Skip to main content
NCBI home page
Journal of Microbiology and Biotechnology logoLink to Journal of Microbiology and Biotechnology
. 2023 Mar 8;33(6):823–830. doi: 10.4014/jmb.2301.01019

Potential Anti-Allergy and Immunomodulatory Properties of Lactococcus lactis LB 1022 Observed In Vitro and in an Atopic Dermatitis Mouse Model

Jihye Baek 1, Jong-Hwa Kim 1,2,*, Wonyong Kim 1,2,*
PMCID: PMC10331936  PMID: 36908272

Abstract

Lactococcus lactis is a lactic acid bacterium and used in the dairy food industry. The ameliorating effects of Lactobacillus species on atopic dermatitis (AD) have been extensively studied, but the specific effect of L. lactis strains has not yet been investigated. In this study, the efficacy of L. lactis LB 1022, isolated from natural cheese, was evaluated using RAW 264.7, HMC-1 and HaCaT cell lines and an ovalbumin-sensitized AD mouse model. L. lactis LB 1022 exhibited nitric oxide suppression and anti-allergy and anti-inflammatory activity in vitro. Oral administration of L. lactis LB 1022 to AD mice significantly reduced the levels of IgE, mast cells, and eosinophils, and a range of T cell-mediated T helper Th1, Th2, and Th17-type cytokines under interleukin (IL)-10, transforming growth factor-β (TGF-β), thymus and activation-regulated chemokine (TARC), and thymic stromal lymphopoietin (TSLP). In addition, L. lactis LB 1022 treatment increased the concentration of short-chain fatty acids. Overall, L. lactis LB 1022 significantly modulated AD-like symptoms by altering metabolites and the immune response, illustrating its potential as candidate for use in functional food supplements to alleviate AD.

Keywords: Lactococcus lactis, atopic dermatitis, allergic inflammation, Th2, ovalbumin

Introduction

Atopic dermatitis (AD) is a common chronic relapsing skin disorder, affecting at least 230 million people globally [1]. Though various genetic and environmental factors and the Western diet have been associated with AD, its pathogenesis remains difficult to fully understand [2]. Recent studies have reported that the pathogenesis of AD is related to gut dysbiosis with inflammation and imbalanced immune responses [3]. In this context, lactic acid bacteria, which are commonly used as probiotics, have been shown to improve gut health by regulating gut and immune homeostasis and alleviating allergic disease in the host. In particular, Lactobacillus spp. and Bifidobacterium have been proposed as complementary therapeutic agents for AD [4-6].

Lactococcus lactis, which has been classified by the Food and Drug Administration, is widely used as a starter culture to produce dairy products including cheese, fermented milk products, and sour cream [7]. L. lactis subsp. lactis is also found in dairy products and fermentation processing [8]. It has been found that oral administration of L. lactis strain C59 decreases IgE levels in inflammation in ovalbumin (OVA)-induced mice models, while a recent study reported that L. lactis strain NZ9000 prevents airway OVA-induced asthmatic mice [9, 10]. However, other studies have demonstrated the effects of L. lactis on AD symptoms.

This study thus investigated the anti-allergy and anti-inflammatory properties of L. lactis LB 1022 in OVA-induced mice and whether these properties are linked to alters in the function of short-chain fatty acid (SCFA) metabolites and to systemic immunomodulatory response, with the ultimate aim to identify a new probiotic candidate for the treatment of AD.

Materials and Methods

Cultures of Lactococcus lactis LB 1022

To isolate L. lactis subsp. lactis, a cheese sample was serially diluted to a concentration of 10-7, added to trypticase soy agar (BD BBL, USA), and left at 30°C for 48 h for use as a selective medium [11]. Following the L. lactis LB 1022 isolation process, colonies were selected and identified using 16S rRNA gene sequencing [12]. The isolate was placed in trypticase soy broth (BD BBL) containing 50 % (v/v) glycerol for preparing stock and stored at –80°C.

Cell Cultures

Human mast cell line (HMC-1), human keratinocyte cell line (HaCaT), and murine macrophages cell line (RAW 267.4) were purchased from the Korean Cell Line Bank (Korea). HMC-1 were cultivated in Iscovés Modified Dulbeccós Medium (Lonza, Switzerland) added with 10% MSC-qualified fetal bovine serum (FBS)(Gibco BRL, USA), HaCaT in Dulbecco’s Modified Eagle’s Medium (DMEM; Lonza) containing 10% FBS, and RAW 264.7 cells in DMEM supplemented with 10% FBS. All three cultures were kept at 37°C in 5% CO2 incubator.

Anti-Inflammatory Activity

RAW 264.7 cells were used to investigate the effect of L. lactis LB 1022 on the immune response. RAW 264.7 cells were seeded at 5.0 × 105 cells/well and pretreated with L. lactis LB 1022 (1 × 108 CFU) for 1 h prior to stimulation with 0.1 μg/ml of lipopolysaccharide (LPS), followed by incubation for 24 h. The NO concentration was assessed using Griess reagent (Sigma-Aldrich, USA) and measured using a microplate reader (Infinite M200 Nano-quant; Männedorf, Switzerland) at a wavelength of OD540 [13]. The MTT cell growth assay reagent 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma–Aldrich) was measured the effect of L. lactis LB 1022 on the viability [14]. RAW 264.7 cells were seeded at 5.0 × 105 cells/well for 24 h. L. lactis LB 1022 (1 × 108 CFU) was replaced to fresh DMEM and incubated for 24 h. Then, 500 μl of 5 mg/ml MTT reagent was added, and incubation for 1 h. Then, 500 μl of dimethyl sulfoxide (Sigma-Aldrich) added, and the cells then measured at OD590.

Thymus and Activation-Regulated Chemokine (TARC) and T helper 2 (Th2) Cytokine Assays for HaCaT Cells

HaCaT cells were seeded at 5.0 × 105 cells/well and treated with L. lactis LB 1022 (1 × 108 CFU) and stimulated with tumor necrosis factor (TNF)-a/ interferon (IFN)-g (both 20 ng/ml) for 24 h. The supernatant was centrifuged at 1,000 ×g for 5 min. The secretion levels of TARC and Th2-related cytokines (IL-4, IL-5, and IL-13) in the HaCaT cells were performed using an ELISA kit (BD Biosciences, USA).

Measurement of β-Hexosaminidase and Histamine Release Assays

Inhibitory effects on release and activity from HMC-1 cells were performed as previously described [15]. Briefly, to the β-hexosaminidase inhibition assays, HMC-1 cells were seeded at 2 × 106 cells/well and added Tyrode’s buffer (0.4 mM NaH2PO4, 1.8 mM CaCl2, 2.7 mM KCl, 5.6 mM glucose, 11.9 mM NaHCO3, and 137 mM NaCl; pH 7.2) and L. lactis LB 1022 (108 CFU/ml) for 30 min. Samples of 20 μl were then incubated at 37°C for 1 h with 30 μl of 1 mM p-nitrophenyl-N-acetyl-β-D-glucosaminide suspended in a 0.1 M citrate buffer. Finally, the samples were terminated to stop the reaction. The absorbance was measured at OD405 using an Infinite M200 microplate reader (Nano-quant). Histamine assay was conducted using a histamine ELISA kit (Cayman Chemical Company, USA). The absorbance was measured at OD405 with an Infinite M200 microplate reader (Nano-quant) and compared with a standard curve to identify the histamine levels.

Animal Studies

Female BALB/c mice (5 weeks old) were obtained from Central Laboratory Animal in Korea (Korea). The animals were maintained in hard-top cages (five mice per cage) under a 12-h light/dark cycle at a temperature of 22 ± 2°C and humidity of 50 ± 10%. The experiments were approved by the Animal Care Committee of Chung-Ang University (IACUC no. 2018-00022). The mice were distributed into three groups (n = 5 / group) as follows: control, OVA (Sigma-Aldrich; the AD-induced group), and L. lactis LB 1022 (AD + treatment with L. lactis LB 1022). To sensitive an AD immunological response and skin lesions, once a week, the hair on the dorsal skin of the mice was shaved. Six-week-old BALB/c mice were sensitized intraperitoneally with OVA (50 μg/ml) and alum (Sigma-Aldrich) at 1, 3, 5, and 7 weeks. The LB 1022 group received L. lactis LB 1022 (1 × 108 CFU) orally using a gavage for 8 weeks.

Dermatitis Scoring

The dermatitis score of AD on the dermal was scored twice a week as the sum of individual erythema, dryness, edema, and erosion/excoriation scores (0, none; 1, mild; 2, moderate; and 3, severe).

Quantitation of Serum IgE and Cytokine Levels

The levels of total IgE. IL-4, IL-5, IL-12, IL-10, IL-13, thymic stromal lymphopoietin (TSLP), IFN-γ, TNF-α, in the serum were measured using ELISA kits (R&D Systems; Abcam, USA). The absorbance was measured at OD450 and compared with a standard curve to calculate the cytokine levels.

Real-Time Quantitative PCR Analysis

Total RNA was extracted from skin material by a RNeasy Mini Kit (Qiagen, Germany) and the cDNA was synthesized using a PrimeScript 1st strand cDNA Synthesis Kit (Takara, Japan) following the manufacturer’s instructions and quantitatively analyzed with SYBR Green (Qiagen) using a QuantStudio 3 system. The 36B4 housekeeping gene was used as control. The primers used were presented in Table 1.

Table 1.

Primers used for quantitative real-time PCR in mice.

Gene Primers (5’-3’)
TGF-β Forward: GAAGGCAGAGTTCAGGGTCTT
Reverse: GGTTCCTGTCTTTGTGGTGAA
IL-10 Forward: CGGGAAGACAATAACTGCACCC
Reverse: CGGTTAGCAGTATGTTGTCCAGC
TARC Forward: AGAGCTGCTCGAGCCACCAATGTA
Reverse: CACCAATCTGATGGCCTTCTTCAC
Eotaxin Forward: GCGCTTCTATTCCTGCTGCTCACGG
Reverse: GTGGCATCCTGGACCCACTTCTTC
TSLP Forward: TGCAAGTACTAGTACGGATGGGGC
Reverse: GGACTTCTTGTGCCATTTCCTGAG
Open in a new tab

Histological Analysis

The dorsal skin tissue was collected and fixed with 10% formaldehyde solution and embedded in paraffin. Paraffin blocks were cut to a thickness of 4–5 μm and stained with hematoxylin and eosin solution (H&E; Sigma-Aldrich) for inflammation and Toluidine Blue solution (Sigma-Aldrich) for mast cells under a DM 4000B microscope (Leica Microsystem, Wetzlar).

Short-Chain Fatty Acid Analysis

To determine whether the SCFA levels are different between control, LB 1022, and OVA, stool samples were collected from each mouse at 8, 12, and 16 weeks and stored at −80°C. The samples were reconstituted in deionized water and passed through a membrane filter using Sep-Pak Vac cartridges (WAT054955; Waters, USA). Filtered samples were then analyzed using high-performance liquid chromatography (HPLC) by a refractive index detector (RefractoMAX520; ERC, Japan).

Statistical Analysis

All data were expressed as the mean ± SEM. GraphPad Prism (v.8.0) was used to visualize and analyze the data using Tukey’s multiple comparison tests. In vitro data were performed using Student’s t-test. Statistical significance is denoted as ***p < 0.001, ***p < 0.0001.

Results

L. lactis LB 1022 Suppresses the Production of NO Induced by LPS in RAW264.7 Cells

To evaluate the cell viability effect of L. lactis LB 1022, RAW 264.7 cells were incubated with L. lactis LB 1022 at the determined concentrations for 24 h. L. lactis LB 1022 was not cytotoxic to RAW 264.7 cells tested at 1 × 108 CFU with the MTT assay (Fig. 1). Next, to investigate the inflammatory effects of L. lactis LB 1022, the NO production by RAW264.7 cells due to LPS was assessed as an in vitro model. The results indicated that LPS significantly increased the NO production in RAW 264.7 cells (****p < 0.0001 vs. LPS), whereas L. lactis LB 1022 treatment significantly decreased (****p < 0.0001 vs. LPS; Fig. 1B).

Fig. 1. Effects of oral administration of L. lactis LB 1022 on the viability and NO production.

Fig. 1

Open in a new tab

(A) RAW264.7 cells were incubated with the indicated doses of L. lactis LB 1022 (1 × 108 CFU) for 24 h, and cell viability was performed by MTT assay. (B) RAW 264.7 cells were pre-incubated with L. lactis LB 1022 for 4 h, and then treated with 1 μg/ml LPS for an additional 24 h. NO production was analyzed using the Griess reaction. Statistical differences were assessed between OVA and Control/L. lactis LB 1022 by one-way ANOVA by Turkey’s post hoc tests as the mean ± SEM.

L. lactis LB 1022 Exhibits Anti-Allergy and Anti-Inflammatory Activity

To examine whether L. lactis LB 1022 has anti-allergic activity, the production of β-hexosaminidase was monitored. Untreated and pre-treated with L. lactis LB 1022 for 30 min were challenged with activator C48/80 (Sigma-Aldrich). The stimulated HMC-1 cells treated with L. lactis LB 1022 had β-hexosaminidase levels that were 73.7 ± 0.5% higher than that of the control (Fig. 2A). To determine whether L. lactis LB 1022 had a regulatory effect on the degranulation of mast cells, the activity of histamine was tested. The results revealed that L. lactis LB 1022 significantly reduced the release of histamine (Fig. 2B). In addition, L. lactis LB 1022 suppressed cytokine levels of IL-4, IL-5, IL-13, and TARC in HaCaT cells (Fig. 2C), indicating that L. lactis LB 1022 inhibited TARC activation, leading to the downregulation of Th2 cytokines.

Fig. 2. Inhibitory effects of L. lactis LB 1022 on β-hexosaminidase, histamine assays, and Th2-mediated inflammation.

Fig. 2

Open in a new tab

(A) β-hexosaminidase and (B) histamine release assays for HMC-1 cells. (C) Levels of chemokine (TARC) and Th2-related cytokines (IL-4 and IL-13) in TNF-α/IFN-γ-treated in HaCaT cells. Statistical differences between the control and L. lactis LB 1022 groups were assessed using unpaired 2-tailed t-tests or one-way ANOVA followed by Turkey’s post-hoc tests (mean ± SEM).

L. lactis LB 1022 Treatment Alleviates Clinical AD Symptoms in OVA-Induced AD Mice

The animal experimental process is illustrated in Fig. 3A. L. lactis LB 1022 mice group significantly reduced skin symptoms in OVA-induced AD mice model (Fig. 3B). The dermatitis scores in the L. lactis LB 1022 group were significantly decreased than OVA group (***p = 0.0008 at 12 weeks; ****p < 0.0001 at 16 weeks) (Fig. 3C). Itching behaviour was also monitored, and it was found that repeated topical application of L. lactis LB 1022 decreased the itchiness scores compared with OVA group after 12 weeks (***P = 0.0008), with a 2-fold decrease after 16 weeks (***p = 0.0002; Fig. 3D). Furthermore, total IgE was promoted in the OVA group compared with the control and L. lactis LB 1022 groups (Fig. 3E), which suggests that L. lactis LB 1022 leads to the inhibition of AD-like skin symptoms and AD pathology in OVA-induced AD mice.

Fig. 3. Changes in symptoms following oral administration of L. lactis LB 1022 in mice with OVA-induced atopic dermatitis (AD)-like symptoms.

Fig. 3

Open in a new tab

(A) Experimental design. The mice were sensitized with OVA for 8 weeks. After 8 weeks, the mice were fed LB 1022 for an additional 8 weeks. Dermatitis scores were measured at 4-week intervals. Statistical differences between the OVA and control/L. lactis LB 1022 groups were assessed using one-way ANOVA followed by Turkey’s post-hoc tests (mean ± SEM). *** p < 0.001; *** p < 0.0001.

L. lactis LB 1022 Treatment Alleviates Atopic Dermatitis Symptoms by Decreasing Mast Cell and Eosinophils Infiltration and Regulatory Epithelium-Derived Innate Cytokines in the Skin

OVA-induced mice exhibited AD-like lesions and hyperkeratosis in the skin. Oral administration of L. lactis LB 1022 decreases epidermal thickness (Fig. 4A). To evaluate the skin lesions in more detail, mast cells and eosinophils were stained with Toluidine Blue and H&E, respectively. The count of mast cells and eosinophils was significantly lower in the L. lactis LB 1022 group compared with OVA group (Figs. 4A–4D). Furthermore, the levels of TSLP and TARC were significantly lower in the L. lactis LB 1022 group (Figs. 4E and 4F). Interestingly, the mRNA levels of IL-10 and TGF-β were upregulated by L. lactis LB 1022 treatment (Figs. 4F and 4H). Thus, L. lactis LB 1022 suggested that TSLP and TARC are key players in the AD-like skin phenotype following treatment.

Fig. 4. Effects of the oral administration of L. lactis LB 1022 on dorsal skin inflammation in OVA-induced AD mice.

Fig. 4

Open in a new tab

(A, B) Mast cells in the dorsal skin of mice. Mast cells were stained with Toluidine Blue. (C, D) Eosinophils in the dorsal skin mice of mice. Eosinophils were stained with hematoxylin and eosin. (E) Relative TSLP, (F) TARC, (G) IL-10 and (H) TGF-β mRNA expression in skin evaluated by RT-PCR. Statistical differences between the OVA and Control/L. lactis LB 1022 groups were assessed using one-way ANOVA followed by Turkey’s post-hoc tests (mean ± SEM).

L. lactis LB 1022 Treatment Modulates Pro-Inflammatory Chemokine and Cytokine Levels

Serum levels of Th2 cytokines (IL-4, IL-5, IL-13, and TARC), a regulatory T cell (Treg) cytokine (IL-10), and a Th17 cytokine (IL-17A) were significantly suppressed in the L. lactis LB 1022 group compared to the control, whereas Th1 cytokines (IL-12 and IFN-γ) were present at higher levels (Figs. 5A–5F and 5H–5I). Moreover, the serum levels of eotaxin were decreased in the L. lactis LB 1022 group compared with OVA group (Fig. 5G).

Fig. 5. Effects of the oral administration of L. lactis LB 1022 on Th1, Th2, Th17, and Treg-associated cytokine production in serum.

Fig. 5

Open in a new tab

Protein levels of Th2-related cytokines (A) interleukin (IL)-4, (B) IL-5, (C) IL-13, and (D) TARC, Treg-associated cytokine (E) IL-10, Th17-related cytokine (F) IL-17A, (G) eotaxin, and Th1-related cytokines (H) IL-12 and (I) IFN-γ measured using an ELISA kit. Statistical differences between the OVA and Control/L. lactis LB 1022 groups were assessed using one-way ANOVA followed by Turkey’s post-hoc tests (mean ± SEM).

L. lactis LB 1022 Treatment Upregulated the SCFA Concentrations in OVA-Induced Mice

The probiotic strain, L. lactis, is used as a fermentation substrate by gut microbiota-derived metabolites, including acetic acid, butyric acid, and propionic acid. As shown in Fig. 6, L. lactis LB 1022 treatment remarkably upregulated concentrations of butyrate, propionate, valerate, and lactate, but the acetate levels were not statistically different.

Fig. 6. Effects of the oral administration of L. lactis LB 1022 on short-chain fatty acids (SCFAs) in the cecum.

Fig. 6

Open in a new tab

The concentration of (A) acetate, (B) butyrate, (C) propionate, (D) valerate, and (E) lactate measured using HPLC in AD mice. Statistical differences between the OVA and Control/L. lactis LB 1022 groups were assessed using one-way ANOVA followed by Turkey’s post-hoc tests (mean ± SEM).

Discussion

The bacterium L. lactis is widely used in dairy products and is extensively used to be a safety probiotic strain, with the discovery of new strains with starter culture properties further expanding its range of industrial applications [7]. In addition, various strains of L. lactis have recently been reported to show anti-inflammatory activity in vitro [16]. For example, oral administration of L. lactis ML2018 remarkably suppressed the expression of inflammatory factors in DSS-induced IBD mice [17]. However, while L. lactis has been widely studied in general, several studies have reported the potential effects of its strains on allergic disease. In this study, we isolated a new probiotic LB 1022 strain from natural cheese with probiotic properties, such as acid and bile tolerance and adherence. LB 1022 exhibited stronger anti-allergy and inflammatory characteristics than the control and was orally administered to an OVA-induced AD mice model to investigate whether it can alleviate AD-like lesions.

Previous studies have shown that dysbiosis of the intestinal microbiota leads to the development of atopic diseases by affecting Th2-related immune responses [18, 19]. Administration of L. lactis LB 1022 improved clinical AD symptoms, decreased serum IgE and suppressed the Th2 cytokines secretion, such as IL4, IL-13, and TSLP in blood, which are factors known to be elevated by AD. In our previous study, the oral administration of Lactococcus strains suppressed clinical phenotypes, improved gut microbial-derived metabolites, and regulated Th1/Th2 cytokines in AD mice [20, 21]. Similar to these results, L. lactis LB 1022 may have a protective effect against AD by reducing high IgE serum levels and Th2-related responses that arise from an imbalance in the gut microbiota.

AD is an inflammatory disease with complex pathogenesis that includes immune dysregulation. Innate immunity mechanisms, such as the regulation of Th1, Th2, Th17, and Treg, play a central role in the development of AD. In the present study, L. lactis LB 1022 suppressed cytokine levels associated with the Th2 (IL-4, IL-5, and IL-13), Th1 (IL-12 and IFN-γ), and Treg (IL-10) immune response, while also suppressing the production of TSLP/CCL17 and eotaxin/CCL11 compared with OVA group. Moreover, mRNA expression levels of TSLP and TARC were lower in the dorsal skin. Skin lesions in AD pathogenesis exhibit biphasic inflammation with initial Th2 and chronic Th1 phases [22]. In the initial stage of tissue inflammation, the Th2 immune response contributes to the secretion of IL-4, IL-5, and IL-13 with increased IgE levels [23]. IL-4 plays a crucial role in the pathogenesis of AD via Th2 immunity, IgE switch, and mast cell and eosinophil recruitment, which are involved in itching, dryness and erythema during allergic antigens exposure [24].

Th1 immune responses, including IFN-γ and IL-12, are higher in chronic AD symptoms, with elevated Th2 cytokine levels in acute AD lesions [23]. In addition, Tregs are closely associated with immune suppression and are essential to the control of allergic responses [25]. In the allergic response, Tregs migrate from inflammatory tissue to draining lymph nodes and regulate the inhibition of the Th2 immune response [26]. Consequently, our results suggest that L. lactis LB 1022 ameliorates the symptoms exhibited by OVA-induced AD mice by alleviating the imbalance in Th1/Th2 and suppressing allergic inflammation.

SCFAs, including acetate, butyrate, propionate, valerate, and lactate, are the main metabolites produced in the intestine from the microbial fermented dietary fiber and have a central role in maintaining gut homeostasis and the gut barrier [27]. Compromised epithelial barrier integrity has been reported to be associated with diseases such as AD, asthma, and autoimmunity. Furthermore, SCFAs have been identified to have anti-inflammatory abilities, including promoting Tregs expression [28]. Previously, we reported that OVA-induced gut dysbiosis is associated with AD by reducing SCFA production. [29]. Similarly, our results showed that OVA-induced AD mice had lower SCFA production, which recovered with the administration of L. lactis LB 1022. These results indicate that L. lactis LB 1022 can improve SCFA production and is related to the regulation of allergic responses induced by Treg and Th2 immunity. This study highlights the potential feature of L. lactis as a functional ingredient to ameliorate allergic dermatitis symptoms by promoting gut microbiota-derived metabolites.

Acknowledgments

This work was supported by a National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (NRF-2021R1C1C2003223 and NRF-2022R1A2C2012209).

Footnotes

Authors Contributions

WK conceived and designed the study. WK and J-HK carried out the statistical analyses. JB and J-HK performed the experiments and drafted the manuscript, with major input from WK.

Conflict of Interest

The authors have no financial conflicts of interest to declare.

References

  • 1.Zhu TH, Zhu TR, Tran KA, Sivamani RK, Shi VY. Epithelial barrier dysfunctions in atopic dermatitis: a skin-gut-lung model linking microbiome alteration and immune dysregulation. Br. J. Dermatol. 2018;179:570–581. doi: 10.1111/bjd.16734. [DOI] [PubMed] [Google Scholar]
  • 2.Petersen EBM, Skov L, Thyssen JP, Jensen P. Role of the gut microbiota in atopic dermatitis: A systematic review. Acta Derm. Venereol. 2019;99:5–11. doi: 10.2340/00015555-3008. [DOI] [PubMed] [Google Scholar]
  • 3.Lee SY, Lee E, Park YM, Hong SJ. Microbiome in the gut-skin axis in atopic dermatitis. Allergy Asthma Immunol. Res. 2018;10:354–362. doi: 10.4168/aair.2018.10.4.354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Yamamoto K, Yokoyama K, Matsukawa T, Kato S, Kato S, Yamada K, et al. Efficacy of prolonged ingestion of Lactobacillus acidophilus L-92 in adult patients with atopic dermatitis. J. Dairy Sci. 2016;99:5039–5046. doi: 10.3168/jds.2015-10605. [DOI] [PubMed] [Google Scholar]
  • 5.Reddel S, Del Chierico F, Quagliariello A, Giancristoforo S, Vernocchi P, Russo A, et al. Gut microbiota profile in children affected by atopic dermatitis and evaluation of intestinal persistence of a probiotic mixture. Sci. Rep. 2019;9:4996. doi: 10.1038/s41598-019-41149-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Anania C, Brindisi G, Martinelli I, Bonucci E, D'Orsi M, Ialongo S, et al. Probiotics function in preventing atopic dermatitis in children. Int. J. Mol. Sci. 2022;23:5409. doi: 10.3390/ijms23105409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Song AA, In LLA, Lim SHE, Rahim RA. A review on Lactococcus lactis: from food to factory. Microb. Cell Fact. 2017;16:55. doi: 10.1186/s12934-017-0669-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ghasemzadeh J, Shekooh Saljughi Z, Akbary P, Hasani M. Effects of dietary probiotic, Lactococcus lactis "subspecies PTCC 1403" on the growth parameters and survival rate of grey mullet (Mugil cephalus L.) against Lactococcus garvieae bacteria. J. Anim. Environ. Sci. 2018;10:367–374. [Google Scholar]
  • 9.Yoshida A, Aoki R, Kimoto-Nira H, Kobayashi M, Kawasumi T, Mizumachi K, et al. Oral administration of live Lactococcus lactis C59 suppresses IgE antibody production in ovalbumin-sensitized mice via the regulation of interleukin-4 production. FEMS Immunol. Med. Microbiol. 2011;61:315–322. doi: 10.1111/j.1574-695X.2010.00777.x. [DOI] [PubMed] [Google Scholar]
  • 10.Cervantes-Garcia D, Jimenez M, Rivas-Santiago CE, Gallegos-Alcala P, Hernandez-Mercado A, Santoyo-Payan LS, et al. Lactococcus lactis NZ9000 prevents asthmatic airway inflammation and remodelling in rats through the improvement of intestinal barrier function and systemic TGF-beta production. Int. Arch. Allergy Immunol. 2021;182:277–291. doi: 10.1159/000511146. [DOI] [PubMed] [Google Scholar]
  • 11.Konkit M, Choi WJ, Kim W. Alcohol dehydrogenase activity in Lactococcus chungangensis: application in cream cheese to moderate alcohol uptake. J. Dairy Sci. 2015;98:5974–5982. doi: 10.3168/jds.2015-9697. [DOI] [PubMed] [Google Scholar]
  • 12.Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA, Olsen GJ. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl. Environ. Microbiol. 2008;74:2461–2470. doi: 10.1128/AEM.02272-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Robbins KS, Greenspan P, Pegg RB. Effect of pecan phenolics on the release of nitric oxide from murine RAW 264.7 macrophage cells. Food Chem. 2016;212:681–687. doi: 10.1016/j.foodchem.2016.06.018. [DOI] [PubMed] [Google Scholar]
  • 14.Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods. 1983;65:55–63. doi: 10.1016/0022-1759(83)90303-4. [DOI] [PubMed] [Google Scholar]
  • 15.Kim JH, Kim W. Alleviation effects of Rubus coreanus Miquel root extract on skin symptoms and inflammation in chronic atopic dermatitis. Food Funct. 2022;13:2823–2831. doi: 10.1039/D1FO03580K. [DOI] [PubMed] [Google Scholar]
  • 16.Luerce TD, Gomes-Santos AC, Rocha CS, Moreira TG, Cruz DN, Lemos L, et al. Anti-inflammatory effects of Lactococcus lactis NCDO 2118 during the remission period of chemically induced colitis. Gut Pathog. 2014;6:33. doi: 10.1186/1757-4749-6-33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Liu M, Zhang X, Hao Y, Ding J, Shen J, Xue Z, et al. Protective effects of a novel probiotic strain, Lactococcus lactis ML2018, in colitis: in vivo and in vitro evidence. Food Funct. 2019;10:1132–1145. doi: 10.1039/C8FO02301H. [DOI] [PubMed] [Google Scholar]
  • 18.Penders J, Stobberingh EE, van den Brandt PA, Thijs C. The role of the intestinal microbiota in the development of atopic disorders. Allergy. 2007;62:1223–1236. doi: 10.1111/j.1398-9995.2007.01462.x. [DOI] [PubMed] [Google Scholar]
  • 19.Kim HJ, Lee SH, Hong SJ. Antibiotics-induced dysbiosis of intestinal microbiota aggravates atopic dermatitis in mice by altered short-chain fatty acids. Allergy Asthma Immunol. Res. 2020;12:137–148. doi: 10.4168/aair.2020.12.1.137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Choi WJ, Konkit M, Kim Y, Kim MK, Kim W. Oral administration of Lactococcus chungangensis inhibits 2,4-dinitrochlorobenzene-induced atopic-like dermatitis in NC/Nga mice. J. Dairy Sci. 2016;99:6889–6901. doi: 10.3168/jds.2016-11301. [DOI] [PubMed] [Google Scholar]
  • 21.Kim JH, Kim K, Kim W. Cream Cheese-Derived Lactococcus chungangensis CAU 28 modulates the gut microbiota and alleviates atopic dermatitis in BALB/c mice. Sci. Rep. 2019;9:446. doi: 10.1038/s41598-018-36864-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Bieber T. Atopic dermatitis: an expanding therapeutic pipeline for a complex disease. Nat. Rev. Drug Discov. 2022;21:21–40. doi: 10.1038/s41573-021-00266-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yamanaka K-i, Mizutani H. The role of cytokines/chemokines in the pathogenesis of atopic dermatitis. Curr. Probl. Dermatol. 2011;41:80–92. doi: 10.1159/000323299. [DOI] [PubMed] [Google Scholar]
  • 24.Brandt EB, Sivaprasad U. Th2 cytokines and atopic dermatitis. J. Clin. Cell. Immunol. 2011;2:110. doi: 10.4172/2155-9899.1000110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Smits HH, Engering A, van der Kleij D, de Jong EC, Schipper K, van Capel TM, et al. Selective probiotic bacteria induce IL-10-producing regulatory T cells in vitro by modulating dendritic cell function through dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin. J. Allergy Clin. Immunol. 2005;115:1260–1267. doi: 10.1016/j.jaci.2005.03.036. [DOI] [PubMed] [Google Scholar]
  • 26.Zhang N, Schroppel B, Lal G, Jakubzick C, Mao X, Chen D, et al. Regulatory T cells sequentially migrate from inflamed tissues to draining lymph nodes to suppress the alloimmune response. Immunity. 2009;30:458–469. doi: 10.1016/j.immuni.2008.12.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Koh A, De Vadder F, Kovatcheva-Datchary P, Backhed F. From dietary fiber to host physiology: Short-chain fatty acids as key bacterial metabolites. Cell. 2016;165:1332–1345. doi: 10.1016/j.cell.2016.05.041. [DOI] [PubMed] [Google Scholar]
  • 28.Maslowski KM, Vieira AT, Ng A, Kranich J, Sierro F, Yu D, et al. Regulation of inflammatory responses by gut microbiota and chemoattractant receptor GPR43. Nature. 2009;461:1282–1286. doi: 10.1038/nature08530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kim JH, Kim K, Kim W. Gut microbiota restoration through fecal microbiota transplantation: a new atopic dermatitis therapy. Exp. Mol. Med. 2021;53:907–916. doi: 10.1038/s12276-021-00627-6. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Microbiology and Biotechnology are provided here courtesy of Korean Society for Microbiology and Biotechnology

RESOURCES