as a tumor-secreted cytokine with a substantial role in tumor invasion and angiogenesis.26,27 Higher values of VEGFA can be detected in patients with PCa relative to healthy subjects; however, it cannot be considered a useful tool in differentiating PCa from benign prostate tissue.28 It has been demonstrated that VEGFA up-regulation contributes to PCa growth and metastasis and thereby, is associated with poor prognosis in PCa patients.29 Gabriel et al. Sought to explore the mechanism by which smoking alters VEGFA expression in PCa patients and clarified that cigarette smoke can stimulate VEGFA secretion from PCa cells by inducing translocation of heme oxygenase 1.30 In the current study, both conventional and e-cigarette groups had significantly higher levels of VEGFA compared to the control group. Additionally, significantly higher VEGFA expression was observed in the conventional smoking group than e-cigarette group.

PMEPA1, which is known as a multifunctional protein, has been reported to maintain a mandatory role in prostate carcinogenesis.31. Conflicting results regarding the role of PMEPA1 in PCa progression have appeared. It has been revealed that PMEPA1 derives carcinogenesis via interference with several signaling mediators, including p53, EGF, Wnt, and Hippo signaling.32 Its suppression was shown to be associated with the growth and proliferation of PCa cells through modulating several signaling pathways, especially androgen receptor (AR) and TGF- β signaling.32 In contrast, Sharad et al. Declared that higher levels of PMEPA1 1-b were correlated with higher pathological stages in PCa.33 As far as we are aware, we are the first study to assess the impact of conventional smoking and e-cigarette on the expression of PMEPA1 in the prostate. Both conventional and e-cigarette smoking increased the expression of PMEPA1; however, no difference between the two groups in terms of PMEPA1 expression was found. It has been shown that PTEN block is associated with increased PTEN protein degradation through activating AR signaling34; however, in the present study, we observed that PTEN expression was suppressed in both cases groups while PMEPA1 expression was up-regulated, indicating the robust effects of smoking on PMEPA1 expression.

5. Conclusion

In the current in vivo study, both conventional smoking and e-cigarette altered oncogene and tumor suppressor gene expression with the same pattern. We detected no significant differences between the two groups in terms of PTEN and PMEPA1 expression while VEGFA was significantly more expressed in conventional smoking compared to an e-cigarette. Hence, it seems that e-cigarettes could not be considered a better alternative to conventional smoking, and quitting smoking is the best option.

Availability of data and material

Information, data, and photos will be provided if requested.

Ethical considerations

All animal experimentations and the study design were approved by the Ethical Committee of Tehran University of Medical Sciences (IR.TUMS.MEDICINE.REC.1399.986).

Author's contributions

All authors contributed equally.

Conflicts of interest

All authors claim that there is not any potential competing or conflict of interest.

Funding

There is no funding.

Acknowledgments

Special thanks to the urology Research Center, Tehran University of Medical Sciences, Tehran, Iran.

References

  • 1.Lee W., Lim B., Kyung Y.S., Kim C.-S. Impact of positive surgical margin on biochemical recurrence in localized prostate cancer. Prostate International. 2021;9(3):151–156. doi: 10.1016/j.prnil.2020.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Mirzaei A., Akbari M.R., Zadeh S.S.T., Khatami F., Mashhadi R., Aghamir S.M.K. Novel combination therapy of prostate cancer cells with arsenic trioxide and flutamide: An in-vitro study. Tissue Cell. 2022;74 doi: 10.1016/j.tice.2021.101684. [DOI] [PubMed] [Google Scholar]
  • 3.Tamehri Zadeh S.S., Taheri D., Shivarani S., Khatami F., Kazemi R. Liquid biopsy in prostate cancer diagnosis and prognosis: a narrative review. Translational Research in Urology. 2020;2(4):139–146. [Google Scholar]
  • 4.Chung B.H., Horie S., Chiong E. The incidence, mortality, and risk factors of prostate cancer in Asian men. Prostate international. 2019;7(1):1–8. doi: 10.1016/j.prnil.2018.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Leitzmann M.F., Rohrmann S. Risk factors for the onset of prostatic cancer: age, location, and behavioral correlates. Clin Epidemiol. 2012;4:1. doi: 10.2147/CLEP.S16747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Huncharek M., Haddock K.S., Reid R., Kupelnick B. Smoking as a risk factor for prostate cancer: a meta-analysis of 24 prospective cohort studies. Am J Publ Health. 2010;100(4):693–701. doi: 10.2105/AJPH.2008.150508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Palazzolo D.L. Electronic cigarettes and vaping: a new challenge in clinical medicine and public health. A literature review. Front Public Health. 2013:56. doi: 10.3389/fpubh.2013.00056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yamin C.K., Bitton A., Bates D.W. American College of Physicians; 2010. E-cigarettes: a rapidly growing Internet phenomenon; pp. 607–609. [DOI] [PubMed] [Google Scholar]
  • 9.Fearon I.M., Eldridge A.C., Gale N., McEwan M., Stiles M.F., Round E.K. Nicotine pharmacokinetics of electronic cigarettes: a review of the literature. Regul Toxicol Pharmacol. 2018;100:25–34. doi: 10.1016/j.yrtph.2018.09.004. [DOI] [PubMed] [Google Scholar]
  • 10.Mirbolouk M., Charkhchi P., Kianoush S., Uddin S.I., Orimoloye O.A., Jaber R., et al. Prevalence and distribution of e-cigarette use among US adults: behavioral risk factor surveillance system, 2016. Ann Intern Med. 2018;169(7):429–438. doi: 10.7326/M17-3440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Golli N.E., Jrad-Lamine A., Neffati H., Dkhili H., Rahali D., Dallagi Y., et al. Impact of e-cigarette refill liquid exposure on rat kidney. Regul Toxicol Pharmacol. 2016;77:109–116. doi: 10.1016/j.yrtph.2016.02.012. [DOI] [PubMed] [Google Scholar]
  • 12.Lee H.-W., Park S.-H., Weng M-w, Wang H.-T., Huang W.C., Lepor H., et al. E-cigarette smoke damages DNA and reduces repair activity in mouse lung, heart, and bladder as well as in human lung and bladder cells. Proc Natl Acad Sci USA. 2018;115(7):E1560–E1569. doi: 10.1073/pnas.1718185115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wawryk-Gawda E., Zarobkiewicz M.K., Chłapek K., Chylińska-Wrzos P., Jodłowska-Jędrych B. Histological changes in the reproductive system of male rats exposed to cigarette smoke or electronic cigarette vapor. Toxicol Environ Chem. 2019;101(7-8):404–419. [Google Scholar]
  • 14.Bjurlin M.A., Matulewicz R.S., Roberts T.R., Dearing B.A., Schatz D., Sherman S., et al. Carcinogen biomarkers in the urine of electronic cigarette users and implications for the development of bladder cancer: a systematic review. European urology oncology. 2021;4(5):766–783. doi: 10.1016/j.euo.2020.02.004. [DOI] [PubMed] [Google Scholar]
  • 15.Sengupta P. The laboratory rat: relating its age with human's. Int J Prev Med. 2013;4(6):624. [PMC free article] [PubMed] [Google Scholar]
  • 16.Andreollo N.A., Santos EFd, Araújo M.R., Lopes L.R. Rat's age versus human's age: what is the relationship? ABCD Arquivos Brasileiros de Cirurgia Digestiva (São Paulo) 2012;25:49–51. doi: 10.1590/s0102-67202012000100011. [DOI] [PubMed] [Google Scholar]
  • 17.Organization W.H. World Health Organization; Geneva: 2011. WHO report on the global tobacco epidemic, 2011: warning about the dangers of tobacco. [Google Scholar]
  • 18.Sapru S., Vardhan M., Li Q., Guo Y., Li X., Saxena D. E-cigarettes use in the United States: reasons for use, perceptions, and effects on health. BMC Publ Health. 2020;20(1):1–10. doi: 10.1186/s12889-020-09572-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Goniewicz M.L., Kuma T., Gawron M., Knysak J., Kosmider L. Nicotine levels in electronic cigarettes. Nicotine Tob Res. 2013;15(1):158–166. doi: 10.1093/ntr/nts103. [DOI] [PubMed] [Google Scholar]
  • 20.Siegel R.L., Jacobs E.J., Newton C.C., Feskanich D., Freedman N.D., Prentice R.L., et al. Deaths due to cigarette smoking for 12 smoking-related cancers in the United States. JAMA Intern Med. 2015;175(9):1574–1576. doi: 10.1001/jamainternmed.2015.2398. [DOI] [PubMed] [Google Scholar]
  • 21.Mravec B., Tibensky M., Horvathova L., Babal P. E-cigarettes and cancer risk. Cancer Prev Res. 2020;13(2):137–144. doi: 10.1158/1940-6207.CAPR-19-0346. [DOI] [PubMed] [Google Scholar]
  • 22.Chung J.-S., Morgan T.M., Hong S.K. Clinical implications of genomic evaluations for prostate cancer risk stratification, screening, and treatment: a narrative review. Prostate international. 2020;8(3):99–106. doi: 10.1016/j.prnil.2020.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Turnham D.J., Bullock N., Dass M.S., Staffurth J.N., Pearson H.B. The PTEN conundrum: how to target PTEN-deficient prostate cancer. Cells. 2020;9(11):2342. doi: 10.3390/cells9112342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Cai B., Liu M., Li J., Xu D., Li J. Cigarette smoke extract amplifies NADPH oxidase-dependent ROS production to inactivate PTEN by oxidation in BEAS-2B cells. Food Chem Toxicol. 2021;150 doi: 10.1016/j.fct.2021.112050. [DOI] [PubMed] [Google Scholar]
  • 25.Boran C., Kandirali E., Yanik S., Ahsen H., Ulukaradağ E., Yilmaz F., editors. Urologic Oncology: Seminars and Original Investigations. Elsevier; 2017. Does smoking change expression patterns of the tumor suppressor and DNA repair genes in the prostate gland? [DOI] [PubMed] [Google Scholar]
  • 26.Kim J.H., Oh E., Han Y.S., Lee S.H., Song Y.S. Enhanced inhibition of tumor growth using TRAIL-overexpressing adipose-derived stem cells in combination with the chemotherapeutic agent CPT-11 in castration-resistant prostate cancer. Prostate international. 2021;9(1):31–41. doi: 10.1016/j.prnil.2020.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Li C., Wu X., Zhang H., Yang G., Hao M., Sheng S., et al. A Huaier polysaccharide restrains hepatocellular carcinoma growth and metastasis by suppression angiogenesis. Int J Biol Macromol. 2015;75:115–120. doi: 10.1016/j.ijbiomac.2015.01.016. [DOI] [PubMed] [Google Scholar]
  • 28.Botelho F., Pina F., Lunet N. VEGF and prostatic cancer. Eur J Cancer Prev. 2010;19(5):385–392. doi: 10.1097/CEJ.0b013e32833b48e1. [DOI] [PubMed] [Google Scholar]
  • 29.Zhan P., Ji Y.-N., Yu L.-K. VEGF is associated with the poor survival of patients with prostate cancer: a meta-analysis. Transl Androl Urol. 2013;2(2):99. doi: 10.3978/j.issn.2223-4683.2013.06.03. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Birrane G., Li H., Yang S., Tachado S.D., Seng S. Cigarette smoke induces nuclear translocation of heme oxygenase 1 (HO-1) in prostate cancer cells: nuclear HO-1 promotes vascular endothelial growth factor secretion. Int J Oncol. 2013;42(6):1919–1928. doi: 10.3892/ijo.2013.1910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Sharad S., Dillman A.A., Sztupinszki Z.M., Szallasi Z., Rosner I., Cullen J., et al. Characterization of unique PMEPA1 gene splice variants (isoforms d and e) from RNA Seq profiling provides novel insights into prognostic evaluation of prostate cancer. Oncotarget. 2020;11(4):362. doi: 10.18632/oncotarget.27406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Sharad S., Dobi A., Srivastava S., Srinivasan A., Li H. PMEPA1 gene isoforms: a potential biomarker and therapeutic target in prostate cancer. Biomolecules. 2020;10(9):1221. doi: 10.3390/biom10091221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sharad S., Sztupinszki Z.M., Chen Y., Kuo C., Ravindranath L., Szallasi Z., et al. Analysis of PMEPA1 isoforms (a and b) as selective inhibitors of androgen and TGF-β signaling reveals distinct biological and prognostic features in prostate cancer. Cancers. 2019;11(12):1995. doi: 10.3390/cancers11121995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Li H., Mohamed A.A., Sharad S., Umeda E., Song Y., Young D., et al. Silencing of PMEPA1 accelerates the growth of prostate cancer cells through AR, NEDD4 and PTEN. Oncotarget. 2015;6(17) doi: 10.18632/oncotarget.3526. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Information, data, and photos will be provided if requested.

Articles from Prostate International are provided here courtesy of Asian Pacific Prostate Society

RESOURCES