Skip to main content
NCBI home page
eLife logoLink to eLife
. 2023 Jun 30;12:e85872. doi: 10.7554/eLife.85872

A back-door insight into the modulation of Src kinase activity by the polyamine spermidine

Sofia Rossini 1, Marco Gargaro 1, Giulia Scalisi 1, Elisa Bianconi 2, Sara Ambrosino 1, Eleonora Panfili 1, Claudia Volpi 1, Ciriana Orabona 1, Antonio Macchiarulo 2, Francesca Fallarino 1, Giada Mondanelli 1,✉
Editors: Volker Dötsch3, Volker Dötsch4
PMCID: PMC10328509  PMID: 37387273

Abstract

Src is a protein tyrosine kinase commonly activated downstream of transmembrane receptors and plays key roles in cell growth, migration, and survival signaling pathways. In conventional dendritic cells (cDCs), Src is involved in the activation of the non-enzymatic functions of indoleamine 2,3-dioxygenase 1 (IDO1), an immunoregulatory molecule endowed with both catalytic activity and signal transducing properties. Prompted by the discovery that the metabolite spermidine confers a tolerogenic phenotype on cDCs that is dependent on both the expression of IDO1 and the activity of Src kinase, we here investigated the spermidine mode of action. We found that spermidine directly binds Src in a previously unknown allosteric site located on the backside of the SH2 domain and thus acts as a positive allosteric modulator of the enzyme. Besides confirming that Src phosphorylates IDO1, here we showed that spermidine promotes the protein–protein interaction of Src with IDO1. Overall, this study may pave the way toward the design of allosteric modulators able to switch on/off the Src-mediated pathways, including those involving the immunoregulatory protein IDO1.

Research organism: Mouse

Introduction

Besides being intermediates in metabolic reactions, metabolites can serve as intra- and intercellular signals (Piazza et al., 2018). Indeed, by interacting with specific molecular partners, soluble mediators can trigger a series of molecular events critical for cell fitness and adaptation. Metabolites binding to either the active site or the allosteric pocket – that is, that different from the catalytic site – of enzymes are among the best-characterized interactions that modulate protein activity as well as the assembly and function of multiprotein complexes (Changeux and Christopoulos, 2016; Mondanelli et al., 2020b; Feng et al., 2014).

The naturally occurring polyamines (i.e., putrescine, spermidine, and spermine) are organic cations derived from the decarboxylation of L-ornithine, which is generated by the arginase 1 from L-arginine (Pegg, 2016; Igarashi and Kashiwagi, 2000). The conversion of L-ornithine into putrescine is catalyzed by the rate-limiting enzyme ornithine decarboxylase 1, followed by two specific synthases that sequentially give rise to spermidine and spermine (Pendeville et al., 2001). These metabolites are protonated at physiological pH levels, allowing them to interact with negatively charged macromolecules, including nucleic acids, proteins, and phospholipids. Given their structure, polyamines indeed modulate several cellular processes, ranging from cell growth and proliferation to immune system function (Proietti et al., 2020; Holbert et al., 2022). As a matter of the fact, alteration of polyamines intracellular content is associated with the occurrence of several tumors, including prostate, breast, and colon cancers, for which polyamines are considered as biomarkers (Gerner et al., 2018; Geck et al., 2020; Nakkina et al., 2021). Among polyamines, spermidine has recently gained much more attention as player of immune regulation and in age-related disorders, such as cardiac hypertrophy and memory impairment (Madeo et al., 2018; Li et al., 2020; Eisenberg et al., 2016; Yang et al., 2016; Ni and Liu, 2021; Liu et al., 2020). Spermidine exerts a protective role in mouse experimental models of autoimmune diseases, such as multiple sclerosis and psoriasis, by activating the Forkhead box protein O3 (FOXO3) pathway and thus suppressing the production of inflammatory cytokines tumor necrosis factor (TNF)-α and interleukin (IL)-6 (Li et al., 2020). Moreover, spermidine is able to reprogram mouse conventional dendritic cells (cDCs) toward an immunoregulatory phenotype via Src kinase-dependent phosphorylation of indoleamine 2,3-dioxygenase 1 (IDO1) (Mondanelli et al., 2017). However, the exact mechanism of Src activation by spermidine remains to be elucidated.

The non-receptor tyrosine kinase Src is the representative of a family of structure-related kinases initially discovered as a proto-oncogene regulating critical cellular functions (Oppermann et al., 1979). Src activation mainly occurs downstream of multiple transmembrane receptors, including epidermal growth factor receptor (EGF-R), fibroblast growth factor receptor (FGF-R), and insulin-like growth factor-1 receptor (IGF-1R). Indeed, a dysregulated Src activity has been associated with tumor growth and metastasis, inflammation-mediated carcinogenesis, and therapeutic resistance to traditional antineoplastic drugs (Caner et al., 2021; Ahn et al., 2018; Cardin et al., 2018; Dosch et al., 2020; Roskoski, 2015; Shao et al., 2022). The induction of Src kinase activity can also occur following Aryl hydrocarbon Receptor (AhR) activation, whose conformational changes favor the Src-AhR disjunction, allowing the former to phosphorylate its downstream partner IDO1 and thereby promote the generation of an immunoregulatory milieu (Manni et al., 2020).

In addition to the kinase domain, Src possesses an N-terminal Src homology-4 (SH4) domain, a unique domain, an SH3 domain, an SH2 domain, an SH2-kinase linker domain, and a C-terminal autoregulatory motif (Roskoski, 2015). The SH2 and SH3 modules serve in protein–protein interactions that are essential for the regulation of kinase activity and signaling function. Specifically, the SH2 domain contains two distinct binding pockets. The first one has a conserved arginine residue that binds a phosphotyrosine (pY) residue presented by the protein substrate, whereas the second pocket binds the residue that is three positions C-terminal of pY (pY+3), contributing to the specificity in ligand–protein recognition.

The autoregulatory function of the kinase occurs through intramolecular interactions that stabilize the catalytically inactive conformation of Src, in which the SH2 domain binds to a pY located at position +530 of the human sequence. Accordingly, binding of ligand proteins to the SH2 domain displaces intramolecular contacts and promotes the catalytic activation of the Src kinase, which is characterized by the phosphorylation of a tyrosine residue in the activation loop (Y419 of the human sequence). Given the crucial role of the non-catalytic domains in modulating Src kinases activity, efforts have been made to develop drug-like modulators of the SH2 and SH3 domains. Small peptidomimetics destabilize the closed conformation and thus promote the kinase activation through the binding of SH3 and/or SH2 domains (Moroco et al., 2015; Moroco et al., 2014). Alternatively, modulators of Src kinases able to reinforce the intramolecular interactions have proven to allosterically inhibit the enzyme activity (Dorman et al., 2019).

Prompted by the finding that spermidine triggers the immunosuppressive IDO1 signaling in cDCs (Mondanelli et al., 2017), here we investigated the molecular relationship between that polyamine, Src kinase and IDO1. We found that spermidine (1) activates Src kinase with an allosteric mechanism; (2) binds directly Src kinase at a previously unknown allosteric site; (3) favors the association of IDO1 and Src kinase.

Results

Spermidine causes allosteric activation of the kinase activity of Src

The activation of Src kinase mainly occurs downstream of multiple transmembrane and intracellular receptors (such as AhR) as well as protein tyrosine phosphatases (Manni et al., 2020; Mondanelli et al., 2020a; Arias-Romero et al., 2009). In cDCs, it has been demonstrated that a small molecule, namely spermidine, activates Src with a still undefined mechanism (Mondanelli et al., 2017). To figure out whether a direct activation would occur, we assayed spermidine against purified recombinant human Src (rhSrc) protein. After 30 min of incubation, a luminescent assay was used to measure the ADP released by the kinase. Results showed that spermidine activated rhSrc with a half-maximal effective concentration (EC50) of 106.4 ± 13.4 nM (Figure 1A). To confirm the modulation of the kinase also in living cells, we resorted to immunoblot analysis of phosphorylated murine Src at the tyrosine Y418 as sign of kinase activation. SYF cells that is fibroblast null for Src family kinases, Src, Yes, and Fyn (Klinghoffer et al., 1999) were stably transfected with vector encoding for murine Src kinase and then treated with increasing concentration of spermidine. Results showed that the metabolite promoted Src phosphorylation with an EC50 of 6.4 ± 0.6 μM (Figure 1B, C). In addition, by measuring the kinase activity in cells endogenously expressing Src (i.e., the murine colon cancer cell line MC38), we confirmed the ability of the polyamine to activate Src (Figure 1D).

Figure 1. Spermidine enhances the activity of Src kinase in ATP-independent manner.

(A) Enzymatic activity of rhSrc in the presence of ATP (10 μM), synthetic peptide (100 μM), and increasing concentration of spermidine (45 nM to 100 μM). ADP-Glo Kinase Assay (Promega) was used to detect the activity. Results are shown as fold change vs untreated samples (fold change = 1, dotted line). Data are mean ± standard deviation (SD) of three independent experiments, each performed in triplicates. Data were analyzed with one-way analysis of variance (ANOVA) followed by post hoc Bonferroni test, by comparing the mean of spermidine-treated samples to untreated counterpart. *p < 0.05, **p < 0.01. Spermidine EC50 = 106.4 ± 13.4 nM. (B) Immunoblot analysis of phosphorylated (pSrc) and total Src protein level evaluated in cell lysates from SYF cells reconstituted with vector coding for wild-type Src and then treated with increasing concentration of spermidine (400 nM to100 μM). β-Actin expression was used as normalizer and the Src/β-actin ratio is included as mean ± SD of three independent experiments. One representative immunoblot of three is shown. (C) pSrc/Src ratio of scanning densitometry analysis of three independent immunoblots. Data (mean ± SD) are reported as fold change of samples treated with spermidine relative to untreated cells (fold change = 1, dotted line). Data were analyzed with one-way ANOVA followed by post hoc Bonferroni test, by comparing the mean of spermidine-treated samples to the untreated counterpart. *p < 0.05. Spermidine EC50 = 6.4 ± 0.6 μM. (D) Immunoblot analysis of phosphorylated (pSrc) and total Src protein level evaluated in cell lysates from MC38 cells treated with spermidine (20 μM) for the indicated time. β-Actin expression was used as normalizer. pSrc/Src ratio is calculated by densitometric quantification of the specific bands and is reported as fold change against untreated cells (fold change = 1). Data were analyzed with one-way ANOVA followed by post hoc Bonferroni test, by comparing the mean of spermidine-treated samples to the untreated counterpart. *p < 0.05, **p < 0.01 (E) Enzymatic activity of rhSrc in the presence of spermidine, with or without ATP and peptide substrate. Data are mean ± SD of three independent experiments and were analyzed by Student’s t-test comparing the Spd/ATP/peptide vs ATP/peptide sample. (F) Enzymatic activity of rhSrc in the presence of fixed concentrations of spermidine and increasing concentration of peptide substrate. Data are reported as mean ± SD of three independent experiments, each performed in triplicates. Vmax and Km were calculated after fitting the kinase activity data to the Michaelis–Menten equation. Data were analyzed with one-way ANOVA followed by post hoc Bonferroni test. *p < 0.05.

Figure 1—source data 1. Original immunoblots of phosphorylated (pSrc), total Src and actin protein levels evaluated in cell lysates from SYF cells reconstituted with vector coding for wild-type Src and then treated with increasing concentration of spermidine.
Figure with the uncropped blots with relevant bands clearly labeled are provided.
Figure 1—source data 2. Original immunoblots of phosphorylated (pSrc), total Src and actin protein levels evaluated in cell lysates from MC38 cells either treated with spermidine or left untreated for 15 and 30 min.
Figure with the uncropped blots with relevant bands clearly labeled are provided.

Figure 1.

Figure 1—figure supplement 1. Spermidine does not compete with ATP and does not potentiate the constitutive active Src.

Figure 1—figure supplement 1.

(A) Enzymatic activity of recombinant human Src in the presence of fixed concentration of spermidine and increasing concentration of ATP. Vmax and Km were calculated after fitting the kinase activity data to the Michaelis–Menten equation and reported in the table. Data are reported as mean ± standard deviation (SD) of three independent experiments, each performed in triplicates, and were analyzed with one-way analysis of variance (ANOVA) followed by post hoc Bonferroni test. (B) Immunoblot analysis of phosphorylated (pSrc) and total Src protein level in cell lysates from SYF cells either reconstituted with vector coding for wild-type Src (WT) or Src mutated at tyrosine 529 with phenilalanine (Y529F). Cells were then exposed to spermidine at the indicated concentrations. β-Tubulin expression was used as normalizer. One representative immunoblot of three is shown.
Figure 1—figure supplement 1—source data 1. Original immunoblots of phosphorylated, total Src and β-tubulin protein levels in lysates from SYF cells either reconstituted with vector coding for wild-type Src or Src mutated at tyrosine 529 with phenylalanine and then exposed to spermidine .
Figure with the uncropped blots with relevant bands clearly labeled are provided.
Open in a new tab

To get insights into the mechanism of action of spermidine, we measured the intrinsic activity of the polyamine in the absence of either ATP or the synthetic peptide. Results showed that spermidine did not activate Src in the absence of either ATP or peptide (Figure 1E), while it promoted the production of ADP when the substrate is also present, ruling out any competition for the same site. As this profile was compatible with an allosteric modulation, we incubated rhSrc with different concentration of ATP or peptide. In the presence of fixed amount of spermidine and increasing concentration of the peptide, the maximum rate of Src kinase activity (Vmax) and the affinity (Km) for the substrate increase (Figure 1F). On the contrary, in the presence of different concentration of ATP, spermidine did not affect neither the efficacy nor the affinity of Src kinase (Figure 1—figure supplement 1). Such a kinetic profile is consistent with a non-ATP competition, suggesting that spermidine allosterically activates the kinase activity of Src. On measuring the spermidine effect on constitutive active Src, we resorted to the SYF cells model expressing the Src carrying a tyrosine to phenylalanine mutation at position 529 of the murine sequence (here, Src Y529F). Results demonstrated that the polyamine is not able to activate Src Y529F as measured by its phosphorylation (Figure 1—figure supplement 1), suggesting that spermidine per se cannot activate or stabilize the constitutive active form of Src, instead it might promote the conformational changes of the kinase and thus its activation.

Spermidine binds to a negatively charged pocket in SH2 domain of Src kinase

In the inactive state, Src assumes a closed conformation with the SH3 domain bound to the SH2-kinase linker and the SH2 domain bound to the tyrosine phosphorylated tail (Figure 2A). Using the experimental available structure of single SH2 domain (PDB ID: 2JYQ; viral isoform), we characterized key structural and electrostatic elements involved in ligand/protein recognition using electrostatic potential calculations (Figure 2B). A positive electrostatic potential was observed in the region of the pY-binding site (R178 and H204 residues according to sequence numbering of human isoform, Figure 2B), whereas a stretch of surface endowed with a strong negative electrostatic potential was observed on the backside of the pY-binding site as delimited by glutamate residues E150 and E169 (Figure 2B), suggesting the existence of a putative allosteric site. Of note, by the alignment of amino acid sequences, we identified that such residues were conserved in Src protein of human, murine and viral isoforms (Figure 2—figure supplement 1), further supporting potential functional role for this allosteric site.

Figure 2. Spermidine binds to an allosteric site located in the SH2 domain of Src kinase.

(A) Schematic representation of the murine Src domains and kinase activation. The catalytic activation of the enzyme is characterized by the phosphorylation of the Y418 (pY418) in the activation loop. Created with BioRender.com. (B) Electrostatic potential surface of the Src SH2 domain showing the pY-binding site (R178 and H204) and the putative allosteric site for the endogenous polyamine as delimited by the glutamate residues (E150 and E169). Residues are labeled according to sequence numbering of the human isoform: R178, H204, E150, and E169 correspond to R32, H58, E4, and E23 of the NMR structure of the viral isoform, respectively. (C) Overlay of docking solutions of spermidine into the shallow cavity of Src kinase (poses #1–18, Supplementary file 1). Induced-fit conformations of side chains of residues shaping the cavity are shown with gray carbon-atoms according to each docking solution. Conformations of spermidine according to each docking solution are shown with green carbon-atoms. The Src SH2 domain is shown with magenta cartoon depicting the secondary structure. Residues are labeled according to sequence numbering of the human isoform. E150 and E169 residues are shown with magenta carbon-atoms. (D) Best energy-scored solution of the binding mode of spermidine into the allosteric pocket of Src (pose #1, Supplementary file 1). E149 and E168 are shown with magenta carbon-atoms. Interacting residues and spermidine are shown with gray and green carbon-atoms, respectively. Hydrogen bond interactions are shown with yellow dashed lines, while the π-cation interaction is reported with green dashed line. (E) Immunoblot analysis of phosphorylated (pSrc) and total Src protein level in cell lysates from SYF cells either reconstituted with vector coding for wild-type Src (WT) or Src mutated at glutamate 149 or 168 with alanine (E149A and E168A). Cells were then exposed to spermidine (100 μM). β-Actin expression was used as normalizer. pSrc/Src ratio is calculated by densitometric quantification of the specific bands and is reported as fold change against the corresponding untreated cells. Data were analyzed with one-way analysis of variance (ANOVA) followed by post hoc Bonferroni test, by comparing the mean of spermidine-treated samples to the untreated counterpart. *p < 0.05. (F) Activation of Src kinase in SYF cells treated with increasing concentration of spermidine (400 nM to 100 μM) and measured as pSrc/Src ratio of scanning densitometry analysis of three independent immunoblots. Results (mean ± standard deviation [SD]) are reported as fold change of samples treated with spermidine relative to untreated cells (fold change = 1, dotted line). (G) Schematic representation of the reporter functions. In the presence of active Src kinase, the phosphorylation of Src peptide results in its intramolecular interaction with the SH2 domain that prevents the complementation of split-luciferase fragments and generates a reduced bioluminescence activity. In the absence of Src activation, the N- and C-terminal luciferase domains are reconstituted and thus the bioluminescent activity is restored. (H) Measurement of luminescent signal in SYF cells co-expressing the reporter and the wild-type Src or its mutants (E149A and E168A), and then exposed to spermidine (10 and 100 µM). Results (mean ± SD of three independent experiments) are reported as fold change of bioluminescent signal in stimulated cells as compared to their respective untreated samples. Data (F, H) were analyzed with two-way ANOVA followed by post hoc Bonferroni test. *p < 0.05, **p < 0.01, ***p < 0.001.

Figure 2—source data 1. Original immunoblots of phosphorylated (pSrc), total Src and actin protein level evaluated in cell lysates from SYF cells either reconstituted with vector coding for wild-type Src (WT) or Src mutated at glutamate 149 or 168 with alanine.
Cells were either treated with spermidine (100 µM) or left untreated. Figure with the uncropped blots with relevant bands clearly labeled are provided.

Figure 2.

Figure 2—figure supplement 1. The glutamate residues E149 and E168 are conserved across different species.

Figure 2—figure supplement 1.

Alignment of the amino acid sequences of human, murine, and viral (2JYQ_1) Src. Conserved glutamate residues are highlighted in red.
Figure 2—figure supplement 2. Efficient reconstitution of SYF cells with vectors coding for Src kinase.

Figure 2—figure supplement 2.

(A) Immunoblot analysis of phosphorylated (pSrc) and total Src protein level in cell lysates from SYF cells either reconstituted with vector coding for wild-type Src (WT) or Src mutated at glutamate 149 or 168 with alanine (E149A and E168A). SYF cells transfected with empty vector (SYF) were used as control. β-Actin expression was used as normalizer. (B) Immunoblot analysis of phosphorylated (pSrc) and total Src protein level in cell lysates from SYF cells either reconstituted with vector coding for wild-type Src (WT) or Src mutated at glutamate 149 or 168 with alanine (E149A and E168A). Cells were then exposed to lysophosphatidic acid (LPA; 20 μM) for the indicated time. β-Actin expression was used as normalizer. One representative immunoblot of four is shown. (C) pSrc/Src ratio of scanning densitometry analysis of four independent experiments (mean ± standard deviation [SD]) expressed as fold change relative to the untreated counterparts (fold change = 1). Data were analyzed by one-way analysis of variance (ANOVA) followed by post hoc Bonferroni’s test. *p < 0.05, **p < 0.001.
Figure 2—figure supplement 2—source data 1. Original immunoblots of phosphorylated (pSrc), total Src and actin protein levels in cell lysates from SYF cells either reconstituted with vector coding for wild-type Src (WT) or Src mutated at glutamate 149 or 168 with alanine.
SYF cells transfected with empty vector (SYF) were used as control. Figure with the uncropped blots with relevant bands clearly labeled are provided.
Figure 2—figure supplement 2—source data 2. Original immunoblots of phosphorylated, total Src and actin protein levels in lysates from SYF cells either reconstituted with vector coding for wild-type Src or Src mutated at glutamate 149 or 168 with alanine.
Figure with the uncropped blots with relevant bands clearly labeled are provided.
Open in a new tab

A docking study was carried out to investigate the binding mode of spermidine into the allosteric site of Src SH2 domain. As a result, n.18 solutions were obtained showing a conserved binding mode located in a shallow cavity close to E150 and shaped by A148, F153, and T250 (sequence numbering of human isoform, Figure 2C). According to the top scored solution (Supplementary file 1; Figure 2D), the first primary amine group interacts by an electrostatic enforced hydrogen bond with E150, the secondary amine group forms electrostatic enforced hydrogen bond with E150 and the carbonyl group of T250, the other primary amine group makes hydrogen bonds with the side chain of E150 and the carbonyl group of A148 while engaging the aromatic ring of F153 through a specific π-cation interaction (Macchiarulo et al., 2009).

To experimentally confirm the proposed spermidine-binding site, we resorted to mutagenesis experiments by substituting the residues E150 or E169, corresponding to E149 and E168 of murine Src sequence into alanine (E149A and E168A). SYF cells were thus stably transfected with vectors coding for the mutated Src (i.e., Src E149A and Src E168A) and wild-type Src (WT) (Figure 2—figure supplement 2). To validate the functional equivalence of Src mutants, cells were exposed to lysophosphatidic acid (LPA), a stimulus known to activate Src kinase downstream the LPA2 receptor in SYF cells (Lai et al., 2005). Results indicated that Src activity is induced by LPA as measured by the phosphorylation of the Y418, independently of the mutation at the putative allosteric site (Figure 2—figure supplement 2). On evaluating the activation of Src by spermidine, we found that the mutation of the glutamate residues abrogated the kinase activation (Figure 2E, F). The split-luciferase fragment complementation assay confirmed that E149 and E168 are key anchoring points for spermidine binding. Specifically, SYF cells expressing Src WT or mutant were stably transfected with a bioluminescent reporter that contains the SH2 domain and the Src consensus substrate peptide between the amino-(Nluc) and carboxyl-(Cluc) terminal domains of the Firefly luciferase molecule (Figure 2G; Niu and Chen, 2012). When the endogenous Src is active, the tyrosine residue of the consensus peptide is phosphorylated and interact with the docking pocket of the SH2 domain. This creates a steric hindrance that prevents the reconstitution of a functional luciferase, resulting in a reduction of bioluminescent signal (Figure 2G). Cells co-expressing Src and the reporter were thus exposed to spermidine and the luminescent signal was measured. Results demonstrated that the bioluminescence decreased when spermidine is applied only in cells ectopically expressing wild-type Src (Figure 2H). Of note, in the absence of spermidine, cells – those reconstituted with the reporter and the different mutants of Src – did not generate statistically different luminescent signal (617.7 ± 121 vs 552.2 ± 68.9 vs 501 ± 110, WT Src vs E149A vs E168A, respectively). This suggests that the basal activity of the kinase is not affected by the specific amino acid substitution.

Overall, these data suggested the presence of a previously unknown allosteric site on the backside of Src SH2 domain as defined by the glutamate residues at positions 150 and 169 of the human sequence. Spermidine, by means of ionic and hydrogen bond interactions between its protonated amino groups and residues of the shallow anionic site on the SH2 domain, directly associates with and activates Src kinase. It is worth noting that no direct interaction was observed between spermidine and E169 in the docking study. This may be ascribed to the limit of the scoring function in identifying a binding mode engaging E169 among resulting solutions, or to an indirect role of such residue in promoting long-range electrostatic interactions to accomplish the molecular recognition of the cognate ligand into the allosteric site. Moreover, the alignment of murine Src, Yes, and Fyn sequences highlighted that only the glutamate residue at position 149 of murine Src is conserved across SH2 domains, while the glutamate residue at position 168 is replaced by the amino acid glycine (data not shown). Thus, although we cannot exclude that spermidine can bind the SH2 domain of related Src kinases, we might speculate that the lack of the negative charge at position 168 reduces the long-range electrostatic interactions that we hypothesized to be responsible for the molecular recognition of the ligand into the allosteric site.

Spermidine promotes the Src-dependent tyrosine phosphorylation of IDO1 and their interaction

Among the proteins phosphorylated by Src, the immunometabolic enzyme IDO1 is worthy of note (Mondanelli et al., 2017; Manni et al., 2020). Indeed, aside metabolizing the amino acid tryptophan, IDO1 is endowed with non-enzymatic properties (Mondanelli et al., 2020a; Albini et al., 2017; Pallotta et al., 2011; Orabona et al., 2012; Orecchini et al., 2023; Albini et al., 2018). The latter relies on the presence of two ITIMs (immunoreceptor-tyrosine-based inhibitory motif) that can be phosphorylated in response to immunomodulatory stimuli, such as TGF(transforming growth factor)-β, L-kynurenine, and spermidine (Mondanelli et al., 2017; Manni et al., 2020; Pallotta et al., 2011). However, the exact molecular mechanism and the role of spermidine have never been explored. To confirm that Src can phosphorylate IDO1, SYF cells were reconstituted with vectors coding for murine wild-type Src and IDO1, either alone or in combination, and then were exposed to spermidine. Results from immunoblot demonstrated that IDO1 phosphorylation increased when Src is co-expressed and activated by spermidine (Figure 3A). In addition, we found that in the presence of a constitutive active Src (i.e., Src Y529F) IDO1 phosphorylation increases regardless of the stimulation with spermidine (Figure 3—figure supplement 1). This suggests that spermidine can act as an on/off switcher of the kinase, without potentiating the constitutively active protein.

Figure 3. Spermidine triggers the phosphorylation of indoleamine 2,3-dioxygenase 1 (IDO1) by Src kinase and the complex formation.

(A) Immunoprecipitation with anti-phosphotyrosine antibody from SYF cells reconstituted with vectors coding for Src and IDO1 and then treated with spermidine (100 μM) for 60 min. Cells transfected with vectors coding for either Src or IDO1 were used as control, while immunoprecipitation without antibody was included as negative control (n.c.). The detection of IDO1, Src, and β-tubulin was performed by sequential immunoblotting with specific antibodies. Whole-cell lysates (WCL) was used as control of protein expression. One representative immunoblot of three is shown. The amount of IDO1 precipitated is measured by densitometric quantification of the specific bands in treated sample co-expressing IDO1 and Src and is reported relative to untreated cells (fold change = 1). Data (mean of three experiments) were analyzed with unpaired Student’s t-test. *p < 0.05. (B) Continuous in vitro kinase assay with rhIDO1 (300 ng) and rhSrc (50 ng) followed by immunoblot analysis with anti-phosphotyrosine and anti-IDO1 specific antibodies. The reaction was carried out for the indicated time, in either the presence or absence of spermidine. One representative immunoblot of three is shown. (C) pTYR/IDO1 signals were calculated by densitometric quantification of the specific bands. Data were plotted over incubation time of the kinase reaction and the slopes (relative velocity) of linear fits were calculated. Results (mean ± standard deviation [SD]) were analyzed with two-way analysis of variance (ANOVA) followed by post hoc Bonferroni test and by comparing, for each time point, the pTYR/IDO1 ratio of spermidine-treated sample to the untreated counterpart. (D) The relative velocity of the kinase reaction in either the presence or absence of spermidine from three independent experiments is shown. Data (mean ± SD) were analyzed with unpaired Student’s t-test. ***p < 0.001. (E) Immunoprecipitation of Src from SYF cells reconstituted with Src and IDO1, and then treated as in (A). The detection of IDO1, Src, and β-tubulin was performed by sequential immunoblotting with specific antibodies. Immunoprecipitation without antibody was included as negative control (n.c.). Whole-cell lysates (WCL) was used as control of protein expression. One representative immunoblot of three is shown. IDO1/Src ratio is calculated by densitometric quantification of the specific bands and is reported as fold change against untreated cells. Data (mean of three independent experiments) were analyzed with unpaired Student’s t-test. *p < 0.05. (F) The in situ proximity ligation assay between IDO1 and Src in SYF cells reconstituted with wild-type Src or the mutant forms and treated as in (A). Red spots indicate a single IDO1/Src interaction; scale bars, 10 µm. One representative experiment of three is shown. (G) Quantification of the interactions detected by proximity ligation assay using ImageJ. Results are reported as function of the number of cells. Data (mean ± SD) were analyzed with one-way ANOVA followed by post hoc Bonferroni test. *p < 0.05, **p < 0.01. (H) Immunoprecipitation with anti-phosphotyrosine antibody from MC38 cells either treated with spermidine (20 μM) for 60 min or left untreated. Immunoprecipitation without antibody was included as negative control (n.c.). The detection of IDO1, Src, and β-actin was performed by sequential immunoblotting with specific antibodies. Whole-cell lysates (WCL) was used as control of protein expression. One representative immunoblot of three is shown. The amount of IDO1 precipitated is measured by densitometric quantification of the specific band and is expressed relative to untreated cells (fold change = 1). Data (mean of three independent experiments) were analyzed with unpaired Student’s t-test. **p < 0.01. (I) Immunoprecipitation of Src from MC38 cells treated as in (H). The detection of IDO1, Src, and β-tubulin was performed by sequential immunoblotting with specific antibodies. Whole-cell lysates (WCL) was used as control of protein expression. One representative immunoblot of three is shown. IDO1/Src ratio is calculated by densitometric quantification of the specific bands and is reported as fold change against untreated cells (fold change = 1). Data (mean of three independent experiments) were analyzed with unpaired Student’s t-test. *p < 0.05.

Figure 3—source data 1. Original immunoblots of immunoprecipitation with anti-phosphotyrosine antibody (IP) followed by the detection of indoleamine 2,3-dioxygenase 1 (IDO1) with specific antibodies.
Whole-cell lysates (PRE-IP) was used as control of protein expression of IDO1, Src, and β-tubulin. SYF cells reconstituted with vectors coding for Src and IDO1 and then treated with spermidine (100 μM) for 60 min as well as cells transfected with vectors coding for either Src or IDO1 were used for the experiments. The negative control (i.e., the sample expressing both IDO1 and Src, but not immunoprecipitated with the antibody) is included. Figure with the uncropped blots with relevant bands clearly labeled are provided.
Figure 3—source data 2. Original immunoblots of in vitro kinase assay with rhIDO1 (300 ng) and rhSrc (50 ng) followed by immunoblot analysis with anti-phosphotyrosine and anti-IDO1 specific antibodies.
The reaction was in either the presence or absence of spermidine. Figure with the uncropped blots with relevant bands clearly labeled are provided.
Figure 3—source data 3. Original immunoblots of immunoprecipitation with anti-phosphotyrosine antibody (IP) followed by the detection of indoleamine 2,3-dioxygenase 1 (IDO1) with specific antibodies.
Whole-cell lysates (PRE-IP) of MC38 cells was used as control of protein expression of IDO1, Src, and β-actin. The negative control (i.e., sample not immunoprecipitated with the antibody) is included. Figure with the uncropped blots with relevant bands clearly labeled are provided.
Figure 3—source data 4. Original immunoblots of immunoprecipitation of Src from MC38 cells treated with spermidine or left untreated.
The detection of indoleamine 2,3-dioxygenase 1 (IDO1) and Src was performed by sequential immunoblotting with specific antibodies (IP). Whole-cell lysates (PRE-IP) was used as control of protein expression. The negative control (i.e., sample not immunoprecipitated with the antibody) is included. Figure with the uncropped blots with relevant bands clearly labeled are provided.
Figure 3—source data 5. Original immunoblots of immunoprecipitation of Src from MC38 cells treated with spermidine or left untreated.
The detection of indoleamine 2,3-dioxygenase 1 (IDO1) and Src was performed by sequential immunoblotting with specific antibodies (IP). Whole-cell lysates (PRE-IP) was used as control of protein expression. The negative control (i.e., sample not immunoprecipitated with the antibody) is included. Figure with the uncropped blots with relevant bands clearly labeled are provided.

Figure 3.

Figure 3—figure supplement 1. Spermidine does not promote the phosphorylation of indoleamine 2,3-dioxygenase 1 (IDO1) via constitutive active Src.

Figure 3—figure supplement 1.

Immunoprecipitation with anti-phosphotyrosine antibody from SYF cells reconstituted with vectors coding for Src (WT or Y529F) and IDO1, and then treated with spermidine (100 µM) for 60 min. Immunoprecipitation without antibody was included as negative control (n.c.). Cells transfected with vectors coding for either Src (WT or Y529F) or IDO1 were used as control. The detection of IDO1, Src, and β-tubulin was performed by sequential immunoblotting with specific antibodies. Whole-cell lysates (WCL) was used as control of protein expression. One representative immunoblot of three is shown. The amount of IDO1 immunoprecipitated is measured by densitometric quantification of the specific bands and is expressed relative to the respective untreated cells (fold change = 1). Data (mean of three experiments) were analyzed with one-way analysis of variance (ANOVA). *p < 0.05.
Figure 3—figure supplement 1—source data 1. Original immunoblots of immunoprecipitation with anti-phosphotyrosine antibody (IP) followed by the detection of indoleamine 2,3-dioxygenase 1 (IDO1) with specific antibodies.
Whole-cell lysates (PRE-IP) was used as control of protein expression of IDO1, Src, and β-tubulin. SYF cells were reconstituted with vectors coding for wild-type Src and IDO1 or Src mutated at tyrosine 529 with phenylalanine and IDO1. Moreover, cells transfected with vectors coding for either Src or IDO1 were used for the experiments. The negative control (i.e., sample expressing both IDO1 and Src, but not immunoprecipitated with the antibody) is included. Cells were either treated with spermidine (100 μM) or left untreated. Figure with the uncropped blots with relevant bands clearly labeled are provided.
Open in a new tab

To further confirm that spermidine could promote the IDO1 phosphorylation by accelerating the reaction velocity, an in vitro kinase assay was performed using purified human Src and IDO1 proteins. By detecting phosphotyrosine residues with a specific antibody, we found that IDO1 was phosphorylated in a time-dependent manner (Figure 3B, C). Moreover, in the presence of spermidine, Src quicker phosphorylated IDO1, as demonstrated by the twofold increase of the relative velocity (Figure 3D). To figure out whether the IDO1 phosphorylation was a direct effect through physical interaction with Src, SYF cells reconstituted with murine wild-type Src and IDO1 were exposed to spermidine for different length of time. Co-immunoprecipitation followed by immunoblot studies demonstrated that when cells were treated with spermidine for 60 min, IDO1 was found in a complex with Src (Figure 3E). Of note, among the predicted functional partners of murine Src, we verified additional substrates (i.e., Stat3) and we found that the spermidine effect is specific to the IDO1–Src complex (data not shown). The specific IDO1–Src interaction was confirmed in situ by the proximity ligation assay (Figure 3F, G). Accordingly, spermidine treatment induced the Src-IDO1 interaction in SYF cells reconstituted with wild-type Src, but not with the E149A or E168A mutant form of the kinase (Figure 3F, G). To prove a physiological relevance of this interaction, the spermidine effect was also evaluated in MC38 cells endogenously expressing the proteins IDO1 and Src. Results demonstrated that when MC38 cells are exposed to spermidine, the phosphorylation of IDO1 increased (Figure 3H) as well as the IDO1/Src interaction (Figure 3I).

As a whole, these results suggested that spermidine not only accelerates the Src-mediated phosphorylation of IDO1, but also promotes the formation of Src–IDO1 complex.

Discussion

The non-receptor tyrosine kinase Src is the representative of a family of structure-related enzymes involved in several signaling pathways regulating key cellular processes as well as immune responses (Caner et al., 2021; Liu et al., 2013). Much relevant literature correlates dysregulated Src kinase activity with cancer and thus extensive efforts have been made to develop small molecules kinase inhibitors. Currently, approved kinase inhibitors are compounds that reversibly bind the catalytic site and thus compete with the ligand (i.e., ATP) (Roskoski, 2015). As the ATP-binding cleft is structurally well conserved among kinases, these inhibitors are poorly selective. Moreover, their chronic usage is frequently associated with acquired drug resistance that ultimately limits patients’ compliance and the therapeutic success. For instance, the FDA-approved Dasatinib and Bosutinib inhibit more than 30 kinases, and thus are not suitable for probing Src-dependent pharmacology (Ozanne et al., 2015). Saracatinib is another example of small molecule that interacts with the ATP-binding pocket. Although more selective than Dasatinib, it potently inhibits EGF-R as well (Formisano et al., 2015). In addition to competitive Src inhibitors, an emerging pharmacological modality – known as targeted covalent inhibitors – has been pursued at the preclinical level for blocking Src kinase activity (Gurbani et al., 2020). However, the promiscuity of molecules interacting with the ATP pocket has moved the interest toward the development of alternative strategies for more effective and less-toxic inhibitors.

The peculiarity of the Src protein, as well as of other tyrosine kinases, is its structural plasticity, that is, the capability to adopt distinct conformations due to intrinsic dynamic properties (Engen et al., 2008). The activation state of this protein kinase is indeed dictated by dynamic intramolecular interactions between the SH3, SH2, and kinase domains. The SH2 domain plays a key role in both autoregulating Src kinase activity and in recruiting the protein ligand. Specifically, the tyrosine residue at position +530, when phosphorylated, interacts with the SH2 domain and stabilizes a restrained catalytically inactive conformation of Src (Shah et al., 2018). Accordingly, binding of ligand proteins to the SH2 domain displaces intramolecular contacts and promotes the catalytic activation of the Src kinase. This activating event is mostly driven by a dynamic breakage and formation of electrostatic interactions that involve salt bridges and hydrogen bonds. Guided by the dynamic nature of the kinase, allosteric modulation has been proposed as pharmacological approach to target the activity of Src kinase. Allosteric molecules do not possess intrinsic efficacy, but instead modulate – either positively or negatively – the activity of orthosteric agonists. Moreover, being less conserved among kinases, the allosteric hotspots ensure greater drug selectivity. Targetable allosteric pockets have been identified for few kinases as reported for Hck, Lyn, Aurora A kinase, and Bcr-Abl (Dorman et al., 2019; Zhang et al., 2010; Saporito et al., 2012; Panicker et al., 2019). In addition, modulators of the SH2 and SH3 domains – either peptidomimetics or small molecules – have been developed as chemical tools modifying the conformation and thus both the enzymatic and non-enzymatic functions of Src, the latter including protein–protein interactions and intracellular localization (Moroco et al., 2015; Moroco et al., 2014; Saporito et al., 2012; Leonard et al., 2014; Fischer et al., 2015).

Metabolites are chemicals that do not merely take place in the metabolic reactions, but are also involved in inter- and intracellular communications, energy production, macromolecule synthesis, post-translational modifications, and cell survival (Gargaro et al., 2022; Makowski et al., 2020; Icard et al., 2019; Diskin et al., 2021; Mondanelli and Volpi, 2021; Mondanelli and Volpi, 2020). In accordance, the enzymes responsible for their production are considered central regulators of the function of cells, including immune cells (Giovanelli et al., 2019; Grohmann et al., 2017; Sun et al., 2022; Mandarano et al., 2020; Bonometti et al., 2023). IDO1 is the prototype of such metabolic enzymes acting at the forefront of immune responses. Thanks to its catalytic activity as well as non-enzymatic function (relying on the phosphorylation of its ITIMs), IDO1 is a tiebreaker of tolerance and immunity (Grohmann et al., 2017; Mondanelli et al., 2019; Iacono et al., 2020). Prompted by the finding that spermidine (i.e., a natural occurring polyamine) can reprogram murine cDCs toward an immunoregulatory phenotype via the Src kinase-dependent induction of the IDO1 signaling (Mondanelli et al., 2017), we here demonstrated that the polyamine behaves as a positive allosteric modulator of Src by increasing the maximum rate of enzyme activity. Indeed, electrostatic potential calculation studies on the SH2 domain identified a surface endowed with a negative electrostatic potential on the back side of the pY-binding site, as delimited by glutamate residues E149 and E168. By its protonated amino groups, spermidine interacts with the anionic head of E149 on the SH2 domain, directly associates with and activates Src kinase. As a matter of the fact, the site-directed mutagenesis of the glutamate residues with uncharged amino acids abrogates the spermidine-mediated activation of Src kinase. On note, by aligning murine Src with several SH2 domain proteins (Liu et al., 2011) such as enzymes (Abl1, SHIP1), docking (Shc1), and adaptor (Grb2, SOCS1) proteins, we found that neither E149 nor E168 are conserved, in their place there are non-polar hydrophobic amino acids (e.g., alanine, glycine, and proline) or those with polar uncharged side chains (e.g., glutamine) (data not shown). These would suggest that spermidine cannot broadly bind SH2-domain containing proteins and that the polyamine selectively affects the Src kinase activity. It is noteworthy of mention that polyamines are not new in the field of allosteric modulation, as they modify the activity of ionotropic N-methyl-D-aspartate receptor (NMDAR, a receptor for glutamate) by both increasing the affinity of NMDAR for the co-agonist glycine and relieving the tonic proton inhibition of the receptor (Hirose et al., 2015), further supporting the spermidine mode of action. Polyamines are usually considered as a family of molecules with similar functions; however, different polyamines may have distinct, sometimes opposite, roles as in inflammatory- and age-related pathologies, (Minois et al., 2011). Concordantly, they have a different regulatory capacity on Src. For instance, putrescine and spermidine, but not spermine, promote the phosphorylation of Src in tumor cells (Hölttä et al., 1993), while spermine negatively modulates the activity of the kinase in intestinal epithelial cells (Ray et al., 2012). In cDCs, putrescine and spermidine, but not spermine, increased Src phosphorylation and when compared the IDO1-inducing ability of polyamines, the induction of the IDO1 protein could be observed only for spermidine-treated cells (Mondanelli et al., 2017).

Besides confirming that Src phosphorylates IDO1, and that the polyamine accelerates the enzyme kinetic, here we showed that spermidine promotes the interaction of Src with IDO1 protein (Figure 4). Our data provided evidence that an endogenous metabolite, when present at specific concentrations, can directly activate Src kinase without requiring a membrane receptor. By acting on the backside of the SH2 domain, that is the domain responsible for the substrate binding, spermidine not only modulates the catalytic activity, but also affects the scaffold function of Src in organizing transducing signaling complexes – as those with IDO1 – which could be relevant in many diseases. Thus, from a therapeutic perspective, our results provide the proof of principle for the development of molecules that can modulate the kinase activity and the non-enzymatic functions of Src and IDO1 at once.

Figure 4. Scheme of the Src kinase modulation by the polyamine spermidine.

Figure 4.

Open in a new tab

Created with BioRender.com.

Materials and methods

Cell lines and reagents

SYF cells that is fibroblast null for Src, Fyn, and Yes kinases (Klinghoffer et al., 1999); RRID:CVCL_6461 were grown in DMEM(Dulbecco’s Modified Eagle Medium) supplemented with 10% FCS(fetal calf serum), at 37°C, in a humidified 5% CO2 incubator. SYF cells were purchased by ATCC (# CRL-2459). MC38 cells were kindly provided by Stefano Ugel (University of Verona, Italy) and were cultured as indicated for SYF cells. Both cell lines were tested to confirm the absence of mycoplasma contamination by N-GRADE Mycolpasma PCR Reagent set (#EMK090020). Spermidine, LPA, and recombinant Src protein were purchased from Sigma-Aldrich, while recombinant human IDO1 protein was obtained by Giotto Biotech. Construct (pCMV6-Entry) expressing murine Src was obtained from Origene (MR227248). Src was then subcloned into pEF.bos plasmid by using degenerate primers bearing the unique restriction site (namely Kpn I and Not I). Src mutants were generated by PCR(Polymerase chain reaction)-based site-directed mutagenesis performed with overlap extension that involved mutagenic primers (Table 1) in two independent PCRs before combining them in the final PCR (Reikofski and Tao, 1992; Ho et al., 1989). The resulting PCR products were digested with appropriate restriction enzymes and cloned into pEF-BOS plasmid.

Table 1. Primers for site-directed mutagenesis of Src.

Primer Sequence
Src E149A, Forward atccaggctgaggcgtggtacttt
Src E149A, Reverse aaagtaccacgcctcagcctggat
Src E168A, Forward ctcaacgccgcgaacccgaga
Src E168A, Reverse tctcgggttcgcggcgttgag
Src Y529F, Forward gagccacagttccagcccgg
Src Y529F, Reverse ccgggctggaactgtggctc
Open in a new tab

Cell transfection and treatment

SYF cells (0.3 millions/ml in 6-well plate) were plated the day before and were transfected with 2 µg of the vectors expressing either wild-type Src or Src mutants according to the Lipofectamine 3000 protocol (Thermo Fisher Scientific). Stable transfectants were obtained by antibiotic selection (2.5 µg/ml) of SYF cells transfected with pEF-BOS-based vectors carrying the puromycin resistant genes. SYF and MC38 cells were serum starved overnight before spermidine treatment. Cells were incubated with the polyamine or LPA for 60 min for immunoblot analysis, as otherwise indicated. These conditions were selected based upon optimization experiments.

Split-luciferase fragment complementation assay

The N and C fragments of luciferase were amplified by PCR from pGL3-Basic. The fragment including nucleotide sequences of SH2 domain of murine Src (aa 374–465), linker (SRGGSTSGSGKPGSGEGSG), and Src consensus substrate peptide (WMEDYDYVHLQG), was synthesized by sequential reactions of PCR amplification. This cassette and the luciferase fragments were cloned into pCDNA 3.1 vector.

SYF cells stably expressing the reporter were transfected with wild-type Src and Src E149A or Src E168A and then cultured into 96-well plate, in serum-free medium. After treatment with spermidine for 2 hr, cells were washed with PBS1X and lysed with PLB-lysis buffer. Luciferase activity was measured with the Luciferase Reporter Assay Kit (Promega).

Immunoblot and co-immunoprecipitation studies

For immunoblotting, proteins were extracted in M-PER buffer (Thermo Fisher Scientific) supplemented with phosphatases and proteases inhibitors cocktails (Thermo Fisher Scientific) and run on sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS/PAGE). The pSrc/Src ratio was assessed with a rabbit Phospho-Src Family (Tyr416) Antibody (#2101, Cell Signaling Technology, Danvers, MA, USA; RRID:AB_331697), recognizing the phosphorylation at tyrosine 418 in murine Src, followed by the detection of total Src by rabbit monoclonal antibody (36D10, Cell Signaling Technology, Danvers, MA, USA; RRID:AB_2106059), as previously shown (Manni et al., 2020). Mouse monoclonal antibody against β-actin (Sigma-Aldrich; RRID:AB_262137) was used as normalizer.

Co-immunoprecipitation appraises were performed following the manufacturer’s protocol (Thermo Fisher) and as previously shown (Gargaro et al., 2022). Briefly, lysates were incubated overnight at 4°C with Dynabeads Protein G, prepared by blocking 12.5 µl of magnetic beads with PBS1X containing 0.5% bovine serum albumin (wt/vol) and bound to 2.5 µg of rabbit anti-Src (36D10) or MultiMab Rabbit Phospho-Tyrosine (P-Tyr-1000; RRID:AB_2687925) antibody. After washing with buffer (25 mM citric acid, 50 mM Dibasic Sodium Phosphate dodecahydrate pH 5), the immuno-complex was eluted with Elution buffer (0.1 M Sodium Citrate dihydate pH 2–3) and Laemmli buffer. Proteins were run on SDS–PAGE and the expression of IDO1 and Src were analyzed with a mouse anti-IDO1 antibody (clone 8G-11, Merck) and a rabbit anti-Src monoclonal antibody (36D10). Mouse monoclonal Ab against β-tubulin (Sigma-Aldrich; RRID:AB_2827403) was used as normalizer. Protein expression was measured by using Image Lab software (Bio-Rad) and the densitometric analysis of the specific signals was performed as previously described (Mondanelli et al., 2020a).

Biochemical assay

For the in vitro cell-free assay, 5 ng of recombinant hSrc were combined with 10 μM of ATP and 100 μM of synthetic peptide (KVEKIGEGTYGVVYK) corresponding to amino acids 6–20 of p34cdc2. The reaction was carried out in a buffer containing 100 mM of Tris–HCl (pH 7.2), 125 mM of MgCl2, 25 mM of MnCl2, 250 μM of Na3VO2, and 2 mM of DTT(dithiothreitol). The mixture was incubated at 25°C for 30 min and the production of ADP was measured using the ADP-Glo kinase assay kit (Promega). Vmax was calculated after fitting the kinase activity data to the Michaelis–Menten equation. For the continuous in vitro assay, 50 ng of recombinant hSrc were incubated in the assay buffer with 300 ng of recombinant hIDO1, 100 μM of ATP, with or without spermidine (50 nM). The reaction was carried out at 25°C for the indicated time and then stopped by the addition of Laemmli buffer. Samples were run on SDS/PAGE and analyzed for the expression of Phospho-Tyrosine and IDO1 using an anti-pTyr-1000 and anti-IDO1 (clone 10.1, Merck) antibodies, respectively.

Proximity ligation assay

SYF cells expressing WT Src or Src E149A or Src E168A were serum starved, stimulated with spermidine, fixed for 20 min with 4% PFA(Paraformaldehyde), permeabilized for 10 min with Triton-X 0.1% in PBS1X and then blocked. Duolink Proximity Ligation Assay (#DUO92008, Sigma-Aldrich) was performed according to the manufacturer’s protocol. Briefly, primary antibodies rabbit a-mouse Src (Thermo Fisher, 7G6M9) and mouse a-mouse IDO1 (clone 8G11, Merk) were conjugated with either PLUS (#DUO92009, Sigma-Aldrich) or MINUS (#DUO92010, Sigma-Aldrich) oligonucleotides to create proximity ligation assay probes. Samples were incubated overnight at 4°C and, subsequently, ligase solution was added for 30 min. The signal was amplified with amplification polymerase solution at 37°C for 100 min. Nuclei were counterstained with 4′,6′-diamidino-2-phenylindole (#DUO82040, Sigma-Aldrich). A total of seven images (on average of 60 cells) per samples were taken with a Nikon inverted microscope (×60 magnification) and analyzed with the software ImageJ.

Electrostatic potential calculation study and docking study

The NMR structure of the SH2 domain of Src kinase of Rous sarcoma virus (PDB ID: 2JYQ) (Taylor et al., 2008) was taken from the protein data bank (https://www.rcsb.org) (Berman et al., 2000). It should be mentioned that the SH2 domain of the viral Src kinase shares a high sequence identity (97%) with the relative SH2 domains of human and murine Src tyrosine kinase (Figure 2—figure supplement 1). Hence, it is possible to use the NMR structure of the viral isoform with very good approximation to infer about the electrostatic potential map of human SH2 domain and to investigate the putative binding site of spermidine. The use of the NMR structure of the single viral SH2 domain avoids the bias that a full-length structure of human Src kinase might bring into more time-consuming calculations due to considering multiple conformations between the regulatory and kinase domains of the enzyme (Figure 2A). Indeed, diverse conformations of Src may differently affect the electrostatic potential of the SH2 domain as well as potentially mask a putative binding site for spermidine. Atomic coordinates of the viral SH2 domain (PDB ID: 2JYQ) were processed using the program PDB2PQR (Dolinsky et al., 2007; Dolinsky et al., 2004). The Adaptive Poisson-Boltzmann Solver (APBS) was applied to calculate the electrostatic potential of SH2 domain and map it on the excluded solvent surface (Baker et al., 2001). Specifically, the PARSE force field was employed with default parameters including a solute dielectric value = 2, solvent dielectric value = 78.54, solvent probe radius = 1.4 Å, and temperature = 298.150°K. Two calculations were performed using cubic spline charge discretization and a grid dimension of 129 × 129 × 129 Å. The first run adopted a grid spacing of 0.574 × 0.557 × 0.509 Å, for a grid length of 73.433 × 71.279 × 65.163 Å centered at points 2.638 (x), 0.458 (y), and 0.467 (z). The second run used a grid spacing of 0.494 × 0.484 × 0.456 Å for a grid length of 63.196 × 61.929 × 58.331 Å centered at the same point of the first run.

The chemical structure of spermidine was taken from PubChem compound (Kim et al., 2016). The structure was processed using LigPrep (Schrödinger Release 2021-3: LigPrep, LLC, New York, NY, 2021) and applying the default settings.

The structure of the SH2 domain of Src kinase (PDB ID: 2JYQ) was also processed for docking calculations employing the Protein Preparation Wizard (PPW) tool, as implemented in Maestro (Schrödinger Release 2021-3: Maestro, Schrödinger, LLC, New York, NY). In particular, hydrogen atoms were added and the internal geometries of the protein were optimized with a coordinate displacement restrain on heavy atoms set to 0.3 Å. The docking study was carried out defining a grid box for calculations centered on the center of mass of residues E4 and E23 (E150 and E169 according to sequence numbering of the human isoform; E149 and E168 according to sequence numbering of the murine isoform). The inner box was sized 10 × 10 × 10 Å. Since the allosteric site features a shallow surface, a ligand induced-fit approach was used to investigate the binding mode of spermidine. Accordingly, docking solutions were obtained using the induced-fit docking algorithm (Schrödinger Release 2021-3: Induced Fit Docking, Schrödinger, LLC, New York, NY, 2021) and the standard protocol to generate up to n.20 binding poses of spermidine into the allosteric site. During calculations, ligand and receptor van der Waals scaling factors were set to 0.5 kcal/mol, respectively. The side chain conformations of residues within 5 Å of the ligand-binding pose were sampled and refined using the OPLS 2005 force field. The structure of spermidine was then redocked with glide and standard precision scoring function into different obtained conformations of the allosteric site, using up to n.20 top energy conformations of the binding site within 30 kcal/mol of the minimum energy conformation.

Acknowledgements

This research was funded by University of Perugia, Ricerca di base 2019 (RBGMON19; to GM), Associazione Italiana per la Ricerca sul Cancro (AIRC 2019-23084; to CV), Italian Ministry of Education, University, and Research (PRIN 2020L45ZW; to CO), and University of Perugia, Ricerca di base 2020 (INTEGRATE; to AM).

Funding Statement

The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.

Contributor Information

Giada Mondanelli, Email: giada.mondanelli@unipg.it.

Volker Dötsch, Goethe University, Germany.

Volker Dötsch, Goethe University, Germany.

Funding Information

This paper was supported by the following grants:

  • Università degli Studi di Perugia Ricerca di base 2019 to Giada Mondanelli.

  • Associazione Italiana per la Ricerca sul Cancro AIRC 2019-23084 to Claudia Volpi.

  • Italian Ministry of Education, University, and Research PRIN 2020L45ZW to Ciriana Orabona.

  • Università degli Studi di Perugia Ricerca di base 2020 to Antonio Macchiarulo.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Methodology, Data curation.

Conceptualization, Methodology.

Methodology.

Methodology.

Methodology.

Methodology.

Methodology.

Supervision.

Supervision, Methodology.

Supervision.

Conceptualization, Methodology, Writing - original draft, Data curation.

Additional files

Supplementary file 1. Solutions of the docking study of spermidine into the allosteric site of Src SH2 domain using the structure of the viral isoform (PDB ID: 2JYQ).
elife-85872-supp1.docx (14.1KB, docx)
MDAR checklist

Data availability

All data generated or analyzed during this study are included in the manuscript and supporting file. Figure 1 - Source Data 1; Figure 1 - Source Data 2; Figure 1 - Figure supplement 1 - Source Data 1; Figure 2 - Source Data 1; Figure 2 - Figure supplement 2 - Source Data 1; Figure 2 - Figure supplement 2 - Source Data 2; Figure 3 - Source Data 1; Figure 3 - Source Data 2; Figure 3 - Source Data 3; Figure 3 - Source Data 14; Figure 3 - Source Data 5; Figure 3 - Figure supplement 1 - Source Data 1: contain the original blots used to generate the figures.

References

  1. Ahn K, Moon O Y, Ji YG, Cho HJ, Lee DH. Synergistic anti-cancer effects of AKT and SRC inhibition in human Pancreatic cancer cells. Yonsei Medical Journal. 2018;59:727–735. doi: 10.3349/ymj.2018.59.6.727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Albini E, Rosini V, Gargaro M, Mondanelli G, Belladonna ML, Pallotta MT, Volpi C, Fallarino F, Macchiarulo A, Antognelli C, Bianchi R, Vacca C, Puccetti P, Grohmann U, Orabona C. Distinct roles of Immunoreceptor tyrosine-based motifs in immunosuppressive Indoleamine 2,3-Dioxygenase 1. Journal of Cellular and Molecular Medicine. 2017;21:165–176. doi: 10.1111/jcmm.12954. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Albini E, Coletti A, Greco F, Pallotta MT, Mondanelli G, Gargaro M, Belladonna ML, Volpi C, Bianchi R, Grohmann U, Macchiarulo A, Orabona C. Identification of a 2-Propanol analogue Modulating the non-enzymatic function of Indoleamine 2,3-Dioxygenase 1. Biochemical Pharmacology. 2018;158:286–297. doi: 10.1016/j.bcp.2018.10.033. [DOI] [PubMed] [Google Scholar]
  4. Arias-Romero LE, Saha S, Villamar-Cruz O, Yip SC, Ethier SP, Zhang ZY, Chernoff J. Activation of SRC by protein tyrosine phosphatase 1B is required for Erbb2 transformation of human breast epithelial cells. Cancer Research. 2009;69:4582–4588. doi: 10.1158/0008-5472.CAN-08-4001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Baker NA, Sept D, Joseph S, Holst MJ, McCammon JA. Electrostatics of Nanosystems: application to Microtubules and the Ribosome. PNAS. 2001;98:10037–10041. doi: 10.1073/pnas.181342398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE. The protein data bank. Nucleic Acids Research. 2000;28:235–242. doi: 10.1093/nar/28.1.235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bonometti A, Borsani O, Rumi E, Ferretti VV, Dioli C, Lucato E, Paulli M, Boveri E. Arginase-1+ bone marrow myeloid cells are reduced in Myeloproliferative Neoplasms and correlate with clinical phenotype, fibrosis, and molecular driver. Cancer Medicine. 2023;12:7815–7822. doi: 10.1002/cam4.5542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Caner A, Asik E, Ozpolat B. SRC signaling in cancer and tumor Microenvironment. Advances in Experimental Medicine and Biology. 2021;1270:57–71. doi: 10.1007/978-3-030-47189-7_4. [DOI] [PubMed] [Google Scholar]
  9. Cardin DB, Goff LW, Chan E, Whisenant JG, Dan Ayers G, Takebe N, Arlinghaus LR, Yankeelov TE, Berlin J, Merchant N. Dual SRC and EGFR inhibition in combination with Gemcitabine in advanced Pancreatic cancer: phase I results: A phase I clinical trial. Investigational New Drugs. 2018;36:442–450. doi: 10.1007/s10637-017-0519-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Changeux JP, Christopoulos A. Allosteric modulation as a unifying mechanism for receptor function and regulation. Cell. 2016;166:1084–1102. doi: 10.1016/j.cell.2016.08.015. [DOI] [PubMed] [Google Scholar]
  11. Diskin C, Ryan TAJ, O’Neill LAJ. Modification of proteins by metabolites in immunity. Immunity. 2021;54:19–31. doi: 10.1016/j.immuni.2020.09.014. [DOI] [PubMed] [Google Scholar]
  12. Dolinsky TJ, Nielsen JE, McCammon JA, Baker NA. Pdb2Pqr: an automated pipeline for the setup of Poisson-Boltzmann Electrostatics calculations. Nucleic Acids Research. 2004;32:W665–W667. doi: 10.1093/nar/gkh381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dolinsky TJ, Czodrowski P, Li H, Nielsen JE, Jensen JH, Klebe G, Baker NA. Pdb2Pqr: expanding and upgrading automated preparation of Biomolecular structures for molecular simulations. Nucleic Acids Research. 2007;35:W522–W525. doi: 10.1093/nar/gkm276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dorman HR, Close D, Wingert BM, Camacho CJ, Johnston PA, Smithgall TE. Discovery of non-peptide small molecule allosteric Modulators of the SRC-family kinase, Hck. Frontiers in Chemistry. 2019;7:822. doi: 10.3389/fchem.2019.00822. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dosch AR, Dai X, Reyzer ML, Mehra S, Srinivasan S, Willobee BA, Kwon D, Kashikar N, Caprioli R, Merchant NB, Nagathihalli NS. Combined SRC/EGFR inhibition targets Stat3 signaling and induces Stromal remodeling to improve survival in Pancreatic cancer. Molecular Cancer Research. 2020;18:623–631. doi: 10.1158/1541-7786.MCR-19-0741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Eisenberg T, Abdellatif M, Schroeder S, Primessnig U, Stekovic S, Pendl T, Harger A, Schipke J, Zimmermann A, Schmidt A, Tong M, Ruckenstuhl C, Dammbrueck C, Gross AS, Herbst V, Magnes C, Trausinger G, Narath S, Meinitzer A, Hu Z, Kirsch A, Eller K, Carmona-Gutierrez D, Büttner S, Pietrocola F, Knittelfelder O, Schrepfer E, Rockenfeller P, Simonini C, Rahn A, Horsch M, Moreth K, Beckers J, Fuchs H, Gailus-Durner V, Neff F, Janik D, Rathkolb B, Rozman J, de Angelis MH, Moustafa T, Haemmerle G, Mayr M, Willeit P, von Frieling-Salewsky M, Pieske B, Scorrano L, Pieber T, Pechlaner R, Willeit J, Sigrist SJ, Linke WA, Mühlfeld C, Sadoshima J, Dengjel J, Kiechl S, Kroemer G, Sedej S, Madeo F. Cardioprotection and LifeSpan extension by the natural Polyamine Spermidine. Nature Medicine. 2016;22:1428–1438. doi: 10.1038/nm.4222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Engen JR, Wales TE, Hochrein JM, Meyn MA, Banu Ozkan S, Bahar I, Smithgall TE. Structure and dynamic regulation of SRC-family Kinases. Cellular and Molecular Life Sciences. 2008;65:3058–3073. doi: 10.1007/s00018-008-8122-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Feng Y, De Franceschi G, Kahraman A, Soste M, Melnik A, Boersema PJ, de Laureto PP, Nikolaev Y, Oliveira AP, Picotti P. Global analysis of protein structural changes in complex Proteomes. Nature Biotechnology. 2014;32:1036–1044. doi: 10.1038/nbt.2999. [DOI] [PubMed] [Google Scholar]
  19. Fischer G, Rossmann M, Hyvönen M. Alternative modulation of protein-protein interactions by small molecules. Current Opinion in Biotechnology. 2015;35:78–85. doi: 10.1016/j.copbio.2015.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Formisano L, D’Amato V, Servetto A, Brillante S, Raimondo L, Di Mauro C, Marciano R, Orsini RC, Cosconati S, Randazzo A, Parsons SJ, Montuori N, Veneziani BM, De Placido S, Rosa R, Bianco R. Src inhibitors act through different mechanisms in non-small cell lung cancer models depending on EGFR and RAS mutational status. Oncotarget. 2015;6:26090–26103. doi: 10.18632/oncotarget.4636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gargaro M, Scalisi G, Manni G, Briseño CG, Bagadia P, Durai V, Theisen DJ, Kim S, Castelli M, Xu CA, Meyer Zu Hörste G, Servillo G, Della Fazia MA, Mencarelli G, Ricciuti D, Padiglioni E, Giacchè N, Colliva C, Pellicciari R, Calvitti M, Zelante T, Fuchs D, Orabona C, Boon L, Bessede A, Colonna M, Puccetti P, Murphy TL, Murphy KM, Fallarino F. Indoleamine 2,3-Dioxygenase 1 activation in mature Cdc1 promotes Tolerogenic education of inflammatory Cdc2 via metabolic communication. Immunity. 2022;55:1032–1050. doi: 10.1016/j.immuni.2022.05.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Geck RC, Foley JR, Murray Stewart T, Asara JM, Casero RA, Toker A. Inhibition of the Polyamine synthesis enzyme Ornithine decarboxylase sensitizes triple-negative breast cancer cells to cytotoxic chemotherapy. The Journal of Biological Chemistry. 2020;295:6263–6277. doi: 10.1074/jbc.RA119.012376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Gerner EW, Bruckheimer E, Cohen A. Cancer Pharmacoprevention: targeting Polyamine metabolism to manage risk factors for colon cancer. The Journal of Biological Chemistry. 2018;293:18770–18778. doi: 10.1074/jbc.TM118.003343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Giovanelli P, Sandoval TA, Cubillos-Ruiz JR. Dendritic cell metabolism and function in tumors. Trends in Immunology. 2019;40:699–718. doi: 10.1016/j.it.2019.06.004. [DOI] [PubMed] [Google Scholar]
  25. Grohmann U, Mondanelli G, Belladonna ML, Orabona C, Pallotta MT, Iacono A, Puccetti P, Volpi C. Amino-acid sensing and degrading pathways in immune regulation. Cytokine & Growth Factor Reviews. 2017;35:37–45. doi: 10.1016/j.cytogfr.2017.05.004. [DOI] [PubMed] [Google Scholar]
  26. Gurbani D, Du G, Henning NJ, Rao S, Bera AK, Zhang T, Gray NS, Westover KD. Structure and characterization of a Covalent inhibitor of SRC kinase. Frontiers in Molecular Biosciences. 2020;7:81. doi: 10.3389/fmolb.2020.00081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hirose T, Saiki R, Yoshizawa Y, Imamura M, Higashi K, Ishii I, Toida T, Williams K, Kashiwagi K, Igarashi K. Spermidine and Ca(2+), but not Na(+), can permeate NMDA receptors consisting of Glun1 and Glun2A or Glun2B in the presence of Mg(2+) Biochemical and Biophysical Research Communications. 2015;463:1190–1195. doi: 10.1016/j.bbrc.2015.06.081. [DOI] [PubMed] [Google Scholar]
  28. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. Site-directed Mutagenesis by overlap extension using the polymerase chain reaction. Gene. 1989;77:51–59. doi: 10.1016/0378-1119(89)90358-2. [DOI] [PubMed] [Google Scholar]
  29. Holbert CE, Cullen MT, Casero RA, Stewart TM. Polyamines in cancer: integrating Organismal metabolism and Antitumour immunity. Nature Reviews. Cancer. 2022;22:467–480. doi: 10.1038/s41568-022-00473-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Hölttä E, Auvinen M, Andersson LC. Polyamines are essential for cell transformation by Pp60V-SRC: delineation of molecular events relevant for the transformed phenotype. The Journal of Cell Biology. 1993;122:903–914. doi: 10.1083/jcb.122.4.903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Iacono A, Pompa A, De Marchis F, Panfili E, Greco FA, Coletti A, Orabona C, Volpi C, Belladonna ML, Mondanelli G, Albini E, Vacca C, Gargaro M, Fallarino F, Bianchi R, De Marcos Lousa C, Mazza EM, Bicciato S, Proietti E, Milano F, Martelli MP, Iamandii IM, Graupera Garcia-Mila M, Llena Sopena J, Hawkins P, Suire S, Okkenhaug K, Stark A-K, Grassi F, Bellucci M, Puccetti P, Santambrogio L, Macchiarulo A, Grohmann U, Pallotta MT. Class IA Pi3Ks regulate subcellular and functional Dynamics of Ido1. EMBO Reports. 2020;21:e49756. doi: 10.15252/embr.201949756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Icard P, Fournel L, Wu Z, Alifano M, Lincet H. Interconnection between metabolism and cell cycle in cancer. Trends in Biochemical Sciences. 2019;44:490–501. doi: 10.1016/j.tibs.2018.12.007. [DOI] [PubMed] [Google Scholar]
  33. Igarashi K, Kashiwagi K. Polyamines: mysterious Modulators of cellular functions. Biochemical and Biophysical Research Communications. 2000;271:559–564. doi: 10.1006/bbrc.2000.2601. [DOI] [PubMed] [Google Scholar]
  34. Kim S, Thiessen PA, Bolton EE, Chen J, Fu G, Gindulyte A, Han L, He J, He S, Shoemaker BA, Wang J, Yu B, Zhang J, Bryant SH. Pubchem substance and compound databases. Nucleic Acids Research. 2016;44:D1202–D1213. doi: 10.1093/nar/gkv951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Klinghoffer RA, Sachsenmaier C, Cooper JA, Soriano P. Src family Kinases are required for integrin but not PDGFR signal Transduction. The EMBO Journal. 1999;18:2459–2471. doi: 10.1093/emboj/18.9.2459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lai YJ, Chen CS, Lin WC, Lin FT. C-SRC-mediated Phosphorylation of Trip6 regulates its function in Lysophosphatidic acid-induced cell migration. Molecular and Cellular Biology. 2005;25:5859–5868. doi: 10.1128/MCB.25.14.5859-5868.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Leonard SE, Register AC, Krishnamurty R, Brighty GJ, Maly DJ. Divergent modulation of SRC-family kinase regulatory interactions with ATP-competitive inhibitors. ACS Chemical Biology. 2014;9:1894–1905. doi: 10.1021/cb500371g. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Li G, Ding H, Yu X, Meng Y, Li J, Guo Q, Zhou H, Shen N. Spermidine suppresses inflammatory DC function by activating the Foxo3 pathway and Counteracts Autoimmunity iScience. IScience. 2020;23:100807. doi: 10.1016/j.isci.2019.100807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Liu BA, Shah E, Jablonowski K, Stergachis A, Engelmann B, Nash PD. The Sh2 domain-containing proteins in 21 species establish the provenance and scope of Phosphotyrosine signaling in Eukaryotes. Science Signaling. 2011;4:ra83. doi: 10.1126/scisignal.2002105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Liu ST, Pham H, Pandol SJ, Ptasznik A. Src as the link between inflammation and cancer. Frontiers in Physiology. 2013;4:416. doi: 10.3389/fphys.2013.00416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Liu R, Li X, Ma H, Yang Q, Shang Q, Song L, Zheng Z, Zhang S, Pan Y, Huang P, Fang J, Li Y, Liu Z, Cao L, Feng C, Gong Z, Chen Y, Wang Y, Melino G, Shao C, Shi Y. Spermidine endows Macrophages anti-inflammatory properties by inducing mitochondrial superoxide-dependent AMPK activation, Hif-1Α upregulation and Autophagy. Free Radical Biology and Medicine. 2020;161:339–350. doi: 10.1016/j.freeradbiomed.2020.10.029. [DOI] [PubMed] [Google Scholar]
  42. Macchiarulo A, Nuti R, Eren G, Pellicciari R. Charting the chemical space of target sites: insights into the binding modes of amine and Amidine groups. Journal of Chemical Information and Modeling. 2009;49:900–912. doi: 10.1021/ci800414v. [DOI] [PubMed] [Google Scholar]
  43. Madeo F, Eisenberg T, Pietrocola F, Kroemer G. Spermidine in health and disease. Science. 2018;359:eaan2788. doi: 10.1126/science.aan2788. [DOI] [PubMed] [Google Scholar]
  44. Makowski L, Chaib M, Rathmell JC. Immunometabolism: from basic mechanisms to translation. Immunological Reviews. 2020;295:5–14. doi: 10.1111/imr.12858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Mandarano M, Bellezza G, Belladonna ML, Vannucci J, Gili A, Ferri I, Lupi C, Ludovini V, Falabella G, Metro G, Mondanelli G, Chiari R, Cagini L, Stracci F, Roila F, Puma F, Volpi C, Sidoni A. Indoleamine 2,3-Dioxygenase 2 immunohistochemical expression in Resected human non-small cell lung cancer: A potential new Prognostic tool. Frontiers in Immunology. 2020;11:839. doi: 10.3389/fimmu.2020.00839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Manni G, Mondanelli G, Scalisi G, Pallotta MT, Nardi D, Padiglioni E, Romani R, Talesa VN, Puccetti P, Fallarino F, Gargaro M. Pharmacologic induction of Endotoxin tolerance in Dendritic cells by L-Kynurenine. Frontiers in Immunology. 2020;11:292. doi: 10.3389/fimmu.2020.00292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Minois N, Carmona-Gutierrez D, Madeo F. Polyamines in aging and disease. Aging. 2011;3:716–732. doi: 10.18632/aging.100361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Mondanelli G, Bianchi R, Pallotta MT, Orabona C, Albini E, Iacono A, Belladonna ML, Vacca C, Fallarino F, Macchiarulo A, Ugel S, Bronte V, Gevi F, Zolla L, Verhaar A, Peppelenbosch M, Mazza EMC, Bicciato S, Laouar Y, Santambrogio L, Puccetti P, Volpi C, Grohmann U. A relay pathway between arginine and Tryptophan metabolism confers immunosuppressive properties on Dendritic cells. Immunity. 2017;46:233–244. doi: 10.1016/j.immuni.2017.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Mondanelli G, Iacono A, Allegrucci M, Puccetti P, Grohmann U. Immunoregulatory interplay between arginine and Tryptophan metabolism in health and disease. Frontiers in Immunology. 2019;10:1565. doi: 10.3389/fimmu.2019.01565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Mondanelli G, Di Battista V, Pellanera F, Mammoli A, Macchiarulo A, Gargaro M, Mavridou E, Matteucci C, Ruggeri L, Orabona C, Volpi C, Grohmann U, Mecucci C. A novel Mutation of Indoleamine 2,3-Dioxygenase 1 causes a rapid Proteasomal degradation and compromises protein function. Journal of Autoimmunity. 2020a;115:102509. doi: 10.1016/j.jaut.2020.102509. [DOI] [PubMed] [Google Scholar]
  51. Mondanelli G, Coletti A, Greco FA, Pallotta MT, Orabona C, Iacono A, Belladonna ML, Albini E, Panfili E, Fallarino F, Gargaro M, Manni G, Matino D, Carvalho A, Cunha C, Maciel P, Di Filippo M, Gaetani L, Bianchi R, Vacca C, Iamandii IM, Proietti E, Boscia F, Annunziato L, Peppelenbosch M, Puccetti P, Calabresi P, Macchiarulo A, Santambrogio L, Volpi C, Grohmann U. Positive allosteric modulation of indoleamine 2,3-dioxygenase 1 restrains neuroinflammation. PNAS. 2020b;117:3848–3857. doi: 10.1073/pnas.1918215117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Mondanelli G, Volpi C. The double life of serotonin metabolites: in the mood for joining neuronal and immune systems. Current Opinion in Immunology. 2020;70:1–6. doi: 10.1016/j.coi.2020.11.008. [DOI] [PubMed] [Google Scholar]
  53. Mondanelli G, Volpi C. Serotonin pathway in Neuroimmune network. 2021. [May 22, 2021]. https://www.intechopen.com/chapters/75797
  54. Moroco JA, Craigo JK, Iacob RE, Wales TE, Engen JR, Smithgall TE, Sticht H. Differential sensitivity of SRC-family Kinases to activation by Sh3 domain displacement. PLOS ONE. 2014;9:e105629. doi: 10.1371/journal.pone.0105629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Moroco JA, Baumgartner MP, Rust HL, Choi HG, Hur W, Gray NS, Camacho CJ, Smithgall TE. A discovery strategy for selective inhibitors of C-SRC in complex with the focal adhesion kinase Sh3/Sh2-binding region. Chemical Biology & Drug Design. 2015;86:144–155. doi: 10.1111/cbdd.12473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Nakkina SP, Gitto SB, Pandey V, Parikh JG, Geerts D, Maurer HC, Olive KP, Phanstiel O, Altomare DA. Differential expression of Polyamine pathways in human Pancreatic tumor progression and effects of Polyamine blockade on tumor Microenvironment. Cancers. 2021;13:6391. doi: 10.3390/cancers13246391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Ni YQ, Liu YS. New insights into the roles and mechanisms of Spermidine in aging and age-related diseases. Aging and Disease. 2021;12:1948–1963. doi: 10.14336/AD.2021.0603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Niu G, Chen X. Molecular imaging with Activatable reporter systems. Theranostics. 2012;2:413–423. doi: 10.7150/thno.3940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Oppermann H, Levinson AD, Varmus HE, Levintow L, Bishop JM. Uninfected vertebrate cells contain a protein that is closely related to the product of the avian sarcoma virus transforming gene (SRC) PNAS. 1979;76:1804–1808. doi: 10.1073/pnas.76.4.1804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Orabona C, Pallotta MT, Grohmann U. Different partners, opposite outcomes: a new perspective of the Immunobiology of Indoleamine 2,3-Dioxygenase. Molecular Medicine. 2012;18:834–842. doi: 10.2119/molmed.2012.00029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Orecchini E, Belladonna ML, Pallotta MT, Volpi C, Zizi L, Panfili E, Gargaro M, Fallarino F, Rossini S, Suvieri C, Macchiarulo A, Bicciato S, Mondanelli G, Orabona C. The signaling function of Ido1 incites the malignant progression of Mouse B16 Melanoma. Oncoimmunology. 2023;12:2170095. doi: 10.1080/2162402X.2023.2170095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Ozanne J, Prescott AR, Clark K. The clinically approved drugs Dasatinib and Bosutinib induce anti-inflammatory Macrophages by inhibiting the salt-inducible Kinases. The Biochemical Journal. 2015;465:271–279. doi: 10.1042/BJ20141165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Pallotta MT, Orabona C, Volpi C, Vacca C, Belladonna ML, Bianchi R, Servillo G, Brunacci C, Calvitti M, Bicciato S, Mazza EMC, Boon L, Grassi F, Fioretti MC, Fallarino F, Puccetti P, Grohmann U. Indoleamine 2,3-Dioxygenase is a signaling protein in long-term tolerance by Dendritic cells. Nature Immunology. 2011;12:870–878. doi: 10.1038/ni.2077. [DOI] [PubMed] [Google Scholar]
  64. Panicker RC, Coyne AG, Srinivasan R. Allosteric targeting of Aurora A kinase using small molecules: A step forward towards next generation medicines? Current Medicinal Chemistry. 2019;26:2234–2242. doi: 10.2174/0929867324666170727120315. [DOI] [PubMed] [Google Scholar]
  65. Pegg AE. Functions of Polyamines in mammals. The Journal of Biological Chemistry. 2016;291:14904–14912. doi: 10.1074/jbc.R116.731661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Pendeville H, Carpino N, Marine JC, Takahashi Y, Muller M, Martial JA, Cleveland JL. The Ornithine decarboxylase gene is essential for cell survival during early murine development. Molecular and Cellular Biology. 2001;21:6549–6558. doi: 10.1128/MCB.21.19.6549-6558.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Piazza I, Kochanowski K, Cappelletti V, Fuhrer T, Noor E, Sauer U, Picotti P. A map of protein-metabolite interactions reveals principles of chemical communication. Cell. 2018;172:358–372. doi: 10.1016/j.cell.2017.12.006. [DOI] [PubMed] [Google Scholar]
  68. Proietti E, Rossini S, Grohmann U, Mondanelli G. Polyamines and Kynurenines at the intersection of immune modulation. Trends in Immunology. 2020;41:1037–1050. doi: 10.1016/j.it.2020.09.007. [DOI] [PubMed] [Google Scholar]
  69. Ray RM, Li C, Bhattacharya S, Naren AP, Johnson LR. Spermine, a molecular switch regulating EGFR, integrin Β3, SRC, and FAK scaffolding. Cellular Signalling. 2012;24:931–942. doi: 10.1016/j.cellsig.2011.12.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Reikofski J, Tao BY. Polymerase chain reaction (PCR) techniques for site-directed Mutagenesis. Biotechnology Advances. 1992;10:535–547. doi: 10.1016/0734-9750(92)91451-j. [DOI] [PubMed] [Google Scholar]
  71. Roskoski R. Src protein-tyrosine kinase structure, mechanism, and small molecule inhibitors. Pharmacological Research. 2015;94:9–25. doi: 10.1016/j.phrs.2015.01.003. [DOI] [PubMed] [Google Scholar]
  72. Saporito MS, Ochman AR, Lipinski CA, Handler JA, Reaume AG. MLR-1023 is a potent and selective allosteric activator of Lyn kinase in vitro that improves glucose tolerance in vivo. The Journal of Pharmacology and Experimental Therapeutics. 2012;342:15–22. doi: 10.1124/jpet.112.192096. [DOI] [PubMed] [Google Scholar]
  73. Shah NH, Amacher JF, Nocka LM, Kuriyan J. The SRC Module: an ancient scaffold in the evolution of cytoplasmic tyrosine Kinases. Critical Reviews in Biochemistry and Molecular Biology. 2018;53:535–563. doi: 10.1080/10409238.2018.1495173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Shao S, Piao L, Guo L, Wang J, Wang L, Wang J, Tong L, Yuan X, Zhu J, Fang S, Wang Y. Tetraspanin 7 promotes Osteosarcoma cell invasion and metastasis by inducing EMT and activating the FAK-SRC-Ras-Erk1/2 signaling pathway. Cancer Cell International. 2022;22:183. doi: 10.1186/s12935-022-02591-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Sun H, Han W, Wen J, Ma X. Il4I1 and Tryptophan metabolites enhance AHR signals to facilitate colorectal cancer progression and immunosuppression. American Journal of Translational Research. 2022;14:7758–7770. [PMC free article] [PubMed] [Google Scholar]
  76. Taylor JD, Ababou A, Fawaz RR, Hobbs CJ, Williams MA, Ladbury JE. Structure, Dynamics, and binding thermodynamics of the V-SRC Sh2 domain: implications for drug design. Proteins. 2008;73:929–940. doi: 10.1002/prot.22119. [DOI] [PubMed] [Google Scholar]
  77. Yang Q, Zheng C, Cao J, Cao G, Shou P, Lin L, Velletri T, Jiang M, Chen Q, Han Y, Li F, Wang Y, Cao W, Shi Y. Spermidine Alleviates experimental autoimmune Encephalomyelitis through inducing inhibitory Macrophages. Cell Death and Differentiation. 2016;23:1850–1861. doi: 10.1038/cdd.2016.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Zhang J, Adrián FJ, Jahnke W, Cowan-Jacob SW, Li AG, Iacob RE, Sim T, Powers J, Dierks C, Sun F, Guo GR, Ding Q, Okram B, Choi Y, Wojciechowski A, Deng X, Liu G, Fendrich G, Strauss A, Vajpai N, Grzesiek S, Tuntland T, Liu Y, Bursulaya B, Azam M, Manley PW, Engen JR, Daley GQ, Warmuth M, Gray NS. Targeting Bcr-Abl by combining allosteric with ATP-binding-site inhibitors. Nature. 2010;463:501–506. doi: 10.1038/nature08675. [DOI] [PMC free article] [PubMed] [Google Scholar]

Editor's evaluation

Volker Dötsch 1

This is an important study describing the mechanism of Spermidine modulation of Src kinase, identifying the interacting amino acids and the effect on indoleamine 2,3-dioxygenase 1 (IDO1) activation based on solid evidence. Considering the important role of IDO1 in the immune response this study could provide important information for the design of allosteric modulators capable of turning SRC on/off.

Decision letter

Editor: Volker Dötsch1

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "A Back-Door Insights into the modulation of Src kinase activity by the polyamine spermidine" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Volker Dötsch as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1. Please be more clear in the numbering of amino acids and specific species used:

– Line 65. In the introduction, the authors stated "The autoregulatory function of the kinase occurs through intramolecular interactions that stabilize the catalytically inactive conformation of Src, in which the SH2 domain binds to a pY located at position +535." What Src isoform and species are the authors referring to? cSrc is regulated by phosphorylation of Tyr530 in human, Tyr529 in mouse, Tyr527 in avian protein. Providing a reference would be helpful.

– Line 88. The authors stated that they check the phosphorylation of human Src on Tyr424 as an indicator of Src activity. Human Src is phosphorylated on Tyr419, the mouse is on 418, and avian is on 416.

– in vitro experiments were done with human Src but there is no clear statement of what Src construct was used in SYF cells.

– Figure 2C does not highlight A153, F155? and T255. Is F155 numbering correct? E155 or F155?

2. Related: Amino acid positions for the SH2 domain listed in the Results section are confusing. Authors must indicate what species they are referring to. The figure shows the SH2 domain of vSrc. However, vSrc does not have Glu in either position. It appears that the positions are specified for rat Src. Why did the author choose to take the structure of the vSrc SH2 domain alone? If they would take a look at the structure of full-length human Src (PDB# 1FMK) they would find that both Glu amino acids are positioned in close proximity to the region where the SH3 domain binds suggesting a different mechanism of action if these are the sites spermidine interaction. The docking models shown in Figure 2C, D do not reflect the real interactions because they are done with SH2 alone. They have to be one with full-length Src.

3. Please have a look at the statistical analysis and adjust accordingly:

– Figure 1A. The authors do not indicate how many repeats they did for this experiment. Half of the data points do not have error bars. The error bars for the other half are not specified. The figure legend suggests that the star should indicate a statistically significant difference between samples. However, the samples highlighted in Figure 1A do not appear to be different at all. Also, it is not clear if the other samples are significantly different.

– Figure 1C. The figure legend suggests that the star should indicate a statistically significant difference between samples. However, the samples highlighted in Figure 1C do not appear to be different at all. Also, it is not clear if the other samples are significantly different given how large the error bars are.

– Figure 3C does not show any error bars and does not indicate any statistical analysis.

4. Related: Line 98. Authors stated that "In the presence of fixed amount of spermidine and increasing concentration of the peptide, the maximum rate of Src kinase activity (Vmax) increased, while the affinity (Km) for the substrate was not affected (Figure 1E)." However, neither Vmax nor Km values are provided. Judging from the data, it might be impossible to obtain these parameters within the concentration range tested. Also, the figure legend does not indicate how many replicates were performed and what are the error bars showing. The same criticism applies to Suppl Figure S1.

5. In Figure 1A authors show that wild-type Src is activated two-fold by spermidine. It is important to show how spermidine affects the activity of constitutively active Src. This experiment will also allow authors to evaluate the extent of activation and compare the Kcat and Vmax of constitutively active Src and spermidine-activated. A two-fold increase in activity is not substantial for Src but this could be the limitation of the assay.

6. Figure 1b does not indicate what concentration of spermidine was used in what lane.

7. Authors show that spermidine induced maximum Src activity at 106nM in vitro. However, EC50 in cells is much higher at 6uM. How would the authors explain the discrepancy? Such a drastic difference suggests that the mechanism of Src activation in cells might be different from what they observe with purified protein.

8. The rationale for the experiment in Figure 1D is not clear. Why would there be any activity without ATP or substrate? Some of the bars in Figure 1D are marked with stars indicating statistical significance but it is not clear what they are compared to.

9. Line 129. Authors stated that "Results indicated that Src activity is induced by LPA as measured by the phosphorylation of the Y424, independently of the mutation at the putative allosteric site (Supplementary Figure S3B)." This figure only shows that wild-type Src is activated. Both mutants appear to show elevated activity without LPA and do not show convincing activation following LPA treatment (especially considering uneven Src expression in some samples). The figure legend does not state how many times this experiment was repeated and has no quantification data.

10. Figure 2E shows that spermidine does not activate wt Src contradicting their previous data. Samples without spermidine should be shown on the same blot to compare basal levels of activity. The activity measurements in Figure 2F should compare all samples to the activity of wtSrc without spermidine. This will allow authors to evaluate if mutants have higher residual activity. As mentioned above, mutation of these amino acids may affect the inhibitory binding of the SH3 domain and thus lead to increased basal activity of Src. Same problem with the data in Figure 2H. It shows that the mutants do not respond to spermidine, but it does not reveal if they already have higher activity without spermidine. The figure legend does not provide information about the error bars. Furthermore, the authors suggest that the mechanism of spermidine action is to prevent Src SH2 domain binding phospho-tyrosine. In this case, the luciferase sensor should show a higher signal with higher spermidine concentration regardless of Src activity.

11. Line 159. Authors stated that "Results from immunoblot demonstrated that the co-precipitated IDO1 is tyrosine phosphorylated by Src and that the polyamine increases the phosphorylation (Figure 3A)." The data does not show that Src phosphorylates IDO1. They only suggest that IDO1 phosphorylation increases when Src is co-expressed and activated. Furthermore, there is a band in the IP sample where IDO1 is expressed without Src. This is not explained by the authors. The figure legend says that "IDO1/pTYR ratio is measured by densitometric quantification of the specific bands and is expressed relative to untreated cells." but no measurements are provided.

12. Related: Figure 3, does spermidine promote IDO1 phosphorylation via constitutively active-Src in the SYF model? That spermidine promotes IDO1 phosphorylation is interesting. What advantage/disadvantage does spermidine-mediated IDO1 phosphorylation give to IDO1 function? Does Src co-expression increase IDO1 levels (WCLs, last two lanes Figure 3A) independent of spermidine?

13. The phosphorylation of IDO1 and its interaction with Src upon spermidine treatment are only shown with overexpression of both proteins. To prove a physiological relevance, the effects on endogenous proteins should be evaluated if possible.

14. Is spermidine selective for the IDO1-Src complex? Is it possible additional Src substrates may also be candidates? And are E155 and E174 residues conserved across SH2 domains of other close PTKs, such as Yes and Fyn? Is spermidine binding specifically to the Src SH2 domain? what about SH2 domains of related PTKs? Does spermidine broadly bind/impact SH2 domain-containing protein targets?

15. Is spermidine binding to Src constitutive or induced by stimuli/cues?

Reviewer #2 (Recommendations for the authors):

1. Is spermidine selective for the IDO1-Src complex? Is it possible additional Src substrates may also be candidates?

2. Is spermidine binding to Src constitutive or induced by stimuli/cues?

3. Are E155 and E174 residues conserved across SH2 domains of other close PTKs, such as Yes and Fyn? Is spermidine binding specifically to the Src SH2 domain? what about SH2 domains of related PTKs? Does spermidine broadly bind/impact SH2 domain-containing protein targets?

4. It would be more meaningful to include constitutively active-Src and kinase dead-Src in Figure 1A and Figure 1B.

5. Figure S3B, it seems in reconstituted SYF cells, E155A and E174A Src mutants are active in absence of LPA activation and do not significantly respond to LPA ( o vs other time points). A similar profile seems true even with spermidine stimulation of mutants (Figure 2E, F). Why are mutants more active in the LPA experiment (Figure S3B, 0 time points) but not in Figure 2E (-Spd)?

6. Figure 3, does spermidine promote IDO1 phosphorylation via constitutively active-Src in the SYF model? That spermidine promotes IDO1 phosphorylation is interesting. What advantage/disadvantage does spermidine-mediated IDO1 phosphorylation give to IDO1 function? Does Src co-expression increase IDO1 levels (WCLs, last two lanes Figure 3A) independent of spermidine?

Reviewer #3 (Recommendations for the authors):

1. Line 65. In the introduction, the authors stated "The autoregulatory function of the kinase occurs through intramolecular interactions that stabilize the catalytically inactive conformation of Src, in which the SH2 domain binds to a pY located at position +535." What Src isoform and species are the authors referring to? cSrc is regulated by phosphorylation of Tyr530 in human, Tyr529 in mouse, Tyr527 in avian protein. Providing a reference would be helpful.

2. Figure 1A. The authors do not indicate how many repeats they did for this experiment. Half of the data points do not have error bars. The error bars for the other half are not specified. The figure legend suggests that the star should indicate a statistically significant difference between samples. However, the samples highlighted in Figure 1A do not appear to be different at all. Also, it is not clear if the other samples are significantly different.

3. In Figure 1A authors show that wild-type Src is activated two-fold by spermidine. It is important to show how spermidine affects the activity of constitutively active Src. This experiment will also allow authors to evaluate the extent of activation and compare the Kcat and Vmax of constitutively active Src and spermidine-activated. A two-fold increase in activity is not substantial for Src but this could be the limitation of the assay.

4. Line 88. The authors stated that they check the phosphorylation of human Src on Tyr424 as an indicator of Src activity. Human Src is phosphorylated on Tyr419, the mouse is on 418, and the avian is on 416.

5. in vitro experiments were done with human Src but there is no clear statement of what Src construct was used in SYF cells.

6. Figure 1b does not indicate what concentration of spermidine was used in what lane.

7. Figure 1C. The figure legend suggests that the star should indicate a statistically significant difference between samples. However, the samples highlighted in Figure 1C do not appear to be different at all. Also, it is not clear if the other samples are significantly different given how large the error bars are.

8. Authors show that spermidine induced maximum Src activity at 106nM in vitro. However, EC50 in cells is much higher at 6uM. How would the authors explain the discrepancy? Such a drastic difference suggests that the mechanism of Src activation in cells might be different from what they observe with purified protein.

9. The rationale for the experiment in Figure 1D is not clear. Why would there be any activity without ATP or substrate? Some of the bars in Figure 1D are marked with stars indicating statistical significance but it is not clear what they are compared to.

10. Line 98. Authors stated that "In the presence of a fixed amount of spermidine and increasing concentration of the peptide, the maximum rate of Src kinase activity (Vmax) increased, while the affinity (Km) for the substrate was not affected (Figure 1E)." However, neither Vmax nor Km values are provided. Judging from the data, it might be impossible to obtain these parameters within the concentration range tested. Also, the figure legend does not indicate how many replicates were performed and what are the error bars showing. The same criticism applies to Suppl Figure S1.

11. Amino acid positions for the SH2 domain listed in the Results section are confusing. Authors must indicate what species they are referring to. The figure shows the SH2 domain of vSrc. However, vSrc does not have Glu in either position. It appears that the positions are specified for rat Src. Why did the author choose to take the structure of the vSrc SH2 domain alone? If they would take a look at the structure of full-length human Src (PDB# 1FMK) they would find that both Glu amino acids are positioned in close proximity to the region where the SH3 domain binds suggesting a different mechanism of action if these are the sites spermidine interaction. The docking models shown in Figure 2C, D do not reflect the real interactions because they are done with SH2 alone. They have to be one with full-length Src.

12. Line 129. Authors stated that "Results indicated that Src activity is induced by LPA as measured by the phosphorylation of the Y424, independently of the mutation at the putative allosteric site (Supplementary Figure S3B)." This figure only shows that wild-type Src is activated. Both mutants appear to show elevated activity without LPA and do not show convincing activation following LPA treatment (especially considering uneven Src expression in some samples). The figure legend does not state how many times this experiment was repeated and has no quantification data.

13. Figure 2E shows that spermidine does not activate wt Src contradicting their previous data. Samples without spermidine should be shown on the same blot to compare basal levels of activity. The activity measurements in Figure 2F should compare all samples to the activity of wtSrc without spermidine. This will allow authors to evaluate if mutants have higher residual activity. As mentioned above, mutation of these amino acids may affect the inhibitory binding of the SH3 domain and thus lead to increased basal activity of Src. Same problem with the data in Figure 2H. It shows that the mutants do not respond to spermidine, but it does not reveal if they already have higher activity without spermidine. The figure legend does not provide information about the error bars. Furthermore, the authors suggest that the mechanism of spermidine action is to prevent Src SH2 domain binding phospho-tyrosine. In this case, the luciferase sensor should show a higher signal with higher spermidine concentration regardless of Src activity.

14. Line 159. Authors stated that "Results from immunoblot demonstrated that the co-precipitated IDO1 is tyrosine phosphorylated by Src and that the polyamine increases the phosphorylation (Figure 3A)." The data does not show that Src phosphorylates IDO1. They only suggest that IDO1 phosphorylation increases when Src is co-expressed and activated. Furthermore, there is a band in the IP sample where IDO1 is expressed without Src. This is not explained by the authors. The figure legend says that "IDO1/pTYR ratio is measured by densitometric quantification of the specific bands and is expressed relative to untreated cells." but no measurements are provided.

15. Figure 3C does not show any error bars and does not indicate any statistical analysis.

16. The phosphorylation of IDO1 and its interaction with Src upon spermidine treatment are only shown with overexpression of both proteins. To prove a physiological relevance, the effects on endogenous proteins should be evaluated.

eLife. 2023 Jun 30;12:e85872. doi: 10.7554/eLife.85872.sa2

Author response

Essential revisions:

1. Please be more clear in the numbering of amino acids and specific species used:

1a. Line 65. In the introduction, the authors stated "The autoregulatory function of the kinase occurs through intramolecular interactions that stabilize the catalytically inactive conformation of Src, in which the SH2 domain binds to a pY located at position +535." What Src isoform and species are the authors referring to? cSrc is regulated by phosphorylation of Tyr530 in human, Tyr529 in mouse, Tyr527 in avian protein. Providing a reference would be helpful.

The Authors wish to sincerely apologize for the presence of incorrect statements. Numbering of amino acids has been revised thorough the manuscript, indicating residues of the human Src kinase isoform. When other isoforms (viral and/or murine) are cited, numbering of the residues according to the relative sequence is also explicitly indicated. At line 67, the text has been now corrected accordingly, indicating Tyr530 of the human sequence.

1b. Line 88. The authors stated that they check the phosphorylation of human Src on Tyr424 as an indicator of Src activity. Human Src is phosphorylated on Tyr419, the mouse is on 418, and avian is on 416.

We apologize for the mistake and now the text (line 89) has been modified accordingly, indicating Tyr418 of the murine sequence.

1c. in vitro experiments were done with human Src but there is no clear statement of what Src construct was used in SYF cells.

In response to the referee’s request, we specify that the experiments with SYF cells were performed by using the murine Src construct, while biochemical assays were done with recombinant human Src protein. The text has been modified accordingly, in both results and material/methods sections.

1d. Figure 2C does not highlight A153, F155? and T255. Is F155 numbering correct? E155 or F155?

The Authors wish to sincerely apologize for the presence of such mistakes. In response to Reviewer request, Figures 2C and 2D and their legends have been modified. Highlighted residues are now labelled according to sequence numbering of the human isoform. In the legend of Figure 2B, the corresponding residues of the NMR structure of viral SH2 domain are also indicated.

2. Related: Amino acid positions for the SH2 domain listed in the Results section are confusing. Authors must indicate what species they are referring to. The figure shows the SH2 domain of vSrc. However, vSrc does not have Glu in either position. It appears that the positions are specified for rat Src.

The Authors wish to sincerely apologize for the presence of incorrect numbering. Position of residues of the SH2 domain listed in the Results section has been revised according to sequence numbering of the human isoform. When the murine isoform is cited (results of mutagenesis experiments), numbering of the residues according to the relative sequence is also explicitly indicated.

2a. Why did the author choose to take the structure of the vSrc SH2 domain alone? If they would take a look at the structure of full-length human Src (PDB# 1FMK) they would find that both Glu amino acids are positioned in close proximity to the region where the SH3 domain binds suggesting a different mechanism of action if these are the sites spermidine interaction. The docking models shown in Figure 2C, D do not reflect the real interactions because they are done with SH2 alone. They have to be one with full-length Src.

We understand the concern of the referee. We used the NMR structure of the SH2 domain of Src kinase of Rous sarcoma virus (PDB ID: 2JYQ) because it shares a high sequence identity (97%) with the relative SH2 domains of human and murine Src tyrosine kinase. This is now explicitly stated in the Materials and methods section of the revised manuscript, also inserting the sequence of the viral isoform in the multiple alignment reported in Figure 2 —figure supplement 1. The very high sequence identity allows using the NMR structure of the viral isoform with very good approximation to infer about the electrostatic potential map of human/murine SH2 domain and to investigate the putative binding site of spermidine.

The advantage of using a single domain structure rather than the full-length structure of human Src (PDB# 1FMK) is to avoid the bias that a full-length structure of human Src kinase might bring into more time-consuming calculations due to considering multiple conformations between the regulatory and kinase domains of the enzyme. Indeed, diverse conformations of Src may differently affect the electrostatic potential of the SH2 domain as well as potentially mask a putative polyamine binding site for polyamine.

Although we agree with Reviewer’s comment that the human full-length Src may be instrumental to provide more insights into the mechanism of action of spermidine, this latter was not the aim of the present study. Indeed, using electrostatic potential mapping and docking calculations, the goal of the study was to generate a working hypothesis to locate a potential binding site of spermidine in the SH2 domain and next prove such hypothesis with mutagenesis experiments. Results of mutagenesis experiments are in agreement with the working hypothesis generated using the NMR structure of the viral SH2 domain, thereby supporting the validity of using such isoform as input structure for our calculations.

3. Please have a look at the statistical analysis and adjust accordingly:

3a. Figure 1A. The authors do not indicate how many repeats they did for this experiment. Half of the data points do not have error bars. The error bars for the other half are not specified. The figure legend suggests that the star should indicate a statistically significant difference between samples. However, the samples highlighted in Figure 1A do not appear to be different at all. Also, it is not clear if the other samples are significantly different.

We understand the concern of the Referee about the error bars. In this figure, no error bar appears for certain points because they are shorter than the size of the symbol. Thus, to overcome this limitation, we modified the Figure 1A by making the symbols smaller. In the figure legend we specified that the results are the mean of three independent experiments, each performed in triplicates. Moreover, we indicated that the statistical analysis was performed by comparing the kinase activity of each spermidine-treated sample to the untreated counterpart.

3b. Figure 1C. The figure legend suggests that the star should indicate a statistically significant difference between samples. However, the samples highlighted in Figure 1C do not appear to be different at all. Also, it is not clear if the other samples are significantly different given how large the error bars are.

In response to the Referee request, we specify that the data were analyzed by comparing the pSrc/Src ratio of each spermidine-treated sample to the untreated counterpart (the legend of Figure 1C has been modified accordingly). Although the potentiating effect of spermidine on Src activity in SYF cells is relatively subtle, it is nonetheless likely to be physiologically relevant, as small degrees of positive allosteric modulation of the Src by spermidine is known to be relevant in conventional dendritic cells (Mondanelli ed al., Immunity, 2017).

3c. Figure 3C does not show any error bars and does not indicate any statistical analysis.

We wish to apologize for this oversight. As suggested by the Referee, Revised Figure 3C now shows the error bars indicating the standard deviation and the statistical analysis, which has been performed by comparing, for each time point, the pTYR/IDO1 ratio of spermidine-treated sample to the untreated counterpart (as specified in the figure legend).

4. Related: Line 98. Authors stated that "In the presence of fixed amount of spermidine and increasing concentration of the peptide, the maximum rate of Src kinase activity (Vmax) increased, while the affinity (Km) for the substrate was not affected (Figure 1E)." However, neither Vmax nor Km values are provided. Judging from the data, it might be impossible to obtain these parameters within the concentration range tested. Also, the figure legend does not indicate how many replicates were performed and what are the error bars showing. The same criticism applies to Suppl Figure S1.

We agree with the point raised by the Referee, i.e., the limited concentration range tested for ATP and peptide. We thus tried to use higher concentrations of either ATP or peptide. The revised Figure 1F and Revised Figure 1 —figure supplement 1 now show the curve of peptide or ATP from 0 to 600 µM. Due to the limit of detection of the luminescent assay as well as to the saturating effect, we were not able to include any other concentrations higher than 600 µM. The results confirmed that in the presence of increasing concentrations of peptide (but not in the case of increasing concentrations of ATP), spermidine enhanced by almost 2-fold the maximum rate of Src kinase activity and the affinity for the substrate. Moreover, as indicated by the Referee, we specified the Vmax and Km values in the revised figures as well as the number of experiments performed.

5. In Figure 1A authors show that wild-type Src is activated two-fold by spermidine. It is important to show how spermidine affects the activity of constitutively active Src. This experiment will also allow authors to evaluate the extent of activation and compare the Kcat and Vmax of constitutively active Src and spermidine-activated. A two-fold increase in activity is not substantial for Src but this could be the limitation of the assay.

We understand the point raised by the Reviewer and his/her skepticism on the polyamine effect. We got the importance of showing that spermidine increases the activity of the constitutively active Src. However, due to funding shortage and long time required for the reagent purchase and shipment, we were not able to perform the specific experiment with the recombinant viral Src protein as required by the Referee. We wish to sincerely apologize for that.

Nevertheless, we performed related experiments with SYF cells expressing the wild type Src or the mutated one at the tyrosine 529 into phenylalanine (Y529F of the murine sequence) that is constitutive active Src. By measuring the pSrc/Src ratio (revised Figure 1 —figure supplement 1) as well as the phosphorylation of IDO1 (revised Figure 3 —figure supplement 1) in cells treated with spermidine, we found that spermidine did not potentiate the activity of Src Y529F.

We thus concluded that, upon binding the allosteric site on the SH2 domain, spermidine makes Src to change its tridimensional structure. We speculated that spermidine promotes the conformational changes of the kinase and thus its activation. The results obtained with the SYF model highlight that spermidine per se cannot activate or stabilize the constitutive-active form of Src, i.e., that mutated in the residue Y529 at the C-terminus. Therefore, spermidine behaves as a pharmacologic allosteric modulator of Src, as it binds to a distinct site from the catalytic pocket and guides Src to assume the active conformation.

We understand the concern about the 2-fold increase in activity. We would like to stress that this result has been obtained by means of biochemical and fibroblast-based assays, because the aim of this paper was to show the spermidine mechanism of action with these two in vitro models. However, a 2-fold increment of Src activity is sufficient to phosphorylate IDO1 in dendritic cells and finally promote the immunoregulatory phenotype of such immune cells as demonstrated in Mondanelli et al. (Immunity, 2017) and in line with the concept of allosteric modulation.

6. Figure 1b does not indicate what concentration of spermidine was used in what lane.

In response to Referee request, we modified the Figure 1B accordingly, by indicating the concentration of spermidine used.

7. Authors show that spermidine induced maximum Src activity at 106nM in vitro. However, EC50 in cells is much higher at 6uM. How would the authors explain the discrepancy? Such a drastic difference suggests that the mechanism of Src activation in cells might be different from what they observe with purified protein.

We understand the concern of the referee. However, given the intrinsic difference between the cell-free (i.e., the biochemical assay with recombinant Src protein) and cell-based assay (i.e., that with SYF fibroblasts reconstituted with murine Src vector), the tested compound can exhibit distinct potency. Indeed, in a cell-based assay the molecule must penetrate through the cell membrane, distribute within the cell, find the target among the other proteins, and finally activate it. On the contrary, in a biochemical assay, the molecule is directly added to the reaction mixture containing only the purified target protein (besides other reagents in the optimal concentration to carry out the in vitro reaction). Thus, is not surprising that the EC50 of spermidine in the SYF cellbased assay is higher than that found in the biochemical assay.

8. The rationale for the experiment in Figure 1D is not clear. Why would there be any activity without ATP or substrate? Some of the bars in Figure 1D are marked with stars indicating statistical significance but it is not clear what they are compared to.

The point raised by the Reviewer is well-taken. The experiments without ATP or peptide are negative controls of the biochemical assay. Our aim was to confirm the lack of intrinsic activity of the molecule spermidine against purified Src when neither the ATP nor the substrate are present, thus measuring the background signal – which is below 1000 rlu. On the contrary, the activity of Src in the samples with ATP and peptide is above 10000 rlu, which at least doubles in the presence of spermidine. In accordance with the Reviewer #1 request (please, see Reviewer #1, point 3), the statistical analysis of data in Figure 1D (now revised Figure 1E) has been now performed using the Student t-test, by comparing Spd/ATP/ peptide vs ATP/peptide samples. The revised analysis still confirms that the presence of spermidine increases the kinase activity by 2-fold. The Figure and the respective legend have been modified accordingly.

9. Line 129. Authors stated that "Results indicated that Src activity is induced by LPA as measured by the phosphorylation of the Y424, independently of the mutation at the putative allosteric site (Supplementary Figure S3B)." This figure only shows that wild-type Src is activated. Both mutants appear to show elevated activity without LPA and do not show convincing activation following LPA treatment (especially considering uneven Src expression in some samples). The figure legend does not state how many times this experiment was repeated and has no quantification data.

We apologize for the bad quality of the Western blot experiment shown in Supplementary Figure S3. We have now repeated the experiment and the results are now shown in revised Figure 2 —figure supplement 2, alongside the densitometric analysis demonstrating that LPA activates Src in cells expressing the mutant forms of the kinase similarly to the wild-type protein (revised Figure 2 —figure supplement 2).

Moreover, as shown by the revised Figure 2 —figure supplement 2, the mutant forms of the kinase have a basal activity comparable to wild-type protein. The same results can be obtained by looking at the absolute values of luminescent reporter in untreated SYF-Src cells as well as those expressing Src E149A or Src E168A (please, see lines 149-153 of the main text). Specifically, luminescent signal in unstimulated SYF cells co-expressing the reporter and wild type Src is 617,7 ± 121 rlu vs 552,2 ± 68,9 rlu of E149A Src vs 501 ± 110 rlu of E168A Src – which are not statistically different (one-way ANOVA, followed by post-hoc Bonferroni test).

10. Figure 2E shows that spermidine does not activate wt Src contradicting their previous data. Samples without spermidine should be shown on the same blot to compare basal levels of activity. The activity measurements in Figure 2F should compare all samples to the activity of wtSrc without spermidine. This will allow authors to evaluate if mutants have higher residual activity. As mentioned above, mutation of these amino acids may affect the inhibitory binding of the SH3 domain and thus lead to increased basal activity of Src.

As suggested by the Reviewer, we evaluated the activity of Src in unstimulated cells expressing the wild-type protein or the mutated one. As shown in the revised Figure 2 —figure supplement 2, the amino acid substitution at the position 149 and 168 does not affect the basal activity of the kinase, thus suggesting that the Src mutants can be used to validate the working hypothesis generated through the electrostatic potential mapping and docking calculations. Moreover, to overcome the limitation of the samples loaded on different blots, we have now repeated the experiments running samples stimulated with selected spermidine concentration (i.e., 100 µM) in the same gel, so as to have all the cell types. The results are now shown in revised Figure 2E.

10a. Same problem with the data in Figure 2H. It shows that the mutants do not respond to spermidine, but it does not reveal if they already have higher activity without spermidine.

As reported in point 9 of the “Essential revision for authors”, the absolute values of luminescent reporter in untreated cells co-expressing either the wild type Src or those expressing Src E149A or Src E168A are not statistically different, suggesting that the basal activity of the kinase is not affected by the specific amino acid substitution. Specifically, luminescent signal in unstimulated SYF cells co-expressing the reporter and wild type Src is 617,7 ± 121 rlu vs 552,2 ± 68,9 rlu of E149A Src vs 501 ± 110 rlu of E168A Src – which are not statistically different (one-way ANOVA, followed by post-hoc Bonferroni test). This information has been specified in the main text (please see lines 149 – 153).

10b. The figure legend does not provide information about the error bars.

As suggested by the Referee, the figure legend has been modified indicating that the results in Figure 2H are mean ± standard deviation of three independent experiments.

10c. Furthermore, the authors suggest that the mechanism of spermidine action is to prevent Src SH2 domain binding phospho-tyrosine. In this case, the luciferase sensor should show a higher signal with higher spermidine concentration regardless of Src activity.

The bioluminescent reporter has been used as an alternative strategy to demonstrate the capability of spermidine to activate the wild type Src kinase expressed by SYF cells, and not the mutated one. Indeed, the DNA plasmid-based reporter is built by physically separated the N and C luciferase fragments introducing a phosphopeptide recognition domain (i.e., the SH2 sequence) and the Src peptide substrate. Upon cellular Src activation, the reporter peptide substrate becomes phosphorylated, interacts with SH2 of the reporter, thus creating a steric hindrance that prevents luciferase reconstitution and bioluminescence emission (please, refer to the schematic representation Figure 2G). Thus, in the presence of spermidine, the luciferase sensor shows a lower signal in cells co-expressing the wild-type Src and not the mutated forms of the kinase, suggesting that the polyamine activates only the cellular, wild-type Src by acting at the putative allosteric site.

11. Line 159. Authors stated that "Results from immunoblot demonstrated that the co-precipitated IDO1 is tyrosine phosphorylated by Src and that the polyamine increases the phosphorylation (Figure 3A)." The data does not show that Src phosphorylates IDO1. They only suggest that IDO1 phosphorylation increases when Src is co-expressed and activated.

We agree with the Reviewer that Figure 3A shows that IDO1 phosphorylation increases when Src is co-expressed and activated by spermidine, thus we have modified the main text accordingly (please see line 176-177).

11a. Furthermore, there is a band in the IP sample where IDO1 is expressed without Src. This is not explained by the authors.

The band in the IP sample where IDO1 is expressed without Src has molecular weight of around 40 kDa, lower than that of pIDO1. We might speculate that is a non-specific signal. In response to Referee request (please see the minor point 10), we have now replaced the figure with a revised version of IP experiment that includes the negative control (i.e., the immunoprecipitation without antibody; revised Figure 3A) as well.

11b. The figure legend says that "IDO1/pTYR ratio is measured by densitometric quantification of the specific bands and is expressed relative to untreated cells." but no measurements are provided.

As stated in the figure legend, panel A also included the densitometric quantification of the amount of IDO1 co-precipitated in samples after immunoprecipitation with the a-pTYR antibody. The measurement is reported under the specific IP bands and is expressed relative to untreated cells (fold change = 1). To be clearer, we modified the statement in the figure legend as follows: “The amount of IDO1 immunoprecipitated is measured by densitometric quantification of the specific bands in treated sample co-expressing IDO1 and Src and is expressed relative to untreated cells (fold change = 1)”, as the analysis refers to the amount of IDO1 precipitated with the a-pTyr antibody.

12. Related: Figure 3, does spermidine promote IDO1 phosphorylation via constitutively active-Src in the SYF model?

We would like to thank the Reviewer for this suggestion. By immunoprecipitation with the a-pTyr antibody, we found that IDO1 is phosphorylated in SYF cells co-expressing IDO1 and the constitutively active-Src regardless of the stimulation with spermidine, as opposed to samples coexpressing IDO1 and wild type Src (please, refer to revised Figure 3 —figure supplement 1). This result suggests that spermidine can act as on/off switcher. Indeed, when the polyamine binds the site on the SH2 domain, which is distinct from the substrate pocket, it can make Src assume an active conformation, essentially turning it on. Conversely, constitutive active Src adopts already the open conformation, as the substitution of the tyrosine residue at position 529 of the murine sequence with the phenylalanine interferes with the autoregulatory clamp of the enzyme. In that case, spermidine does not increase the Src activity – as also shown by the measurement of the pSrc/Src in SYF cells exposed to spermidine and expressing constitutively active Src (Revised Figure 1 —figure supplement 1).

That spermidine promotes IDO1 phosphorylation is interesting. What advantage/disadvantage does spermidine-mediated IDO1 phosphorylation give to IDO1 function?

We would like to thank the Reviewer for highlighting this point. We have previously demonstrated that spermidine confers an immunoregulatory phenotype on conventional dendritic cells (i.e., the antigen presenting cells of our immune system; cDCs) via IDO1 (Mondanelli et al., Immunity, 2017). Specifically, we have shown that spermidine promotes the phosphorylation of IDO1 and the activation of its non-enzymatic function in cDCs. However, the exact molecular mechanism behind it all was the missing puzzle piece. Through the present study, we thus wondered whether Src directly phosphorylates IDO1 and if spermidine promotes such post-translational modification by resorting to SYF cells appropriately reconstituted with the vectors coding for Src and IDO1 as in vitro model.

Does Src co-expression increase IDO1 levels (WCLs, last two lanes Figure 3A) independent of spermidine?

We understand the concern raised by the Reviewer. The experiment represented in Figure 3A has been performed on SYF cells reconstituted with vectors coding for Src and IDO1, thus we may exclude that the co-expression of Src could increase IDO1 levels.

13. The phosphorylation of IDO1 and its interaction with Src upon spermidine treatment are only shown with overexpression of both proteins. To prove a physiological relevance, the effects on endogenous proteins should be evaluated if possible.

We would like to thank the Reviewer for this suggestion. We have now performed the experiments on colon cancer cell line that express both IDO1 and Src kinase (i.e., MC38). Results showed that spermidine activates Src kinase as measured by its phosphorylation status (revised Figure 1D). Moreover, spermidine promotes the phosphorylation of IDO1 and its interaction with Src (revised Figure 3H, 3I).

14. Is spermidine selective for the IDO1-Src complex? Is it possible additional Src substrates may also be candidates?

We would like to thank the Reviewer for highlighting this point. Among the predicted functional partners of murine Src (https://string-db.org/), we verified Stat3 as possible candidate. Results demonstrated that spermidine does not increase the interaction of Src with Stat3 in SYF cells, as depicted in Author response image 1. Although we cannot exclude the effect on any other candidates, our analysis indicated that spermidine is selective for the IDO1-Src complex. These findings are in line with the notion that allosteric ligands can selectively affect only one biological process and have no effect on any other response via the pharmacologic target. These results have been included as “data not shown” in the main text (please see lines 189-191).

Author response image 1.

Author response image 1.

Open in a new tab

14a. And are E155 and E174 residues conserved across SH2 domains of other close PTKs, such as Yes and Fyn? Is spermidine binding specifically to the Src SH2 domain? what about SH2 domains of related PTKs? Does spermidine broadly bind/impact SH2 domain-containing protein targets?

The point raised by the Reviewer is well taken. The alignment of murine Src, Yes and Fyn sequences highlights that only the glutamate residue at position 149 of murine Src is conserved across SH2 domains, while the glutamate residue at position 168 is replaced by the amino acid glycine, as depicted in Author response image 2. Thus, although we cannot exclude that spermidine can bind the SH2 domain of related Src kinases, we might speculate that the lack of the negative charge at position 168 reduces the long-range electrostatic interactions hypothesized to be responsible for the molecular recognition of the ligand into the allosteric site. These findings were included in the main text as data not shown (please see lines 162-167).

Author response image 2.

Author response image 2.

Open in a new tab

By aligning murine Src with several SH2 domain proteins such as enzymes (Abl1, SHIP1), docking (Shc1) and adaptor (Grb2, SOCS1) proteins, we found that neither E149 nor E168 are conserved, in their place there are non-polar hydrophobic amino acids (e.g., alanine, glycine and proline) or those with polar uncharged side chains (e.g., glutamine). In light of these results, we may conclude that spermidine cannot broadly bind SH2-domain containing proteins, suggesting that the polyamine selectively interacts with Src kinase. These observations have been included in the main text (please see lines 250-255). Please, refer to Author response image 2 for sequences alignment by CLUSTAL.

15. Is spermidine binding to Src constitutive or induced by stimuli/cues?

As shown in the biochemical assay with the recombinant protein (please see Figure 1A) as well as in SYF cells reconstituted with the construct (please see Figure 1B-C), we conclude that spermidine binding to Src does not depend on other general cues.

Reviewer #2 (Recommendations for the authors):

1. Is spermidine selective for the IDO1-Src complex? Is it possible additional Src substrates may also be candidates?

See Essential revisions response to point 14.

2. Is spermidine binding to Src constitutive or induced by stimuli/cues?

See Essential revisions response to point 15.

3. Are E155 and E174 residues conserved across SH2 domains of other close PTKs, such as Yes and Fyn?

See Essential revisions response to point 14a.

Is spermidine binding specifically to the Src SH2 domain? what about SH2 domains of related PTKs? Does spermidine broadly bind/impact SH2 domain-containing protein targets?

By aligning murine Src with several SH2 domain proteins such as enzymes (Abl1, SHIP1), docking (Shc1) and adaptor (Grb2, SOCS1) proteins, we found that neither E149 nor E168 are conserved, in their place there are non-polar hydrophobic amino acids (e.g., alanine, glycine and proline) or those with polar uncharged side chains (e.g., glutamine). In light of these results, we may conclude that spermidine cannot broadly bind SH2-domain containing proteins, suggesting that the polyamine selectively interacts with Src kinase. These observations have been included in the main text (please see lines 250-255). Please, refer to attached files of sequences alignment by CLUSTAL.

4. It would be more meaningful to include constitutively active-Src and kinase dead-Src in Figure 1A and Figure 1B.

We understand the point raised by the Reviewer. However, due to funding shortage and long time required for the reagent purchase and shipment, we were not able to perform the specific experiment with the recombinant proteins as required by the Referee (as parallel experiments for figure 1A). We wish to sincerely apologize for that.

Nevertheless, we performed related experiments with SYF cells expressing the wild type Src or the mutated one at the tyrosine 529 into phenylalanine (Y529F of the murine sequence) that is constitutively active Src. By measuring the pSrc/Src ratio (Figure 1 —figure supplement 1) as well as the phosphorylation of IDO1 (Figure 3 —figure supplement 1) in cells treated with spermidine, we found that spermidine did not potentiate the activity of Src Y529F.

We thus concluded that, upon binding the allosteric site on the SH2 domain, spermidine makes Src to change its tridimensional structure. We speculated that spermidine promotes the conformational changes of the kinase and thus its activation. The results obtained with the SYF model highlight that spermidine per se cannot activate or stabilize the constitutive-active form of Src, i.e., that mutated in the residue Y529 at the C-terminus. Therefore, spermidine behaves as a pharmacologic allosteric modulator of Src, as it binds to a distinct site from the catalytic pocket and guides Src to assume the active conformation.

5. Figure S3B, it seems in reconstituted SYF cells, E155A and E174A Src mutants are active in absence of LPA activation and do not significantly respond to LPA ( o vs other time points). A similar profile seems true even with spermidine stimulation of mutants (Figure 2E, F). Why are mutants more active in the LPA experiment (Figure S3B, 0 time points) but not in Figure 2E (-Spd)?

We apologize for the bad quality of the Western blot experiment shown in Supplementary Figure S3. We have now repeated the experiment and the results are now shown in revised Figure 2 —figure supplement 2, alongside the densitometric analysis demonstrating that LPA activates Src in cells expressing the mutant forms of the kinase similarly to the wild-type protein (Figure 2 —figure supplement 2).

Moreover, as shown by the revised Figure 2 —figure supplement 2, the mutant forms of the kinase have a basal activity comparable to wild-type protein. The same results can be obtained by looking at the absolute values of luminescent reporter in untreated SYF-Src cells as well as those expressing Src E149A or Src E168A (please, see lines 149-153 of the main text). Specifically, luminescent signal in unstimulated SYF cells co-expressing the reporter and wild type Src is 617,7 ± 121 rlu vs 552,2 ± 68,9 rlu of E149A Src vs 501 ± 110 rlu of E168A Src – which are not statistically different (one-way ANOVA, followed by post-hoc Bonferroni test).

6. Figure 3, does spermidine promote IDO1 phosphorylation via constitutively active-Src in the SYF model?

We would like to thank the Reviewer for this suggestion. By immunoprecipitation with the a-pTyr antibody, we found that IDO1 is phosphorylated in SYF cells co-expressing IDO1 and the constitutively active-Src regardless of the stimulation with spermidine, as opposed to samples coexpressing IDO1 and wild type Src (please, refer to revised Figure 3 —figure supplement 1). This result suggests that spermidine can act as on/off switcher. Indeed, when the polyamine binds the site on the SH2 domain, which is distinct from the substrate pocket, it can make Src assume an active conformation, essentially turning it on. Conversely, constitutive active Src adopts already the open conformation, as the substitution of the tyrosine residue at position 529 of the murine sequence with the phenylalanine interferes with the autoregulatory clamp of the enzyme. In that case, spermidine does not increase the Src activity – as also shown by the measurement of the pSrc/Src in SYF cells exposed to spermidine and expressing constitutively active Src (Revised Figure 1 —figure supplement 1).

That spermidine promotes IDO1 phosphorylation is interesting. What advantage/disadvantage does spermidine-mediated IDO1 phosphorylation give to IDO1 function?

We would like to thank the Reviewer for highlighting this point. We have previously demonstrated that spermidine confers an immunoregulatory phenotype on conventional dendritic cells (i.e., the antigen presenting cells of our immune system; cDCs) via IDO1 (Mondanelli et al., Immunity, 2017). Specifically, we have shown that spermidine promotes the phosphorylation of IDO1 and the activation of its non-enzymatic function in cDCs. However, the exact molecular mechanism behind it all was the missing puzzle piece. Through the present study, we thus wondered whether Src directly phosphorylates IDO1 and if spermidine promotes such post-translational modification by resorting to SYF cells appropriately reconstituted with the vectors coding for Src and IDO1 as an in vitro model.

Does Src co-expression increase IDO1 levels (WCLs, last two lanes Figure 3A) independent of spermidine?

We understand the concern raised by the Reviewer. The experiment represented in Figure 3A has been performed on SYF cells reconstituted with vectors coding for Src and IDO1, thus we may exclude that the co-expression of Src could increase IDO1 levels.

Reviewer #3 (Recommendations for the authors):

1. Line 65. In the introduction, the authors stated "The autoregulatory function of the kinase occurs through intramolecular interactions that stabilize the catalytically inactive conformation of Src, in which the SH2 domain binds to a pY located at position +535." What Src isoform and species are the authors referring to? cSrc is regulated by phosphorylation of Tyr530 in human, Tyr529 in mouse, Tyr527 in avian protein. Providing a reference would be helpful.

See response to Essential revisions point 1a.

2. Figure 1A. The authors do not indicate how many repeats they did for this experiment. Half of the data points do not have error bars. The error bars for the other half are not specified. The figure legend suggests that the star should indicate a statistically significant difference between samples. However, the samples highlighted in Figure 1A do not appear to be different at all. Also, it is not clear if the other samples are significantly different.

See response to Essential revisions point 3a.

3. In Figure 1A authors show that wild-type Src is activated two-fold by spermidine. It is important to show how spermidine affects the activity of constitutively active Src. This experiment will also allow authors to evaluate the extent of activation and compare the Kcat and Vmax of constitutively active Src and spermidine-activated. A two-fold increase in activity is not substantial for Src but this could be the limitation of the assay.

See response to Essential revisions point 5.

4. Line 88. The authors stated that they check the phosphorylation of human Src on Tyr424 as an indicator of Src activity. Human Src is phosphorylated on Tyr419, the mouse is on 418, and the avian is on 416.

See response to Essential revisions point 1b.

5. in vitro experiments were done with human Src but there is no clear statement of what Src construct was used in SYF cells.

In response to the referee’s request, we specify that the experiments with SYF cells were performed by using the murine Src construct, while biochemical assays were done with recombinant human Src protein. The text has been modified accordingly, in both results and material & methods sections.

6. Figure 1b does not indicate what concentration of spermidine was used in what lane.

In response to Referee request, we modified the Figure 1B accordingly by indicating the concentration of spermidine used.

7. Figure 1C. The figure legend suggests that the star should indicate a statistically significant difference between samples. However, the samples highlighted in Figure 1C do not appear to be different at all. Also, it is not clear if the other samples are significantly different given how large the error bars are.

See response to Essential revisions point 3b.

8. Authors show that spermidine induced maximum Src activity at 106nM in vitro. However, EC50 in cells is much higher at 6uM. How would the authors explain the discrepancy? Such a drastic difference suggests that the mechanism of Src activation in cells might be different from what they observe with purified protein.

See response to Essential revisions point 7.

9. The rationale for the experiment in Figure 1D is not clear. Why would there be any activity without ATP or substrate? Some of the bars in Figure 1D are marked with stars indicating statistical significance but it is not clear what they are compared to.

See response to Essential revisions point 8.

10. Line 98. Authors stated that "In the presence of a fixed amount of spermidine and increasing concentration of the peptide, the maximum rate of Src kinase activity (Vmax) increased, while the affinity (Km) for the substrate was not affected (Figure 1E)." However, neither Vmax nor Km values are provided. Judging from the data, it might be impossible to obtain these parameters within the concentration range tested. Also, the figure legend does not indicate how many replicates were performed and what are the error bars showing. The same criticism applies to Suppl Figure S1.

See response to Essential revisions point 4.

11. Amino acid positions for the SH2 domain listed in the Results section are confusing. Authors must indicate what species they are referring to. The figure shows the SH2 domain of vSrc. However, vSrc does not have Glu in either position. It appears that the positions are specified for rat Src.

See response to Essential revisions point 2.

Why did the author choose to take the structure of the vSrc SH2 domain alone? If they would take a look at the structure of full-length human Src (PDB# 1FMK) they would find that both Glu amino acids are positioned in close proximity to the region where the SH3 domain binds suggesting a different mechanism of action if these are the sites spermidine interaction. The docking models shown in Figure 2C, D do not reflect the real interactions because they are done with SH2 alone. They have to be one with full-length Src.

See response to Essential revisions point 2a.

12. Line 129. Authors stated that "Results indicated that Src activity is induced by LPA as measured by the phosphorylation of the Y424, independently of the mutation at the putative allosteric site (Supplementary Figure S3B)." This figure only shows that wild-type Src is activated. Both mutants appear to show elevated activity without LPA and do not show convincing activation following LPA treatment (especially considering uneven Src expression in some samples). The figure legend does not state how many times this experiment was repeated and has no quantification data.

See response to Essential revisions point 9.

13. Figure 2E shows that spermidine does not activate wt Src contradicting their previous data. Samples without spermidine should be shown on the same blot to compare basal levels of activity. The activity measurements in Figure 2F should compare all samples to the activity of wtSrc without spermidine. This will allow authors to evaluate if mutants have higher residual activity. As mentioned above, mutation of these amino acids may affect the inhibitory binding of the SH3 domain and thus lead to increased basal activity of Src.

See response to Essential revisions point 10.

Same problem with the data in Figure 2H. It shows that the mutants do not respond to spermidine, but it does not reveal if they already have higher activity without spermidine.

See response to Essential revisions point 10a.

The figure legend does not provide information about the error bars.

See response to Essential revisions point 10b.

Furthermore, the authors suggest that the mechanism of spermidine action is to prevent Src SH2 domain binding phospho-tyrosine. In this case, the luciferase sensor should show a higher signal with higher spermidine concentration regardless of Src activity.

See response to Essential revisions point 10c.

14. Line 159. Authors stated that "Results from immunoblot demonstrated that the co-precipitated IDO1 is tyrosine phosphorylated by Src and that the polyamine increases the phosphorylation (Figure 3A)." The data does not show that Src phosphorylates IDO1. They only suggest that IDO1 phosphorylation increases when Src is co-expressed and activated.

See response to Essential revisions point 11.

Furthermore, there is a band in the IP sample where IDO1 is expressed without Src. This is not explained by the authors.

See response to Essential revisions point 11a.

The figure legend says that "IDO1/pTYR ratio is measured by densitometric quantification of the specific bands and is expressed relative to untreated cells." but no measurements are provided.

See response to Essential revisions point 11b.

15. Figure 3C does not show any error bars and does not indicate any statistical analysis.

See response to Essential revisions point 3c.

16. The phosphorylation of IDO1 and its interaction with Src upon spermidine treatment are only shown with overexpression of both proteins. To prove a physiological relevance, the effects on endogenous proteins should be evaluated.

See response to Essential revisions point 13.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Original immunoblots of phosphorylated (pSrc), total Src and actin protein levels evaluated in cell lysates from SYF cells reconstituted with vector coding for wild-type Src and then treated with increasing concentration of spermidine.

    Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig1-data1.zip (1.2MB, zip)
    Figure 1—source data 2. Original immunoblots of phosphorylated (pSrc), total Src and actin protein levels evaluated in cell lysates from MC38 cells either treated with spermidine or left untreated for 15 and 30 min.

    Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig1-data2.zip (1.3MB, zip)
    Figure 1—figure supplement 1—source data 1. Original immunoblots of phosphorylated, total Src and β-tubulin protein levels in lysates from SYF cells either reconstituted with vector coding for wild-type Src or Src mutated at tyrosine 529 with phenylalanine and then exposed to spermidine .

    Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig1-figsupp1-data1.zip (1.3MB, zip)
    Figure 2—source data 1. Original immunoblots of phosphorylated (pSrc), total Src and actin protein level evaluated in cell lysates from SYF cells either reconstituted with vector coding for wild-type Src (WT) or Src mutated at glutamate 149 or 168 with alanine.

    Cells were either treated with spermidine (100 µM) or left untreated. Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig2-data1.zip (873.1KB, zip)
    Figure 2—figure supplement 2—source data 1. Original immunoblots of phosphorylated (pSrc), total Src and actin protein levels in cell lysates from SYF cells either reconstituted with vector coding for wild-type Src (WT) or Src mutated at glutamate 149 or 168 with alanine.

    SYF cells transfected with empty vector (SYF) were used as control. Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig2-figsupp2-data1.zip (1.8MB, zip)
    Figure 2—figure supplement 2—source data 2. Original immunoblots of phosphorylated, total Src and actin protein levels in lysates from SYF cells either reconstituted with vector coding for wild-type Src or Src mutated at glutamate 149 or 168 with alanine.

    Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig2-figsupp2-data2.zip (1.3MB, zip)
    Figure 3—source data 1. Original immunoblots of immunoprecipitation with anti-phosphotyrosine antibody (IP) followed by the detection of indoleamine 2,3-dioxygenase 1 (IDO1) with specific antibodies.

    Whole-cell lysates (PRE-IP) was used as control of protein expression of IDO1, Src, and β-tubulin. SYF cells reconstituted with vectors coding for Src and IDO1 and then treated with spermidine (100 μM) for 60 min as well as cells transfected with vectors coding for either Src or IDO1 were used for the experiments. The negative control (i.e., the sample expressing both IDO1 and Src, but not immunoprecipitated with the antibody) is included. Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig3-data1.zip (2.8MB, zip)
    Figure 3—source data 2. Original immunoblots of in vitro kinase assay with rhIDO1 (300 ng) and rhSrc (50 ng) followed by immunoblot analysis with anti-phosphotyrosine and anti-IDO1 specific antibodies.

    The reaction was in either the presence or absence of spermidine. Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig3-data2.zip (808.1KB, zip)
    Figure 3—source data 3. Original immunoblots of immunoprecipitation with anti-phosphotyrosine antibody (IP) followed by the detection of indoleamine 2,3-dioxygenase 1 (IDO1) with specific antibodies.

    Whole-cell lysates (PRE-IP) of MC38 cells was used as control of protein expression of IDO1, Src, and β-actin. The negative control (i.e., sample not immunoprecipitated with the antibody) is included. Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig3-data3.zip (3.1MB, zip)
    Figure 3—source data 4. Original immunoblots of immunoprecipitation of Src from MC38 cells treated with spermidine or left untreated.

    The detection of indoleamine 2,3-dioxygenase 1 (IDO1) and Src was performed by sequential immunoblotting with specific antibodies (IP). Whole-cell lysates (PRE-IP) was used as control of protein expression. The negative control (i.e., sample not immunoprecipitated with the antibody) is included. Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig3-data4.zip (2.4MB, zip)
    Figure 3—source data 5. Original immunoblots of immunoprecipitation of Src from MC38 cells treated with spermidine or left untreated.

    The detection of indoleamine 2,3-dioxygenase 1 (IDO1) and Src was performed by sequential immunoblotting with specific antibodies (IP). Whole-cell lysates (PRE-IP) was used as control of protein expression. The negative control (i.e., sample not immunoprecipitated with the antibody) is included. Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig3-data5.zip (2.9MB, zip)
    Figure 3—figure supplement 1—source data 1. Original immunoblots of immunoprecipitation with anti-phosphotyrosine antibody (IP) followed by the detection of indoleamine 2,3-dioxygenase 1 (IDO1) with specific antibodies.

    Whole-cell lysates (PRE-IP) was used as control of protein expression of IDO1, Src, and β-tubulin. SYF cells were reconstituted with vectors coding for wild-type Src and IDO1 or Src mutated at tyrosine 529 with phenylalanine and IDO1. Moreover, cells transfected with vectors coding for either Src or IDO1 were used for the experiments. The negative control (i.e., sample expressing both IDO1 and Src, but not immunoprecipitated with the antibody) is included. Cells were either treated with spermidine (100 μM) or left untreated. Figure with the uncropped blots with relevant bands clearly labeled are provided.

    elife-85872-fig3-figsupp1-data1.zip (2.9MB, zip)
    Supplementary file 1. Solutions of the docking study of spermidine into the allosteric site of Src SH2 domain using the structure of the viral isoform (PDB ID: 2JYQ).
    elife-85872-supp1.docx (14.1KB, docx)
    MDAR checklist
    elife-85872-mdarchecklist1.pdf (185.5KB, pdf)

    Data Availability Statement

    All data generated or analyzed during this study are included in the manuscript and supporting file. Figure 1 - Source Data 1; Figure 1 - Source Data 2; Figure 1 - Figure supplement 1 - Source Data 1; Figure 2 - Source Data 1; Figure 2 - Figure supplement 2 - Source Data 1; Figure 2 - Figure supplement 2 - Source Data 2; Figure 3 - Source Data 1; Figure 3 - Source Data 2; Figure 3 - Source Data 3; Figure 3 - Source Data 14; Figure 3 - Source Data 5; Figure 3 - Figure supplement 1 - Source Data 1: contain the original blots used to generate the figures.

    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES