Skip to main content
ACS Omega logoLink to ACS Omega
. 2023 Jun 20;8(26):23772–23781. doi: 10.1021/acsomega.3c02113

Gene Expression, Enzyme Activity, Nitrogen Use Efficiency, and Yield of Rice Affected by Controlled-Release Nitrogen

Chunyan Tang , Meiqi Han , Xiaoran Yang , Tianlin Shen , Yangyang Gao §, Yong Wang §, Shugang Zhang †,‡,*, Denglun Chen , Di He , Yuncong C Li
PMCID: PMC10323945  PMID: 37426219

Abstract

graphic file with name ao3c02113_0006.jpg

Controlled- or slow-release urea can improve crop nitrogen use efficiencies and yields in many agricultural production systems. The effect of controlled-release urea on the relationships between levels of gene expression and yields has not been adequately researched. We conducted a 2 year field study with direct-seeded rice, which included treatments of controlled-release urea at four rates (120, 180, 240, and 360 kg N ha–1), a standard urea treatment (360 kg N ha–1), and a control treatment without applied nitrogen. Controlled-release urea improved the inorganic nitrogen concentrations of root-zone soil and water, functional enzyme activities, protein contents, grain yields, and nitrogen use efficiencies. Controlled-release urea also improved the gene expressions of nitrate reductase [NAD(P)H] (EC 1.7.1.2), glutamine synthetase (EC 6.3.1.2), and glutamate synthase (EC 1.4.1.14). With the exception of glutamate synthase activity, there were significant correlations among these indices. The results showed that controlled-release urea improved the content of inorganic nitrogen within the rice root zone. Compared with urea, the average enzyme activity of controlled-release urea increased by 50–200%, and the relative gene expression was increased by 3–4 times on average. The added soil nitrogen increased the level of gene expression, allowing enhanced synthesis of enzymes and proteins for nitrogen absorption and use. Hence, controlled-release urea improved the nitrogen use efficiency and the grain yield of rice. Controlled-release urea is an ideal nitrogen fertilizer showing great potential for improving rice production.

Introduction

Nitrogen is the most important nutrition for plant growth, productivity, and metabolism, and it signals plant gene expression.13 Nitrate (NO3) and ammonium (NH4+) are two main inorganic forms of nitrogen, which are directly absorbed by the root system and affect the plant enzymes.4,5 Kiran et al. and Atere et al. found that crop yields are strongly dependent on the levels of supplied nitrogen fertilizers;6,7 however, less than 40% of the applied nitrogen was taken up by the crops.8,9 Increasing nitrogen fertilization levels above the requirements for maximum plant yields results in increased expenditures without increased profits, or “diminishing returns”; this practice also reduces nitrogen use efficiencies.1012 Reducing nitrogen losses and improving nitrogen use efficiencies are essential for sustainable agricultural development.13

Controlled-release urea has been applied to a variety of crops, resulting in numerous advantages.14,15 They are coated with a polymer to control or lessen the release rate of nitrogen, which reduces nutrient losses and groundwater pollution while increasing nitrogen use efficiencies and grain yields at the plant’s physiological level.16,17 Many studies have proved that it is because the nitrogen release patterns and rates from controlled-release urea match well with the crop plants’ requirements.1820 These nitrogen release patterns affect soil inorganic nitrogen concentrations which are the signal molecules in plants. In the laboratory, many have studied the effects of different nitrogen concentrations on the levels of gene expression in Arabidopsis.8,21 Because of the increasing applications of nitrogen fertilizers, investigating these effects on grain crops such as rice, corn, and maize in the greenhouse or laboratory has become a topic of considerable research effort.2225 However, under field conditions, these topics have been investigated much less frequently. It is still unknown how the release patterns of controlled-release urea may change the levels of gene expression and enzyme synthesis of rice. The molecular mechanisms behind how controlled-release urea improves plant nitrogen use efficiencies would seem well worth researching.

In the present study, direct-seeded rice was used to determine the molecular mechanisms of controlled-release urea for improving plant nitrogen use efficiencies and grain yields. Rice (Oryza sativa L.) is a primary food source and staple crop for over 50% of the world’s population and about 65% of the population of China.26,27 Planting rice crops is usually performed mechanically either by transplanting plantlets or directly sowing seeds. Hence, the direct seeding of rice offers many advantages because of the simpler propagation and reduced production costs.28,29 Objectives of the present study were to investigate the effects of controlled-release urea on the nitrogen use efficiency and yield of directed-seeded rice and reveal the reason that controlled-release urea improved the nitrogen use efficiency and yield of directed-seeded rice by detecting the levels of enzyme activity, protein content, and gene expression related to nitrogen and determining how directed-seeded rice absorbs and uses nitrogen. Correlations between soil inorganic nitrogen, enzyme activity, protein content, gene expression, nitrogen use efficiency, and/or grain yields also were determined. The hypothesis was that controlled-release urea increases gene transcription, functional enzyme synthesis, and nitrogen use efficiencies of direct-seeded rice, thereby improving its production.

Experimental Section

Experimental Materials

Field experiments were conducted during 2016–2017 at Yaozhuang, Yutai City Basin, Shandong Province, China (Figure S1, 35°08′ N, 116°53′ E). This area has a temperate, subhumid to humid monsoon climate with a mean air temperature of 13.2 °C, an annual precipitation of 647–900 mm, and a rainy season lasting from June to October. The dominant soil type is hydromorphic paddy soil.15 The main properties of the top 20 cm of soil at the test site included the following: pH, 8.2 (the ratio of soil to water was 1:2.5); soil total nitrogen concentration, 1.56 g kg–1; available phosphorus concentration, 10.56 mg kg–1; available potassium concentration, 156.32 mg kg–1; organic matter concentration, 18.75 g kg–1; clay, 18.52%; silt, 72.62%; and sand, 8.86%.

We used the rice cultivar, O. sativa ‘Runnong11’, which has resistance to pests and diseases and produces high grain yields. Seeds were planted in the field on June 15 of both 2016 and 2017, with the grain harvested on October 12, 2016, or October 22, 2017.

Experimental Design

The rice field tests included six total treatments each with three replications in a randomized block design. The control treatment received no nitrogen fertilizer, but there were five nitrogen-fertilized treatments: one of standard urea (U, 360 kg N/ha) and four of controlled-release urea (CRU1, 120 kg N ha–1; CRU2, 180 kg N ha–1; CRU3, 240 kg N ha–1; and CRU4, 360 kg N ha–1, respectively). The controlled-release urea in these treatments was coated with a thermoplastic resin, which had been previously recycled from plastics. The control treatment was provided with a mono-potassium phosphate mix (52% P2O5 and 34.0% K2O) and potassium sulfate but no nitrogen. In addition to the nitrogen treatment applications, the U and controlled-release urea treatments were fertilized with sulfate and 50% K2O to provide potassium and diammonium phosphate to provide both phosphorus and quick-acting nitrogen. The nitrogen applications for the controlled-release urea treatments (CRU1, CRU2, CRU3, and CRU4) were all applied when the seeds were sown. For the standard urea treatment (U); however, 25% was initially applied at planting, while three more applications of 25% each were made at 20, 30, and 50 d, after planting, respectively. There were 18 rectangular plots, each 6.0 × 3.3 m (20 m2) and representing one treatment and one replication. Each plot was divided by a ridge (40 cm wide and 40 cm high). There were 14 rows (planting beds) in each plot whereby the rectangular widths were spaced 25 cm apart. Rice seeds were planted at 23.6 g per row or 330 g per plot.

Sampling and Analytical Techniques

During both years, soil samples were collected from each plot at the milk stage from a depth of 0–20 cm depth using a drill (2.0 cm diameter × 100 cm length). We pulled out the plants in the three zones, then removed the excess soil, and collected the soil near the roots as soil samples from the rhizosphere. The samples were air-dried and then passed through sieves of 2.0 mm and 0.25 mm for further analyses. Soil NO3-N and NH4+-N were extracted from each sample using 0.01 mol/L of CaCl2 followed by determination of concentrations in the extract solution using an AA3-A001-02E autoanalyzer (Bran-Luebbe Co., Norderstedt, Germany).30 Inorganic soil nitrogen concentration within the root zone of rice plants was considered to be the sum of the concentrations of NO3-N and NH4+-N.

Two suction lysimeters were installed in each plot at a 20 cm soil depth to gather water samples, which were then transferred to 50 mL plastic centrifuge tubes using an injector, followed by placement of the tubes in a bubble chamber with ice bags for storage. Water samples were then brought to the laboratory, and the concentrations of NO3-N and NH4+-N were determined using similar methods with soil samples.31 Similar to the analyses of soil samples, inorganic nitrogen concentrations of water within rice root zones were considered to be the sum of the NO3-N and NH4+-N concentrations.

Rice plant weights were measured from the seedling to mature stages, followed by determination of the growth rates (Table 1); the growth rate was calculated by the plant weight divided by the growth days. Five rice plant samples were collected randomly from each plot by cutting off the above-ground portions at the mature stage. Plants with grains were dried in a drying oven at 75 °C to a constant weight before being weighed and sieved (100-mesh). Nitrogen concentrations were measured using an automatic chemical analyzer Smartchem 200 (AMS Alliance, Guidonia, Italy).19 At maturity, the yields of total biomass and grains were measured by hand from a 1 m2 representative area of each plot. Based on sums of dry matter and nitrogen concentration for each plot, their above-ground nitrogen uptakes were determined. The total nitrogen use efficiency was calculated using the formula of Devkota et al.32 (eq 1).

graphic file with name ao3c02113_m001.jpg 1

Table 1. Rates of Mass Accumulation in Rice Plants during 2016–2017 [ kg/ha)/d].

    growth stageb
year treatmenta seedling 0–20 d tillering 20–30 d panicle initiation 30–50 d milk 50–80 d maturity 80–120 d
2016 control 1.4d 49e 31e 53c 13c
  U 3.0b 76c 82c 114b 47a
  CRU1 2.5c 67d 47b 114b 28b
  CRU2 2.9b 77c 74c 136b 57a
  CRU3 3.3a 91b 104b 120b 50a
  CRU4 3.3a 100a 127a 149a 47a
2017 control 1.4e 49d 40d 65e 16c
  U 2.4c 79c 74c 109b 44b
  CRU1 1.9d 64b 47d 77de 26c
  CRU2 2.3c 76c 72c 88cd 56a
  CRU3 3.0b 88b 101b 97bc 62a
  CRU4 3.2a 95a 129a 147a 21c
a

Control: no nitrogen fertilizer; U: standard urea applied at 360 kg of N/ha; controlled-release urea was applied at 120 CRU1, 180 CRU2, 240 CRU3, or 360 CRU4 kg of N/ha.

b

Means within each column followed by different lowercase letters were significantly different based on a one-way ANOVA followed by Duncan’s multiple-range tests P < 0.05).

Based on data for the growth rates of rice plants (Table 1), immature leaf tips were gathered at the milk stage, put into a kettle with liquid nitrogen, and then brought to the laboratory for qPCR tests and enzyme activity analyses. According to the methods reported by Miller et al., the levels of nitrogen metabolism activity were measured for the following enzymes: glutamine synthetase (GS), glutamate synthase, also known as glutamine-2-oxoglutarate amidotransferase (GOGAT), and nitrate reductase (NR).8

For isolating and purifying RNA samples, synthesizing cDNA, and using real-time PCR, the protocols followed were the same as those in the previous study.21 Five kinds of genes related to nitrogen metabolism in rice were observed for analyses: OsNIA for NR, OsGS1 and 2 for GS, and OsGLN1.1 and 1.2 for GOGAT. OsActin served as the internal reference gene along with different primers (Table 2).

Table 2. Primers Used to Study Rice Genes Related to Nitrogen Metabolism.

primera nucleic acid sequence 5′ to 3′)
OsNIA53130-F AGATATACTTCAAGGGCGAGGA
OsNIA53130-R CCCTTGATGTCGATGGTG
OsGS1-F GGAATGTATGCGGTGATGGT
OsGS1-R TGAAATCCAGCAGGGAACTG
OsGS2-F GTGATCAAGAAGGCAATCCTAAAC
OsGS2-R CTCGTGTAAACCTGTCAACCT
OsGLN1.1-F GAACGGCAAGGGCTACTT
OsGLN1.1-R CTTCCAGATGATGGTGGTCTC
OsGLN1.2-F CCGACATCAACACCTTCAAATG
OsGLN1.2-R GCCTCCTGTCCTCGAAGTA
OsActin-F GGAACTGGTATGGTCAAGGC
OsActin-R AGTCTCATGGATAACCGCAG
a

F represents the front end, and R represents the rear end of each primer.

In addition, rice plant heights were found using a tape measure, and chlorophyll density (SPAD) values were measured using a handheld chlorophyll meter (SPAD-502; Minolta, Tokyo, Japan).

Statistical Analyses

For data processing and drawing figures, Microsoft Excel 2010 and SigmaPlot 12.5 were used, respectively. Analyses of variance followed by Duncan mean separation tests were performed using Statistical Analysis Systems version 9.2 (SAS 2012). Redundancy analyses (RDAs) combined with CANOCO 5.0 software (Microcomputer Power, Ithaca, NY, USA) provided an ordination method and multivariate statistical approach used in the present study. RDAs helped to analyze data for enzyme activity, gene expression, and the effects of multiple environmental effects, such as inorganic nitrogen concentrations in soil and water.

Results and Discussion

Soil and Water Concentrations of Inorganic Nitrogen within Rice Root Zones

Effects among treatments appeared similar during 2016 and 2017 for the levels of inorganic nitrogen within the soil and water of rice root zones (Figure 1). For water samples in 2016, the control treatment resulted in significantly higher levels of inorganic nitrogen than CRU1 and statistically the same levels as U. Otherwise, the levels of inorganic nitrogen from soil and water were all significantly lower in the control than all other treatments during both years. In 2016, the soil inorganic nitrogen concentration of CRU1 was statistically the same as that for U. However, during both years, soil and water nitrogen concentrations were otherwise significantly higher for U (360 kg of N ha–1) than for CRU1 (120 kg of N ha–1), the lowest concentration of controlled-release urea. On the other hand, the most concentrated controlled-release urea, CRU4 (360 kg of N ha–1), yielded significantly higher nitrogen levels than U, CRU1, or the control during both years and for both water and soil samples. CRU4 nitrogen levels were significantly higher than those from all other treatments in soil and water samples from both years except for 2016 water samples when they were statistically the same as the two immediately lower concentrations: CRU3 (240 kg of N ha–1) and CRU2 (180 kg of N ha–1). Both these intermediate treatments, along with CRU4, led to significantly higher nitrogen levels than U, CRU1, or the control in both water and soil samples during both years. The second-highest concentration (CRU3) was significantly higher than the third-highest (CRU2) in soil nitrogen in 2017, unlike in 2016, when the two treatments yielded the same levels in both kinds of samples.

Figure 1.

Figure 1

Inorganic nitrogen concentrations from samples of soil and water taken within rice root zones 0–20 cm deep during the milk stages of 2016 and 2017. Treatments included no applied nitrogen control, CK; standard urea at 360 kg of N/ha U; and treatments that were fertilized with controlled-release urea at 120, 180, 240, and 360 kg of N/ha CRU1, CRU2, CRU3, and CRU4, respectively.

Activities of the Three Enzymes

In both 2016 and 2017, the NR activity was significantly higher in CRU3 and CRU4 than in U, which was significantly higher than that in CRU2, which was significantly higher than that in CRU1 while that of the control was significantly lower than in all other treatments (Figure 2a). During both years, the activity of GS from the CRU4 treatment was significantly higher than that in all other treatments while those of CRU3, CRU2, and U were more intermediate with each significantly higher than that of CRU1 or the control (Figure 2b). The nitrogen application rates of the five treatments were 35.74, 67.21, 60.85, 55.90, and 53.73% (U, CRU1, CRU2, CRU3, and CRU4, respectively) in 2017, which were similar to the rates in 2016.15 Although the nitrogen application rate of the U treatment was just half the rate provided in CRU2, the two treatments had almost the same effect on the activities of GS. During both years, the control treatment, without added nitrogen, resulted in significantly lower GOGAT activities than all the other treatments, whereas CRU4 was consistently in the highest group statistically (Figure 2c). Except for CRU2, which was also in the highest group statistically in 2016, the remaining treatments were statistically intermediate between the control and CRU4 during both years for GOGAT activity. When compared with analyses of the foregoing enzymes, rice protein contents tended to produce similar results, which were generally more consistent between 2016 and 2017 (Figure 2d). During both years, CRU4 and CRU3 each were in the highest group statistically and significantly higher than CRU2 or U, which were significantly higher than CRU1, with the control significantly lower than all the other treatments. Redundancy analyses were used to investigate relationships between enzyme activities and inorganic nitrogen concentrations. Results of redundancy analyses suggested that the first two axes provided a good representation of all the enzyme activity variables in the different treatments (Figure 3; Table 3). Based on Monte Carlo permutation tests, the concentrations of soil ammonia and nitrate in water and soil each had significant effects on enzyme activities. The explanations of the three environmental factors were 51.8, 11.9 and 6.4% (p ≤ 0.01). Except for GOGAT activity, there were significant correlations among soil inorganic nitrogen concentrations, enzyme activities, and grain yields (Table 4).

Figure 2.

Figure 2

Enzyme activities and protein content within rice leaves during the milk stages of 2016 and 2017. Treatments included no applied nitrogen control, CK; standard urea at 360 kg of N/ha U; and treatments that were fertilized with controlled-release urea at 120, 180, 240, and 360 kg of N/ha CRU1, CRU2, CRU3, and CRU4, respectively.

Figure 3.

Figure 3

Redundancy analysis correlation triplots showing the relationships between (a) inorganic nitrogen concentration and amount of gene expression, (b) enzyme activity and the amount of gene expression, and (c) inorganic nitrogen concentration and enzyme activity. Solid lines with solid arrowheads show changes in dependent variables, while solid lines with empty arrowheads denote changing environmental factors. (a) NIA, GS1 and 2, and GLN1.1 and 1.2 mean the gene expression of nitrate reductase, glutamine synthetase, and glutamate synthase; (b) NR, GS, and GOGAT mean the enzyme activity of nitrate reductase, glutamine synthetase, and glutamate synthase; (c) SoilAmmn, Soil Nitr, WaterAmm, and WaterNit mean the concentrations of NO3-N and NH4+-N in soil and water. Circles, squares, diamonds, spots, and crosses indicate different treatments during the two seasons. Each shaded figure indicates one treatment, and a circle and point label shows each replication. Each treatment label begins with “16” for 2016 or “17” for 2017; these are followed by codes for different treatments including no applied nitrogen control, CK; standard urea at 360 kg of N/ha U; and treatments of controlled-release urea at 120, 180, 240, and 360 kg of N/ha CRU1, CRU2, CRU3, and CRU4, respectively.

Table 3. Additional Data Related to Results from Redundancy Analyses Shown in Figure 3.

figure sum %a axis λ as %b λ as cumulative % λ as cumulative % of the sum of all canonical eigenvalues
3a 69.0 1 64.19 64.19 93.02
    2 3.87 68.06 98.63
3b 76.3 1 74.55 74.55 97.71
    2 1.38 75.93 99.52
3c 72.9 1 68.26 68.26 93.69
    2 3.61 71.87 98.65
a

Of the total of all canonical eigenvalues.

b

λ is the standard deviation of the scores.

Table 4. Results of Correlation Analyses Showing Correlation Coefficients and Their Levels of Significance for Traits That Were Measured or Calculated from the Controlled-Release Urea Treatments at the Milk Stage during 2016 and 2017a.

traitb N Yield NUE NR GS GOGAT Protein NIA GS1 GS2 GLN1.1 GLN1.2
N 1                      
yield 0.726** 1                    
NUE –0.664** –0.632** 1                  
NR 0.702** 0.703** –0.730** 1                
GS 0.728** 0.722** –0.538** 0.860** 1              
GOGAT 0.411* 0.3061NS –0.2253NS 0.317NS 0.566** 1            
protein 0.762** 0.730** –0.875** 0.768** 0.626** 0.2219NS 1          
OsNIA 0.710** 0.713** –0.536** 0.775** 0.787** 0.3258NS 0.760** 1        
OsGS1 0.686** 0.534** –0.811** 0.637** 0.552** 0.414* 0.788** 0.569** 1      
OsGS2 0.767** 0.592** –0.803** 0.571** 0.456* 0.3008NS 0.825** 0.593** 0.935** 1    
OsGLN1.1 0.659** 0.662** –0.508* 0.795** 0.741** 0.2504NS 0.712** 0.927** 0.530** 0.569** 1  
OsGLN1.2 0.803** 0.764** –0.800** 0.888** 0.783** 0.3143NS 0.882** 0.798** 0.808** 0.792** 0.843** 1
a

Significant at P < 0.05 * or P < 0.01 **. The source data resulted from pooling all controlled-release urea treatments from both years; n = 24.

b

Soil inorganic nitrogen, N; grain yield, Yield; nitrogen use efficiency, NUE; enzyme activities including nitrate reductase NR, glutamine synthetase GS, and glutamate synthase GOGAT; protein content of rice leaves, Protein, and the expression levels for genes controlling nitrogen metabolism in rice NIA, GS1, GS2, GLN1.1, and GLN1.2.

Effects of Nitrogen on Gene Expression

Five genes related to enzyme synthesis were measured in this study. The results of OsNIA gene products, which help to synthesize NR, were similar during 2016 and 2017 (Figure 4a). During both years, OsNIA gene activity from the CRU4 treatment was significantly higher than from all the other treatments, while CRU3, CRU2, and U were each more intermediate and significantly higher than CRU1 or the control (Figure 4a). The expression of CRU2 and U was statistically the same in both years. Both OsGS1 and OsGS2 could guide the synthesis of GS, The expression of OsGS1 genes which produce GS was similar to those coding for OsNIA during 2016–2017 because OsGS1 gene product activity from the CRU4 treatment was significantly higher than from all the other treatments (Figure 4b). During both years for OsGS1, CRU3 resulted in significantly higher activity levels than all remaining treatments including CRU2 and U, which were each significantly higher than that of the control. Similarly, for both test years with GS 2 (OsGS2) and with OsGLN1.1, CRU4 showed significantly higher gene-product expression levels than CRU3, which was significantly higher than that of CRU2 or U, which were each significantly higher than that of CRU1 or the control (Figure 4c,d). Similarly, for both years of tests on OsGLN1.2, CRU4 showed significantly higher amounts of gene expression than CRU3, which was significantly higher than that of CRU2, CRU1, or U, which were each significantly higher than that of the control (Figure 4e). Generally, OsGLN1.1 and OsGLN1.2 can trigger the synthesis of GOGAT. There were no significant differences between CRU2 and U during both years for OsNIA or in 2016 for OsGS1, OsGS2, or OsGLN1.2. CRU1 was significantly lower than U during both years for all five gene products except for OsGLN1.2 in 2017. A redundancy analysis biplot indicated there were significant correlations between the levels of soil nitrate or ammonia and the levels of expression for all five gene products (Figure 3a). Cosines of the angles between the arrows showing levels of enzyme activity and those showing gene expression permitted their linear correlations to be plotted. Specifically, linear correlations were determined between OsNIA and NR, OsGLN1.1 or OsGLN1.2 each versus GOGAT, and OsGS1 or OsGS2 each versus GS (Figure 3b).

Figure 4.

Figure 4

Expression of gene products in the leaf tips of rice at the milk stage during 2016–2017. Gene products were (A) NR OsNIA, (B) GS OsGS1, (C) GS OsGS2, (D) GOGAT OsGLN1.1, and (E) GOGAT OsGLN1.2. The fertilizer treatments included no applied nitrogen control, CK; standard urea at 360 kg of N/ha U; and treatments involving fertilization with controlled-release urea at 120, 180, 240, and 360 kg of N/ha CRU1, CRU2, CRU3, and CRU4, respectively.

Treatment Effects on Soil Inorganic Nitrogen Concentrations

Within the rice-plant root zones (0–20 cm), soil and water inorganic nitrogen concentrations were affected by the kinds and amounts of nitrogen fertilization with controlled-release urea leading to the highest nitrogen contents. Rice production involves a large nitrogen requirement for plant growth and high nitrogen losses from leaching. Because standard urea (U, 360 kg of N/ha) did not provide a continuous supply of nitrogen, its soil levels were lower than those from treatments supplied with the three highest concentrations of controlled-release urea (CRU2, CRU3, and CRU4) in the rice milk stage. Hence, controlled-release urea treatments improved soil nitrogen contents presumably because the release of nitrogen was made continuous by a coating on the fertilizer grains. Zhang et al. (2016) reported similar results, noting that when compared to standard urea,15 controlled-release urea improved rice nitrogen use efficiencies and grain yields.

Fertilizer Treatment Effects on Enzyme Activities

NR, GS, and GOGAT are key enzymes involved in plant nitrogen metabolism 3031. Nitrate is absorbed by the roots but is mainly transferred to the shoots.33,34 In the shoots, nitrate is reduced to nitrite by NR followed by further reduction to ammonium. For ammonium, most of it is taken up by the roots; then, GS/GOGAT changes it to amino acids.8 The leaves of rice and other plant species serve as an interim transfer station for nitrogen. Here, with the help of enzymes such as NR and GS/GOGAT, nitrogen is converted to a form usable by developing seeds.1 We found that compared with standard urea, controlled-release urea improved the activities of enzymes including NR, GS, and GOGAT in the rice leaves. This may have resulted from increases in the amount of inorganic soil nitrogen within rice root zones to levels greater than that from standard urea in the milk stage. Strong correlations were found between concentrations of inorganic soil nitrogen and the activities of these enzymes, thereby supporting this conclusion (Table 4). Yang et al. similarly, reported that with increasing concentrations of inorganic soil nitrogen,18 the activities of NR, GS, and GOGAT also increased. In our study, the controlled-release urea treatments improved the protein contents and activities of GS, GOGAT, and NR. Hence, the controlled-release urea treatments can improve rates of nitrogen uptake and use compared with standard urea treatments (U, 360 kg of N ha–1).

Effects of Controlled-Release Urea on the Levels of Gene Expression

The levels of gene expression often have been found to be affected by external stimuli.35 In the present study, the highest two concentrations of controlled-release urea often resulted in greater levels of gene expression than from the standard urea, which caused crops to generally use the extra nitrogen. Amounts of gene expression for products involving nitrogen metabolism are often affected by concentrations of root-zone soil nitrogen, which therefore provides a signal to plants.1,2 The highest two concentrations of controlled-release urea each provided nitrogen to rice plants continuously throughout the growing season, thus in generally greater amounts than that of standard urea. Our most concentrated controlled-release treatments may have signaled higher levels of continuous gene expression for products involving nitrogen metabolism compared with the standard urea.

While expression levels increased for the genes OsNIA, OsGS1, OsGS2, OsGLN1.1, and OsGLN1.2, especially in plants with the stronger controlled-release urea treatments, the amounts of NR, GS, and GOGAT also increased. Hence, the plants were able to take up more soil nitrogen than corresponding plants fertilized with less or with different fertilizers. Activities of the foregoing genes appeared to be higher in the most well-fertilized, controlled-release urea treatments, resulting in better use of available nitrogen and increased synthesis of enzymes and proteins. Previously, there was a lack of knowledge about the effects of providing different concentrations of controlled-release urea on the physiology and molecular biology of rice under field conditions. Hence, we studied relationships between concentrations of inorganic nitrogen applied to rice roots, the expression of genes involved in nitrogen metabolism, and the levels of resulting enzymes and protein. Pairs of these variables generally correlated with each other, although a notable exception was GOGAT enzyme activity. Compared with the other treatments, our stronger controlled-release urea applications improved soil nitrogen concentrations within rice root zones, resulting in greater nitrogen uptake, which enhanced the expression of genes related to nitrogen metabolism. This in turn led to enhanced synthesis, transportation, and use of enzymes, which supported further increases in the uptake and use of nitrogen.

Effects of Controlled-Release Urea on Nitrogen Use Efficiency and Yield

Increasing levels of nitrogen fertilization have been found to increase rice biomasses and grain yields (Figure S2).36,37 Larger overall rice biomasses are needed in part to produce more of the valuable subset, grain yields.20,38,39 Biomasses and grain yields tend to positively correlate with variables such as plant height and chlorophyll density. We found that the stronger concentrations of controlled-release urea improved rice plant heights and chlorophyll densities, compared with the other treatments including standard urea (Tables S1 and S2). These factors also may have contributed to increases in nitrogen use efficiency, amount of organic matter, and grain yield. Controlled-release urea also provides rice plants with a more persistent nitrogen source, which is not as easily lost through nonuse and leaching compared with standard urea.2123 Hence, controlled-release urea often improves nitrogen use efficiencies compared with standard nitrogen fertilizers. Plant nitrogen use efficiency is a complex trait determined by quantitative-trait gene loci and the environment.13,22 Maintaining good nitrogen use efficiency in crop plants is crucial for sustainable agriculture and increasing grain yields. The natural supply of soil nitrogen is highly variable and strongly affects plant growth and crop yields. Unraveling molecular bases for how plants “sense” and respond to changes in nitrogen availability should help in developing new strategies for increasing nitrogen use efficiencies. Previously, a lack of field study was performed on how providing controlled-release urea to direct-seeded rice affected its nitrogen use efficiency, physiology, molecular biology, and grain yield. The present study found strong correlations among most of these factors. This suggested that compared with the other treatments, our higher concentrations of controlled-release urea first improved root-zone nitrogen concentrations, which promoted higher rates of nitrogen uptake, which led to enhanced expression of genes controlling nitrogen metabolism. These genes indirectly increased the production, transport, and use of nitrogen-synthesizing enzymes and proteins. In turn, the result was added uptake and use of nitrogen and higher nitrogen use efficiencies and grain yields. Hence, controlled-release urea, especially when provided at our two strongest concentrations, can greatly benefit sustainable agriculture while maximizing yields of direct-seeded rice.

Conclusions

Controlled-release urea improved the N concentration in water and soil compared with standard urea and treatments receiving no N fertilizer. This increased the expression of genes related to nitrogen metabolism including OsNIA, OsGS1, OsGS2, OsGLN1.1, and OsGLN1.2. The activity of enzymes in rice leaves related to nitrogen metabolism also increased including NR, GS, and GOGAT; hence, protein content was also improved. Strong correlations usually occurred between the levels of inorganic nitrogen found in rice root zones and indices of nitrogen use efficiency, physiology, molecular biology, and grain yield. Controlled-release urea provided at our two highest concentrations also enhanced the expression of genes related to nitrogen metabolism. These benefits helped the rice plants improve their absorption, transport, and use of nitrogen. The hypothesis was that controlled-release urea increases gene transcription, functional enzyme synthesis, and nitrogen use efficiencies of direct-seeded rice, thereby improving its production. Providing controlled-release urea at our two strongest concentrations during seeding can therefore promote sustainable agriculture while maximizing rice yields.

Acknowledgments

This research was funded by the Young Elite Scientists Sponsorship Program by CAST (2021QNRC001), Shandong Agricultural Innovation Team (SDAIT-2021-04), National Natural Science Foundation of China (grant no. 32202612), and Natural Science Foundation of Shandong Province (grant no. ZR2022QC051). We also thank Cliff G. Martin for reviewing this manuscript.

Supporting Information Available

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.3c02113.

  • Location of field plots, views of field plots and view of rice plants during the milk stages, rice plant heights (cm) measured at different growth stages during 2016, and chlorophyll density (SPAD values) for rice at different growth stages (PDF)

Author Contributions

C.T. and M.H. contributed equally to this work.

The authors declare no competing financial interest.

Supplementary Material

ao3c02113_si_001.pdf (670.6KB, pdf)

References

  1. Kant S. Understanding nitrate uptake, signaling and remobilisation for improving plant nitrogen use efficiency. Semin. Cell Dev. Biol. 2018, 74, 89–96. 10.1016/j.semcdb.2017.08.034. [DOI] [PubMed] [Google Scholar]
  2. Xuan W.; Beeckman T.; Xu G. Plant nitrogen nutrition: sensing and signaling. Curr Opin Plant Biol 2017, 39, 57–65. 10.1016/j.pbi.2017.05.010. [DOI] [PubMed] [Google Scholar]
  3. Tang L.; Li S.; Shen Y.. Response of maize yield and nitrogen leaching to combining controlled-release urea and normal urea under different surface mulching, 2021. [DOI] [PubMed]
  4. Forde B. G. Nitrogen signalling pathways shaping root system architecture: an update. Curr Opin Plant Biol 2014, 21, 30–36. 10.1016/j.pbi.2014.06.004. [DOI] [PubMed] [Google Scholar]
  5. Sun L.; Di D.; Li G.; Kronzucker H. J.; Shi W. Spatio-temporal dynamics in global rice gene expression Oryza sativa L. in response to high ammonium stress. J. Plant Physiol. 2017, 212, 94–104. 10.1016/j.jplph.2017.02.006. [DOI] [PubMed] [Google Scholar]
  6. Kiran J. K.; Khanif Y. M.; Amminuddin H.; Anuar A. R. Effects of controlled release urea on the yield and nitrogen nutrition of flooded rice. Commun Soil Sci Plan 2010, 41, 811–819. 10.1080/00103621003592333. [DOI] [Google Scholar]
  7. Atere C. T.; Ge T.; Zhu Z.; Tong C.; Jones D. L.; Shibistova O.; Guggenberger G.; Wu J. Rice rhizodeposition and carbon stabilisation in paddy soil are regulated via drying-rewetting cycles and nitrogen fertilisation. Biol Fert Soils 2017, 53, 407–417. 10.1007/s00374-017-1190-4. [DOI] [Google Scholar]
  8. Miller A. J.; Cramer M. D. Root nitrogen acquisition and assimilation. Plant Soil 2005, 274, 1–36. 10.1007/s11104-004-0965-1. [DOI] [Google Scholar]
  9. Yang Y.; Meng T.; Qian X.; Zhang J.; Cai Z. Evidence for nitrification ability controlling nitrogen use efficiency and N losses via denitrification in paddy soils. Biol Fert Soils 2017, 53, 349–356. 10.1007/s00374-017-1185-1. [DOI] [Google Scholar]
  10. Islam M. S.; Peng S.; Visperas R. M.; Ereful N.; Bhuiya M. S. U.; Julfiquar A. Lodging-related morphological traits of hybrid rice in a tropical irrigated ecosystem. Field Crop Res 2007, 101, 240–248. 10.1016/j.fcr.2006.12.002. [DOI] [Google Scholar]
  11. Thakur A. K.; Rath S.; Mandal K. G. Differential responses of system of rice intensification (SRI) and conventional flooded-rice management methods to applications of nitrogen fertilizer. Plant Soil 2013, 370, 59–71. 10.1007/s11104-013-1612-5. [DOI] [Google Scholar]
  12. Tilman D.; Cassman K. G.; Matson P. A.; Naylor R.; Polasky S. Agricultural sustainability and intensive production practices. Nature 2002, 418, 671–677. 10.1038/nature01014. [DOI] [PubMed] [Google Scholar]
  13. Liu Q.; Chen X.; Wu K.; Fu X. Nitrogen signaling and use efficiency in plants: what’s new?. Currt Opin Plant Biol 2015, 27, 192–198. 10.1016/j.pbi.2015.08.002. [DOI] [PubMed] [Google Scholar]
  14. Yang X.; Geng J.; Liu Q.; Zhang H.; Hao X.; Sun Y.; Lu X. Controlled-release urea improved rice yields by providing nitrogen in synchrony with the nitrogen requirements of plants. J. Sci. Food Agric. 2021, 101, 4183–4192. 10.1002/jsfa.11056. [DOI] [PubMed] [Google Scholar]
  15. Zhang S.; Shen T.; Yang Y.; Li Y. C.; Wan Y.; Zhang M.; Tang Y.; Allen S. C. Controlled-release urea reduced nitrogen leaching and improved nitrogen use efficiency and yield of direct-seeded rice. J. Environ. Manage. 2018, 220, 191–197. 10.1016/j.jenvman.2018.05.010. [DOI] [PubMed] [Google Scholar]
  16. Wang S.; Zhao X.; Xing G.; Yang Y.; Zhang M.; Chen H. Improving grain yield and reducing N loss using polymer-coated urea in southeast China. Agron Sustain Dev 2015, 35, 1103–1115. 10.1007/s13593-015-0300-7. [DOI] [Google Scholar]
  17. Yang Y.; Zhang M.; Li Y.; Fan X.; Geng Y. Controlled release urea improved nitrogen use efficiency, activities of leaf enzymes, and rice yield. Soil Sci. Soc. Am. J. 2012, 76, 2307–2317. 10.2136/sssaj2012.0173. [DOI] [Google Scholar]
  18. Zhang S.; Yang Y.; Gao B.; Wan Y.; Li Y. C.; Zhao C. Bio-based interpenetrating network polymer composites from locust sawdust as coating material for environmentally friendly controlled-release urea fertilizers. J Agri Food Chem 2016, 64, 5692–5700. 10.1021/acs.jafc.6b01688. [DOI] [PubMed] [Google Scholar]
  19. Xu N.; Wang R.; Zhao L.; Zhang C.; Li Z.; Lei Z.; Liu F.; Guan P.; Chu Z.; Crawford N.; et al. The Arabidopsis NRG2 protein mediates nitrate signaling and interacts with and regulates key nitrate regulators. Plant Cell 2016, 28, 485–504. 10.1105/tpc.15.00567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kant S.; Bi Y.-M.; Rothstein S. J. Understanding plant response to nitrogen limitation for the improvement of crop nitrogen use efficiency. J. Exp. Bot. 2010, 62, 1499–1509. 10.1093/jxb/erq297. [DOI] [PubMed] [Google Scholar]
  21. Zhang S.; Gao N.; Shen T.; Yang Y.; Gao B.; Li Y. C.; Wan Y. One-step synthesis of superhydrophobic and multifunctional nano copper-modified bio-polyurethane for controlled-release fertilizers with “multilayer air shields”: new insight of improvement mechanism. J. Mate. Chem. A 2019, 7, 9503–9509. 10.1039/c9ta00632j. [DOI] [Google Scholar]
  22. Zhang S.; Yang Y.; Zhai W.; Tong Z.; Shen T.; Li Y. C.; Zhang M.; Sigua C. G.; Chen J.; Ding F. Controlled-release nitrogen fertilizer improved lodging resistance and potassium and silicon uptake of rice. Crop Sci 2019, 59, 1–8. [Google Scholar]
  23. Zhang S. G.; Yang Y. Y.; Tong Z. H.; Gao B.; Gao N.; Shen T. L.; Wan Y.; Yu Z.; Liu L.; Ma X.; Guo Y.; Fugice J.; et al. Self-Assembly of Hydrophobic and Self-Healing Bionanocomposite-Coated Controlled-Release Fertilizers. ACS Appl. Mate. Interfaces 2020, 12, 27598–27606. 10.1021/acsami.0c06530. [DOI] [PubMed] [Google Scholar]
  24. McAllister C. H.; Beatty P. H.; Good A. G. Engineering nitrogen use efficient crop plants: the current status. Plant Biotechnol. J. 2012, 10, 1011–1025. 10.1111/j.1467-7652.2012.00700.x. [DOI] [PubMed] [Google Scholar]
  25. Chen H.; Zhang Q.; Lu Z.; Xu F. Accumulation of ammonium and reactive oxygen mediated drought-induced rice growth inhibition by disturbed nitrogen metabolism and photosynthesis. Plant Soil 2018, 431, 107–117. 10.1007/s11104-018-3752-0. [DOI] [Google Scholar]
  26. Hu Y.; Cheng H.; Tao S. The Challenges and Solutions for Cadmium-contaminated Rice in China: A Critical Review. Environ. Int. 2016, 92–93, 515–532. 10.1016/j.envint.2016.04.042. [DOI] [PubMed] [Google Scholar]
  27. Song Z. P.; Lu B.-R.; Zhu Y. G.; Chen J. K. Gene flow from cultivated rice to the wild species Oryza rufipogon under experimental field conditions. New Phytol. 2003, 157, 657–665. 10.1046/j.1469-8137.2003.00699.x. [DOI] [PubMed] [Google Scholar]
  28. Ye N. H.; Wang F. Z.; Shi L.; Chen M.; Cao Y.; Zhu F.; Wu Y.; Xie L.; Liu T.; Su Z.; et al. Natural variation in the promoter of rice calcineurin B-like protein10 (OsCBL10) affects flooding tolerance during seed germination among rice subspecies. Plant J. 2018, 94, 612–625. 10.1111/tpj.13881. [DOI] [PubMed] [Google Scholar]
  29. Wang G.; Hao S.; Gao B.; Chen M.; Liu Y.; Yang J.; Ye N.; Zhang J. Regulation of gene expression in the remobilization of carbon reserves in rice stems during grain filling. Plant Cell Physiol. 2017, 58, 1391–1404. 10.1093/pcp/pcx072. [DOI] [PubMed] [Google Scholar]
  30. Gilliam F. S.; McCulley R. L.; Nelson J. A. Spatial Variability in Soil Microbial Communities in a Nitrogen-Saturated Hardwood Forest Watershed. Soil Sci. Soc. Am. J. 2011, 75, 280–286. 10.2136/sssaj2010.0172. [DOI] [Google Scholar]
  31. Wieder R. K.; Vile M. A.; Scott K. D.; Albright C. M.; McMillen K. J.; Vitt D. H.; Fenn M. E. Differential Effects of High Atmospheric N and S Deposition on Bog Plant/Lichen Tissue and Porewater Chemistry across the Athabasca Oil Sands Region. Environ. Sci. Technol. 2016, 50, 12630–12640. 10.1021/acs.est.6b03109. [DOI] [PubMed] [Google Scholar]
  32. Devkota M.; Martius C.; Lamers J.; Sayre K.; Devkota K.; Vlek P. Tillage and nitrogen fertilization effects on yield and nitrogen use efficiency of irrigated cotton. Soil Till. Res. 2013, 134, 72–82. 10.1016/j.still.2013.07.009. [DOI] [Google Scholar]
  33. Hsu P.-K.; Tsay Y.-F. Two phloem nitrate transporters, NRT1. 11 and NRT1. 12, are important for redistributing xylem-borne nitrate to enhance plant growth. Plant Physiol. 2013, 163, 844–856. 10.1104/pp.113.226563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Léran S.; Muños S.; Brachet C.; Tillard P.; Gojon A.; Lacombe B. Arabidopsis NRT1. 1 is a bidirectional transporter involved in root-to-shoot nitrate translocation. Mol. Plant 2013, 6, 1984–1987. 10.1093/mp/sst068. [DOI] [PubMed] [Google Scholar]
  35. Wei W.; Isobe K.; Shiratori Y.; Nishizawa T.; Ohte N.; Otsuka S.; Senoo K. N2O emission from cropland field soil through fungal denitrification after surface applications of organic fertilizer. Soil Biol. Biochem. 2014, 69, 157–167. 10.1016/j.soilbio.2013.10.044. [DOI] [Google Scholar]
  36. Golden B.; Slaton N.; Norman R.; Wilson C.; DeLong R. Evaluation of polymer-coated urea for direct-seeded, delayed-flood rice production. Soil Sci. Soc. Am. J. 2009, 73, 375–383. 10.2136/sssaj2008.0171. [DOI] [Google Scholar]
  37. Xiong D.; Flexas J.. Leaf economics spectrum in rice: leaf anatomical, biochemical, and physiological trait trade-offs. J. Exp. Bot. 2018, 322, 10.1093/jxb/ery322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Tao Y.; Qu H.; Li Q.; Gu X.; Zhang Y.; Liu M.; Guo L.; Liu J.; Wei J.; Wei G.; et al. Potential to improve N uptake and grain yield in water saving ground cover rice production system. Field Crop Res 2014, 168, 101–108. 10.1016/j.fcr.2014.08.014. [DOI] [Google Scholar]
  39. Chen M. X.; Zhu F. Y.; Wang F. Z.; Ye N. H.; Gao B.; Chen X.; Zhao S.; Fan T.; Cao Y.; Liu T.; Su Z.; Xie L.; Hu Q.; Wu H.; Xiao S.; Zhang J.; Liu Y. G. Alternative splicing and translation play important roles in hypoxic germination in rice. J. Exp. Bot. 2019, 70, 817–833. 10.1093/jxb/ery393. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ao3c02113_si_001.pdf (670.6KB, pdf)

Articles from ACS Omega are provided here courtesy of American Chemical Society

RESOURCES