Skip to main content
ZooKeys logoLink to ZooKeys
. 2023 Jul 4;1168:367–386. doi: 10.3897/zookeys.1168.98724

A new species of the Cyrtodactylusquadrivirgatus complex (Chordata, Reptilia, Squamata, Gekkonidae) from Sumatra Barat, Indonesia

Yuni Ahda 1,✉, Fitra Arya Dwi Nugraha 1, Djong Hon Tjong 2, Nia Kurniawan 3, Yunico Amardi 1, Muhammad Alif Fauzi 3, Si-Min Lin 4
PMCID: PMC10336721  PMID: 37448483

Abstract

Among the six species of Cyrtodactylus occurring in Sumatra, two species were described based on non-Sumatran type series, C.consobrinus and C.quadrivirgatus. The latter species was described originally from Thailand thus the wider distribution in Sumatra should be clarified taxonomically. Cyrtodactylusquadrivirgatus from Sumatra Barat was examined using both morphology and the Natrium Dehydrogenase Subunit 2 (ND2) gene to clarify its taxonomic status and phylogenetic placement. It was found that these specimens form a sister clade to all other species of the sworderi group from Peninsular Malaysia and the genetic distance ranges from 20–24.3%. This subset is herein described as a new species. The new species is readily distinguished from C.quadrivirgatus and other Sumatran species by a combination of characters: small size SVL 37.5–53.78 mm; longitudinal rows of dorsal tubercles 16–19; paravertebral tubercles 31–41; ventral scales 32–43; 24–49 enlarged precloacal and femoral scales; precloacal pores rarely present; no precloacal depression; two postcloacal tubercles on each side; 14–19 subdigital lamellae on forth toe; 9–15 supralabial scales; 9–12 infralabial scales; three or four internasal scales; and 3–6 gular scales that border the first pair of postmental scales. This work underscores the importance of clarifying widely distributed species for taxonomic validation.

Key words: Distribution, evolution, molecular, morphology, ND2 gene, systematics, taxonomy

Introduction

Cyrtodactylusquadrivirgatus Taylor, 1962 was originally described from Khao Chong Forest Experiment Station, Trang Province, Thailand. It ranges from southern Thailand, Peninsular Malaysia and adjacent islands, Singapore to northern Sumatra (Grismer 2011) and Mentawai islands (Teynie et al. 2010), from sea level to 1400 m above sea level (Johnson et al. 2012).

Along Peninsular Malaysia, the populations of C.quadrivirgatus exhibit coloration differences among different localities. The south population has four dark dorsal stripes, the upland population has two dorsolateral stripes and medial blotches, and the other populations possess only blotches instead of stripes. Although there was obvious variation among populations, the ND2 p-distance showed that they were separated from each other by 3.3%–5.8% (Johnson et al. 2012).

Meanwhile, the population from Sumatra was not examined either morphologically or molecularly, leaving this population unknown in term of its taxonomic status and phylogenetic placement. We began surveying Cyrtodactylus Gray, 1827 in Sumatra Barat Province in 2020 and found them from lower elevations, approximately 8 m a.s.l. to 712 m a.s.l. Through careful examination, we wanted to establish whether C.quadrivirgatus from Sumatra Barat should be treated as a distinct species and into which lineage it fell.

Material and methods

Sampling and preservation

Field surveys were undertaken in the province of Sumatra Barat: Lembah Anai Nature Reserve (LANR) (0°29'24"S, 100°20'24"E), around Sarasah Gasang waterfall (SG) (0.31°S, 100.23°E), around Sungai Sirah village (SS) (0°24'8.8128"S, 100°8'37.6728"E), around Sarasah Uwak waterfall (0°54'28"S, 100°28'54"E) and in Bungus Selatan village (1°02'20"S, 100°24'50"E). Individuals were all collected during the night from 19.00–23.00 hours by hand. Anaesthetization and euthanization were done using benzocaine and fixation using 10% formalin. The specimens were stored in 70% alcohol and the livers were stored in 95% ethanol. All photographs were deposited at the Department of Biology, Universitas Negeri Padang, Indonesia (UNP). All specimens will be deposited at Museum Zoologicum Bogoriense, Bogor, Indonesia (MZB).

Morphological analysis

Color notes were observed from digital images of living individuals prior to preservation. If in case the individual displayed stress coloration, we placed them in the cage mimicking the natural habitat and waited until the natural coloration appeared. The individuals under the stress condition showed black coloration along their dorsum, causing the disappearance of the black stripes and bands on the dorsum.

The following measurements were taken with a dial caliper to the nearest 0.5 mm following Hartmann et al. (2016) and Johnson et al. (2012):

SVL Snout-vent length, measured from the tip of snout to the vent;

AX Axial length, measured from the posterior margin of the forelimb at its insertion point on the body to the anterior margin of the hind limb at its insertion point on the body;

TL Tail length, measured from the vent to the tip of the tail, original or regenerated;

AL Arm length, measured insertion of antebrachium with body wall to claw of longest finger;

LL Leg length, measured insertion of femur with body wall to claw of longest toe;

HL Head length, measured from tip of snout to articulation of quadrate bone;

HW Head width, measured at level of ear openings;

HH Head height, measured at level of ear opening;

SL Snout length, measured from tip of snout to anterior margin of orbit;

OEL Orbit-ear length, measured from posterior margin of orbit to anterior margin of ear opening;

OD Orbit diameter, measured from anterior to posterior margin of orbit;

EL Ear length, measured from anterior to posterior margin of ear opening;

ML Mental length, maximum length of mental shield;

IN Internarial distance, measured between the nares across the rostrum;

EN Eye to nostril distance, measured between the anterior margin of the eyeball to the posterior margin of the external nares.

Meristic counts included:

DTR Dorsal tubercles, number of tubercle rows on dorsum at midbody, counted in one row between lateral folds;

PVT Paravertebral tubercles, number of tubercles counted in a longitudinal row between posterior insertion of fore limb and anterior insertion of hind limb;

VS Ventral scales, number of ventral scales at midbody, counted in one row between lateral folds;

EPFS Enlarged precloacal and femoral scales, number of enlarged precloaco-femoral scales, counted along lowest, pore-bearing row;

PP Precloacal pores, number of precloacal pores;

PFP Precloacal and femoral pores, number of precloaco-femoral pores;

PCT Postcloacal tubercles, number of postcloacal tubercles;

LT4 Subdigital lamellae under 4th toe, subdigital scales under 4th toe, counted from first enlarged scale (true lamellae) on lower side of toe to scale proximal to apical scale;

SLL Left supralabial, labial scales of upper jaw, beginning with first enlarged scale bordering rostral shield, ending with last enlarged scale bordering labial angle for left side;

SLR Right supralabial, labial scales of upper jaw, beginning with first enlarged scale bordering rostral shield, ending with last enlarged scale bordering labial angle for right side;

ILL Left infralabial, labial scales of lower jaw, beginning with first scale bordering mental shield, ending with last enlarged scale bordering labial angle for left side;

ILR Right infralabial, labial scales of lower jaw, beginning with first scale bordering mental shield, ending with last enlarged scale bordering labial angle for right side;

IN Internasal scales, number of scales between rostronasals, bordering rostral shield;

GUL Gular scales, number of gular scales bordering pair of 1st postmentals (excluding enlarged second 2nd postmentals).

To make clear the counting of scales (supralabials and infralabials, precloaco-femoral scales) and detecting the presence of pores, we used a staining technique with methylene blue in 70% alcohol (Harvey et al. 2015). We determined male specimens by the enlarge hemipenial pockets and then confirmed the identification by making a small incision laterally at the base of the tail (Riyanto et al. 2021).

Laboratory protocols

Total genomic DNA was extracted from the livers using the Qiagen DNeasy tissue kit (Valencia, CA, USA) following the standard protocol for animal tissue. The amplification of the Natrium Dehydrogenase Subunit 2 (ND2) gene and partial flanking tRNAs was done by using Polymerase Chain Reaction (PCR) under the following condition: 2 min at 95 °C followed by 33 cycles of 95 °C for 35 s, annealing at 54 °C for 35 s, extension at 72 °C for 35 s and a final extension step of 10 min at 72 °C. Amplifications were carried out in 25-µl volume vials consisting of 2.5 µl genomic DNA (concentration: approximately 100 ng), 0.4 µм each primer and 1× GoTaq Green Master Mix (Promega, Wisconsin, USA). The primers used in this study followed Macey et al. (1999a): L4437b (5’–AAGCAGTTGGGCCCATACC–3’) and L5002 (5’–AACCAAACCCAACTACGAAAAAT–3’). The PCR product was then sent to the sequencing service 1st BASE (https://base-asia.com/) through Genetika Science Indonesia Limited Liability Company. The previous two primers were also used for sequencing.

Phylogenetic reconstruction

Sequences were uploaded, assembled, and edited in Geneious Prime 2022.2.2 (http://www.geneious.com/). All sequences, ingroup and outgroup (Table 1), were aligned using CLUSTALW implemented in CIPRES Science Gateway. The fasta output of alignment was used for RAxML and uncorrected p-distance calculation. We reconstructed phylogenetic relationships using maximum likelihood analysis that was performed using RAxML HPC Black Box (1000 bootstrap replicates) implemented in CIPRES Science Gateway portal (Miller et al. 2010; accessed through https://www.phylo.org/). Nodal support with bootstrap value ≥ 70 was considered as significantly supported (Hillis and Bull 1993). The tree resulted from RAxML was visualised and edited in iTOL v. 6 (Letunic and Bork 2021; available at https://itol.embl.de/) and in Photoshop C6 64-bit. We also calculated uncorrected p-distances using MEGA 7 with delete option for the gaps (Kumar et al. 2016).

Table 1.

Species of Cyrtodactylus used in the phylogenetic reconstruction including localities and GenBank accession numbers of the mitochondrial NADH dehydrogenase subunit 2 gene. PM= Peninsular Malaysia; Gn.= Gunung.

Species Locality Museum number Accession number Source
agamensis group
C.metropolis Batu caves, Selangor, PM LSUHC 11343 KU253579 Grismer et al. 2016
C.payacola Bukit Panchor, Penang, PM LSUHC 10070 JQ889190 Johnson et al. 2012
C.majulah Nee Soon Swamp, Singapore ZRC 26951 JX988529 Grismer et al. 2013
C.pantiensis Gn. Panti, Johor, PM LSUHC 8905 JQ889186 Johnson et al. 2012
C.tiomanensis Pahang, PM LSUHC 6251 JX440563 Wood et al. 2012
C.rosichonariefi Bunguran, Great Natuna, Indonesia MZB Lace 12132 KP256187 Riyanto et al. 2015
C.psarops Indonesia MZB 9687 MH248931 O’Connell et al. 2019
C. sp. 3 Indonesia ENS 18140 MH248911 O’Connell et al. 2019
C. sp. 4 Indonesia ENS 18591 MH248912 O’Connell et al. 2019
C. sp. 5 Indonesia ENS 18659 MH248916 O’Connell et al. 2019
C. sp. 6 Indonesia ENS 18719 MH248917 O’Connell et al. 2019
C.semenanjungensis Gn. Panti, Johor, PM LSUHC 8900 JQ889177 Johnson et al. 2012
C.semicinctus Indonesia ENS 14749 MH248925 O’Connell et al. 2019
C. cf. agamensis Indonesia ENS 19634 MH248908 O’Connell et al. 2019
sworderi group
C.quadrivirgatus Bukit Larut, Perak, PM LSUHC 8859 JQ889241 Johnson et al. 2012
C.guakanthanensis Gua Kanthan, Perak, PM LSUHC 11323 KU253577 Grismer et al. 2016
C.tebuensis Gn. Tebu, Terengganu, PM LSUHC 10902 JX988527 Wood et al. 2012
C.sworderi Sungai Kawal, Peta, PM LSUHC 7685 JQ889189 Johnson et al. 2012
C.gunungsenyumensis Hutan Lipur Gn. Senyum, Pahang, PM LSUHC 12201 KU253585 Grismer et al. 2016
C.awalriyantoi sp.nov. Sungai Geringging, Padang Pariaman UNP 153 OR122991 This study
UNP 161 OR122987
UNP 162 OR122988
UNP 163 OR122989
UNP 164 OR122990
lateralis group
C.lateralis Indonesia UTA 62916 KU893163 Harvey et al. 2016
C.rubidus – CES 131445 KM255203 Agarwal et al. 2014
C.durio Malaysia LSUHC 9725 KU893159 Harvey et al. 2016
marmoratus group
C.marmoratus Indonesia ENS 15932 KR921721 Harvey et al. 2015
C.papuensis – SAMA R62652 JQ820320 Oliver et al. 2012
C. sp. 1 Indonesia ENS 15813 KR921697 Harvey et al. 2015
C. sp. 2 Indonesia ENS 15784 KR921689 Harvey et al. 2015
darmandvillei group
C.batucolus Pulau Besar, Melaka, PM LSUHC 8934 JQ889179 Johnson et al. 2012
C.petani Pasuruan, Jawa Timur, Indonesia MZB Lace 11706 KU232620 Grismer et al. 2016
C.kimberleyensis Siuna, Sulawesi Tengah, Pulau Sulawesi, Indonesia WAM R164144 JX440544 Wood et al. 2012
C.jellesmae Siuna, Sulawesi Tengah, Pulau Sulawesi, Indonesia RMB 1672 GU550721 Siler et al. 2010
C.sadleiri Christmas island, Australia SAMA R34810 JQ820309 Oliver et al. 2012
C.seribuatensis Pulau Nangka Kecil, Johor, PM LSUHC 6349 JQ889187 Johnson et al. 2012
C.darmandvillei Nusa Tenggara Barat, Indonesia WAM R98393 JX440533 Wood et al. 2012
Outgroup
Hemidactylusfrenatus – LLG 4871 GQ458049 Murthy et al. 2015
Gekkogecko Thailand: Patong Beach, Kathu District, Phuket Island, Phuket Province MVZ 215314 AF114249 Macey et al. 1999b

Results

Phylogenetic relationship of Cyrtodactylus from Sumatra Barat

We used 969–1005 bases of ND2 gene sequence from the new putative species to build a ML phylogenetic tree. Our ML tree (Fig. 1) showed that the new putative species is a sister clade of the sworderi group from Peninsular Malaysia (BS = 94) and it is a new member of sworderi group. The new putative species significantly formed a group (BS = 100). The uncorrected pairwise distance within this new putative species for ND2 gene is 0–0.5%. The distance from other species in the sworderi group ranges from 20% to 24.3% and from the agamensis group more than 30% (Table 2). Given these results, we further examined the morphological characters and found several distinctive characters. This subset is herein described as a new to science.

Figure 1.

Figure 1.

The maximum likelihood (ML) tree topology of the new species with other Cyrtodactylus inferred by ND2 gene sequences. The bold name within the sworderi group indicates new species that is being described. The numbers beneath the branches are bootstrap values.

Table 2.

Uncorrected p-distance (in %) of the ND2 gene calculated for the new species and sworderi and agamensis groups. For the accession numbers for each species, refer to Table 1.

No. Species 1 2 3 4 5 6 7 8
1 C.awalriyantoi sp. nov. 0–0.5
2 C.quadrivirgatus 20–20.6
3 C.guakanthanensis 22.8–23.5 19.5
4 C.sworderi 23.7–24.3 21.7 15.2
5 C.tebuensis 20.9–21.5 20.2 13.4 17.1
6 C.gunungsenyumensis 22.5–23.2 20.4 14.3 17.1 7.7
7 C.semenanjungensis 32.3–33.1 26.5 31.4 32.1 30.4 28.3
8 C.semicinctus 30.4–31.1 23.4 25.4 28.6 29.2 26.8 17.3
9 C.psarops 33.6–34.3 27.4 28.3 35 31.3 26.8 26.1 22.7

Taxonomy

. Cyrtodactylus awalriyantoi sp. nov.

E415127D-8B5F-576C-A05B-5F7BACB9AF72

https://zoobank.org/0D596952-07C2-439C-930C-D96C01C03F7C

Figs 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 Recommended English common name: Awal Riyanto’s Bent-toed Gecko Recommended Indonesia common name: Cicak Jari Lengkung Awal Riyanto

Figure 2.

Figure 2.

The holotype specimen (UNP070), adult male, of Cyrtodactylusawalriyantoi sp. nov. in preservation color. Scale bars: 10 mm.

Figure 3.

Figure 3.

Representative type series of C.awalriyantoi sp. nov. after preservation. UNP070 (male); UNP075 (female); UNP066 (male); UNP065 (male); UNP103 (female). Scale bars: 10 mm; upper for dorsal view and lower for ventral view.

Figure 4.

Figure 4.

The head of holotype specimen (UNP070) of Cyrtodactylusawalriyantoi sp. nov. A dorsal view B ventral view C, D lateral views of right and left, respectively. Images not to scale.

Figure 5.

Figure 5.

Ventral view of head showing second postmental variations in which they attach to the supralabials and variation in number of smaller scales separating them A UNP067 B UNP073 C UNP070 D UNP142 E UNP069 F UNP072. Images not to scale.

Figure 6.

Figure 6.

Trunk in A dorsal B ventral C ventrolateral views of holotype specimen (UNP070).

Figure 7.

Figure 7.

Tail in dorsal A and ventral B views, precloacal and femoral view (C) and ventral of 4th toe (D). All images from holotype specimen (UNP070). Images not to scale.

Figure 8.

Figure 8.

Coloration in life of C.awalriyantoi sp. nov. A, B UNP142 C, D UNP143 E, F UNP153 G, H 162 I, J unvouchered specimen. Images not to scale.

Figure 9.

Figure 9.

Habitat type of Cyrtodactylusawalriyantoi sp. nov. in Sarasah Gasang Waterfall (A) and Lembah Anai Nature Reserve (B).

Type material.

Holotype. Adult male, UNP070 (Fig. 2), collected from Sarasah Gasang waterfall (0°18'24.25"S, 100°13'45.15"E), Maninjau village, sub-district Tanjung Raya, regency of Agam by Y. Amardi, F. Lestari, and M. Kentino on 31 October 2020 at c. 08.30 pm. Paratypes (N = 17). Four individuals: three females (UNP103, 142, 143) and one male (UNP104), were collected from Lembah Anai Nature Reserve (0°29'24"S, 100°20'24"E), Singgalang village, Sepuluh Koto sub-district, Regency of Tanah Datar, province of Sumatra Barat by M. Rafi, K. Agusdi, F. Rozi, K. Agusdi, and F. A. D. Nugraha on 15 February 2022. Nine individuals: 5 females (UNP069, 075, 073, 067, 072) and 3 males (UNP066, 065, 071) collected from the same locality as holotype. Five individuals: 1 female (UNP153) and 4 males (UNP161, UNP162, UNP163, UNP164) collected from Sungai Sirah village (0°24'8.8128"S, 100°8'37.6728"E), sub-district Sungai Geringging, district Padang Pariaman on 7 May 2022 by M. Rafi and Y. Amardi.

Diagnosis.

Cyrtodactylusawalriyantoi sp. nov. is assigned to the sworderi group based on its phylogenetic position (Fig. 1) and the genetic distances to other congenerics (Table 2). This new species can be differentiated from all other Cyrtodactylus by having the following combination of characters: a small size, SVL 37.5–53.78 mm; axilla to groin distance 16.65–24.31 mm; head width 6.21–8.45 mm; longitudinal rows of dorsal tubercles 16–19; paravertebral tubercles 31–41; ventral scales 32–43; 24–49 enlarged precloacal and femoral scales; precloacal pores rarely present, maximum only two pores in one individual (only two individuals possessed pores); no precloacal groove or depression; postcloacal tubercles two on each side; 14–19 subdigital lamellae on fourth toe; 9–15 supralabial scales; 9–12 infralabial scales; 3–4 internasal scales; and 3–6 gular scales that bordered first pair of postmental scales.

Comparison.

This species is the smallest Cyrtodactylus species inhabiting Sumatra with the maximum SVL of adult individual of 53.78 mm. It can be distinguished from other Cyrtodactylus as follows:

  1. C.quadrivirgatus by having following combination of characters: shorter maximum SVL (53.78 vs. 67 mm); shorter maximum length of axilla to groin (24.31 vs. 34 mm); shorter maximum length of tail (54.77 vs. 77 mm); shorter maximum length of arm (19.47 vs. 21 mm); shorter maximum length of leg (22.75 vs. 26 mm); shorter maximum length of head (15.42 vs. 18 mm); shorter maximum width of head (8.45 vs. 13 mm); shorter maximum length of snout to arm (21.43 vs. 32 mm); fewer DTR (16–19 vs. 24); maximum number of PVT is 41 (vs. 39); 2 precloacal pores (only in two specimens), mostly lack of pores in femoral and precloacal (vs. up to 12); fewer subdigital lamellae on 4 th toe (14–19 vs. 18–23); maximum number of supralabial (15 vs. 11); maximum number of IN scales is 4 (vs. 3); and lack of black stripe between eyes and naris (vs. present).

  2. C.psarops by lower number of DTR (16–19 vs. 28–38); greater number of PVT (31–41 vs. 23–26); minimum number of VS of 32 (vs. 38); number of PCT (2 on each side vs. 1 on each side); fewer subdigital lamellae on 4 th toe (14–19 vs. 18–22); lacking precloacal groove/depression (vs. present); pores rarely present and maximum of 2 pores (vs. 28–32); lacking U-shaped band on occiput/nuchal; and having extended lateral stripe (vs. lacking).

  3. C.semicinctus by lower number of DTR (16–19 vs. 29–35); maximum number of PVT of 41 (vs. 35); maximum number of VS of 40 (vs. 44); maximum number of PCT of 2 on each side (vs. 3 on each side); fewer subdigital lamellae on 4 th toe (14–19 vs. 19–22); lacking precloacal depression (vs. present); pores rarely present and maximum of 2 pores (vs. 36–38); brachium tuberculated (vs. not tuberculated); and having extended lateral stripe (vs. lacking).

  4. C.lateralis by having more PVT (31–41 vs. 21–28); fewer VS (32–43 vs. 51–66); 0–2 precloacal pores and rarely present (vs. 9–15); fewer subdigital lamellae on 4 th toe (14–19 vs. 18–24); lacking spinose tubercles in caudal region, conical tubercles in the ventrolateral fold; and lacking a prehensile tail.

  5. C.consobrinus by having fewer VS (32–43 vs. 58–65); fewer precloacal pores (0–2 vs. 9–10); fewer subdigital lamellae on 4 th toe (14–19 vs. 23–28); lacking narrow light line like network on the head; having extended lateral stripe (vs. lacking); and lacking white crossbands on the dorsum.

  6. C.agamensis by lower number of DTR (16–19 vs. 50–67); greater maximum number of PVT (41 vs. 37); pores rarely present and maximum of two pores (vs. 9–10); lower number of subdigital lamellae under the 4 th toe (14–19 vs. 21–26); 15 supralabial scales (vs. 13); and having four dorsal stripes (vs. absence).

C.awalriyantoi sp. nov. has unique morphological combination and can be separated from other congeners within the sworderi group as follows:

  1. C.gunungsenyumensis by shorter SVL (37.5–53.78 mm vs 65.1–74.7 mm); fewer subdigitall lamellae on fourth toe (14–19 vs 20–23); and more enlarged precoloaco femoral scales (24–49 vs 31–39).

  2. C.tebuensis by shorter SVL (37.5–53.78 mm vs 73.1–84.1 mm); fewer ventral scales (32–43 vs 43–51); fewer subdigital lamellae on fourth toe (14–19 vs 17–21); more infralabial scales (9–12 vs 8–10); and more enlarged precoloaco femoral scales (24–49 vs 31–38).

  3. C.sworderi by shorter SVL (37.5–53.78 mm vs 69–80 mm); and fewer ventral scales (32–43 vs 42–49)

  4. C.guakanthanensis by shorter SVL (37.5–53.78 mm vs 82.2 mm); more supralabial (9–15 vs 9–10); more infralabials (9–12 vs 7–8); fewer subdigital lamellae on fourth toe (14–19 vs 19–21); and more enlarged precloaco-femoral scales (24–49 vs 36–41).

Description (and variation).

Small-sized Cyrtodactylus with SVL of 37.5–53.78 mm; the length of the tail is 31.4–54.77 mm including the original or regenerated tip; the axial body length is 16.65–24.31 mm (Fig. 3). The head is triangular in dorsal view with moderate length (HL/SVL= 0.25–0.31), wide (HW/HL 0.52–0.63), and slightly flattened (HH/HL= 0.29–0.45), distinguishable from neck; medium length of snout (SL/HL 0.33–0.45) and rounded; snout longer than eye diameter (SL/OD 1.38–2.03); eyes large (OD/HL 0.18–0.27); ear openings oval and small (EL/HL 0.02–0.1); eye to ear distance greater than diameter of eye (OEL/OD 0.89–1.54); postorbital and around ear region consists of enlarged tubercles; scales on post nasal to preorbital and post-rostral to frontal region slightly larger in size than scales on the parietal part and occiput; region of parietal containing small scales intermixed with weak, scattered, rounded tubercles while occiput region contained slightly enlarged tubercles (Fig. 4).

The nares are oval, bordered by rostral anteriorly, by supranasals and internasals dorsally, by 1st supralabial ventrally. Supranasal scales larger than post-nasal scales. The supranasal scales as large as intersupranasals and separated from each another by three or four intersupranasal scales (Fig. 4F).

The triangular mental is bordered laterally by first infralabial and posteriorly by right and left first postmental. First postmentals medially connected each other for ~ 30% of their length. Second postmentals in contact with 1st and 2nd infralabials (N = 2) (Fig. 5A), separated from infralabials by relatively smaller scales (N = 1) (Fig. 5B), by relatively similar-sized scales (N = 5) (Fig. 5C), and by relatively larger scales (N = 1) (Fig. 5D). Right scale contacts with 1st and 2nd infralabials but the left only with 2nd infralabial (N = 2) (Fig. 5E), or the right contacted with 2nd infralabial and the left with small part of 1st infralabial and large part of 2nd infralabial (Fig. 5F). Right and left second postmentals are bordered by 3–6 relatively smaller scales (Fig. 5).

Body moderate in length (AX/SVL 0.38–0.53); defined ventrolateral fold with tubercles smaller than dorsal tubercles; dorsum with small scales interspersed with large conical or pyramidal, tubercles most dense on flanks; tubercles extending from occipital region to the base of tail, tubercles on tail largest; 16–19 tubercles between lateral fold in middle of body; 31–41 tubercles of paravertebral from posterior insertion of arm to body to anterior of femur insertion to body; 32–43 ventral scales larger than dorsal scales; ventral scales in middle part slightly larger than those near the ventrolateral folds; from middle of body, scales are smaller anteriorly to the head, ventrum, and posteriorly until groin region (Fig. 6).

Forelimbs medium length (AL/SVL 0.33–0.4); granular scales on upper arm larger than those on dorsum of body (~ 2–3 ×larger); without tubercles; lower arm with smaller scales than upper arm scales, intermixed with weak tubercles slightly larger than weak tubercles on parietal parts; hindlimbs also moderate in size (LL/SVL 0.40–0.52); more robust than forelimbs; covered dorsally by granular scales intermixed with large, rounded tubercles; ventral scales of thigh larger than dorsals; 14–19 subdigital lamellae on 4th toe. Continuous enlarged precloacal and femoral scales present (N = 24–49); no specimen has precloacal groove/ depression; enlarged post-precloacal scales present; two post-cloaca tubercles on left and right base of tail, mostly connected to each another (Fig. 7).

Tail length ~ 1.1 × of SVL, circular in cross-section but tapering at the end portion; tubercles on base of tail dorsally similar in size to those on body dorsum; 4–11 black dorsoventral stripes separated by white stripes; black stripes on venter more faded than on dorsal; part; no median, transversely enlarged, series of scales on the subcaudal; subcaudal cycloidal scales relatively larger than dorsal (Fig. 7).

Coloration in life.

Ground color of body dorsum dark grey to brown; top of head blackish with irregular broken spots scattered on parietal region to nostril; on occipital regions three short black lines extending longitudinally: one in the middle, two begin behind each side of eyes almost parallel to the supraorbital regions; those three short black bands stop at approximately parallel to ears, after which there is a transverse white line extending from each pre-ear region; after the white line, there are two black lines at the nape of the neck that extend backwards, then some meet at an angle and some remain separate, as if these two lines continue the black line originating from the back of the eye parallel to the supraorbital area; after the meeting, there are two lines that separate to the back of the tail, and some are still united to the tail so that it tends to look like a black transverse band; in individuals with the two midlines converging, the confluence of the two lines begins just before the anterior part of the upper arm; there are eight or nine rows of black transverse bands that are counted from the beginning of the union of the two lines to the base of the tail; on the dorsolateral, there are two black lines that extend from behind the eyes to the base of the tail; unpatterned black blotches or obscure irregular black banding on limbs; black and white bands on tails; the width of the black line increases towards the posterior; and the white is opposite; in some individuals, the above-mentioned black stripes are not clear and not strong along the dorsal and dorsolateral body. Ventral surface of head, trunk, and limbs are white, pale grey to cream; ventral surface of tail cream in the first third at the anterior, then the rest to the posterior tends to black with narrow white rings (Fig. 8).

Coloration in preservative.

Ground color of dorsal trunk, limbs, and tail brown to dark; parietal part to the tip of snout paler than any other parts of dorsum; the individuals with unclear or weak black lines on middle dorsum and dorsolateral tend to be dark from the nape to the base of the tails; black lines on nape and trunk still visible; tail with black and white bands; ventral head, trunk, limbs whitish to dark brown. Fresh specimens darker than the others both in ventral or dorsal parts of the body (Fig. 3).

Habitat.

We collected the type series in the primary forest of LANR, SG, and SS with elevation ~ 380–767 m a.s.l. and we encountered non-vouchered individuals from ~ 7 m a.s.l. At SG, this species was found on leaves measuring ~ 7–10 cm width and on twigs, ~ 1 m above the ground, 1–3 m from the edge of the rocky stream. The stream that empties into the waterfall has a breadth of ~ 2 m with a heavy flow. Fewer specimens were found closer to the waterfall. At LANR and SS, this species occupied the same microhabitat as the SG population, but the stream at this location is wider (~ 5–7 m width; Fig. 9). We also encountered this species (an unvouchered individual) at a lower elevation of 7 m a.s.l. in Bungus Selatan village. At this location, the gecko was perching on a bush leaf just beside the paddy field at ~ 70 cm above the ground. Another unvouchered individual was in the Sarasah Uwak waterfall area but far from the waterfall, perching on bushes at ~ 60 cm above the ground (Fig. 10).

Figure 10.

Figure 10.

Type locality and distribution of C.awalriyantoi sp. nov. in Sumatra Barat Province.

Distribution.

Currently, this new species is found only in Sumatra.

Etymology.

The specific epithet awalriyantoi is in reference to the Indonesian herpetologist, Awal Riyanto. He has dedicated much of his time researching Indonesian Cyrtodactylus from Indonesia, as well as patiently and continuously supervising many younger amphibian and reptile taxonomists from both academic institutions and independent positions. Moreover, his contribution to the study of amphibians and other reptiles is significant for Indonesian herpetological knowledge and conservation.

Discussion

Previously, the sworderi group of Cyrtodactylus contained five species of which four are endemic to Peninsular Malaysia: living in lowland swampy habitats (C.sworderi; Taylor 1962), upland habitats (C.tebuensis; Grismer et al. 2013), and in karstic habitats (C.guakanthanensis and C.gunungsenyumensis; Grismer et al. 2014, 2016). The fifth species, C.quadrivirgatus, is a habitat generalist that is widely distributed from Thailand to Sumatra (Grismer 2011). Our study revealed that C.quadrivirgatus from Sumatra Barat differs from the Peninsular Malaysian population based on molecular and morphological evidence. With this addition, Sumatra currently supports six species of Cyrtodactylus in total, but the number of species endemic to this mainland is five: C.agamensis, C.lateralis, C.psarops, C.semicinctus and C.awalriyantoi.

Widely distributed species in Cyrtodactylus are most likely questionable, for example, two potentially new species have been detected within the C.marmoratus complex from southern Sumatra (O’Connell et al. 2019). This study also showed that widely distributed species like C.quadrivirgatus need confirmation. At the current state of knowledge, only C.consobrinus has a wide distribution, originally described from Sarawak (Borneo) and reported from Sumatra (Teynie et al. 2010). Like the new species C.awalriyantoi, its presence in Sumatra most likely warrants taxonomic validation.

Supplementary Material

XML Treatment for Cyrtodactylus awalriyantoi

Acknowledgements

The authors would like to thank Lembaga Penelitian dan Pengabdian Masyarakat Universitas Negeri Padang for funding this work under contract number 1688/UN35.13/LT/2022 to Yuni Ahda, Universitas Brawijaya support with contract number 1074.3/UN10.C10/PN/2022 to Nia Kurniawan, and Universitas Andalas with a contract number T/17/UN.16.17/PT.01.03/IS-RKI-A(MITRA/2022) to Djong Hon Tjong. We also thank M. Rafi, K. Agusdi, and F. R. Octavian for helping us in the fieldwork. The permission to carry out the survey within a conservation area was issued by Balai Konservasi Sumberdaya Alam Sumatra Barat (letter reference SI.496/K.9/TU/DTN/3/2021).

Citation

Ahda Y, Nugraha FAD, Hon Tjong D, Kurniawan N, Amardi Y, Fauzi MA, Lin S-M (2023) A new species of the Cyrtodactylus quadrivirgatus complex (Chordata, Reptilia, Squamata, Gekkonidae) from Sumatra Barat, Indonesia. ZooKeys 1168: 367–386. https://doi.org/10.3897/zookeys.1168.98724

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

Lembaga Penelitian dan Pengabdian Masyarakat Universitas Negeri Padang under contract number 1688/UN35.13/LT/2022; Yuni Ahda, Universitas Brawijaya support with contract number 1074.3/UN10.C10/PN/2022; Nia Kurniawan, and Universitas Andalas with a contract number T/17/UN.16.17/PT.01.03/IS-RKI-A(MITRA/2022) to Djong Hon Tjong.

Author contributions

Conceptualization: YA, DHT. Data curation: MAF, YA. Formal analysis: NK, DHT, MAF. Funding acquisition: SML, DHT, NK, YA. Investigation: FADN, YA. Methodology: YA. Project administration: MAF, FADN. Resources: FADN. Software: FADN. Supervision: SML. Validation: SML. Visualization: NK. Writing – original draft: YA, FADN. Writing – review and editing: SML, YA, FADN, YA, DHT.

Author ORCIDs

Yuni Ahda https://orcid.org/0000-0003-0545-2965

Fitra Arya Dwi Nugraha https://orcid.org/0000-0002-0048-8515

Djong Hon Tjong https://orcid.org/0000-0002-4743-9964

Muhammad Alif Fauzi https://orcid.org/0000-0003-0975-9681

Si-Min Lin https://orcid.org/0000-0001-7080-706X

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

Supplementary materials

Supplementary material 1

Morphometric and meristic data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Yuni Ahda, Fitra Arya Dwi Nugraha, Djong Hon Tjong, Nia Kurniawan, Yunico Amardi, Muhammad Alif Fauzi, Si-Min Lin

Data type

Morphology (.xlsx file)

Explanation note

This file contain the measurement on morphometric characters and meristic, examined on the type series specimen.

Supplementary material 2

Comparison with C.quadrivirgatus

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Yuni Ahda, Fitra Arya Dwi Nugraha, Djong Hon Tjong, Nia Kurniawan, Yunico Amardi, Muhammad Alif Fauzi, Si-Min Lin

Data type

Morphology (.xlsx file)

Explanation note

This file contains the comparison between C.awalriyantoi sp. nov. with C.quadrivirgatus from type series (Taylor 1962) and from Peninsular Malaysia population (Johnson et al. 2012).

References

  1. Agarwal I, Bauer AM, Jackman TR, Karanth KP. (2014) Insights into Himalayan biogeography from geckos: A molecular phylogeny of Cyrtodactylus (Squamata: Gekkonidae). Molecular Phylogenetics and Evolution 80: 145–155. 10.1016/j.ympev.2014.07.018 [DOI] [PubMed] [Google Scholar]
  2. Grismer LL. (2011) Lizards of Peninsular Malaysia, Singapore and their adjacent archipelagos. Chimaira, Frankfurt, 728 pp. [Google Scholar]
  3. Grismer LL, Anuar S, Muin MA, Quah ESH, Wood Jr PL. (2013) Phylogenetic relationships and description of a new upland species of Bent-toed Gecko (Cyrtodactylus Gray, 1827) of the C.sworderi complex from northeastern Peninsular Malaysia. Zootaxa 3616(3): 239–252. 10.11646/zootaxa.3616.3.2 [DOI] [PubMed] [Google Scholar]
  4. Grismer LL, Belabut DM, Quah ESH, Chan KO, Wood PL, Hasim R. (2014) A new species of karst forest-adapted Bent-toed Gecko (genus Cyrtodactylus Gray, 1827) belonging to the C.sworderi complex from a threatened karst forest in Perak, Peninsular Malaysia. Zootaxa 3755(5): 434–446. 10.11646/zootaxa.3755.5.3 [DOI] [PubMed] [Google Scholar]
  5. Grismer LL, Wood JR PL, Anuar S, Davis HR, Cobos AJ, Murdoch ML. (2016) A new species of karst forest Bent-toed Gecko (genus Cyrtodactylus Gray) not yet threatened by foreign cement companies and a summary of Peninsular Malaysia’s endemic karst forest herpetofauna and the need for its conservation. Zootaxa 4061(1): 001–017. 10.11646/zootaxa.4061.1.1 [DOI] [PubMed] [Google Scholar]
  6. Hartmann L, Mecke S, Kieckbusch M, Mader F, Kaiser H. (2016) A new species of bent-toed gecko, genus Cyrtodactylus Gray, 1827 (Reptilia: Squamata: Gekkonidae), from Jawa Timur Province, Java, Indonesia, with taxonomic remarks on C.fumosus (Müller, 1895). Zootaxa 4067(5): 552–568. 10.11646/zootaxa.4067.5.2 [DOI] [PubMed] [Google Scholar]
  7. Harvey MB, O’Connell KA, Barraza G, Riyanto A, Kurniawan N, Smith EN. (2015) Two new species of Cyrtodactylus (Squamata: Gekkonidae) from the southern Bukit Barisan Range of Sumatra and an estimation of their phylogeny. Zootaxa 4020(3): 495–516. 10.11646/zootaxa.4020.3.5 [DOI] [PubMed] [Google Scholar]
  8. Harvey MB, O’Connell KA, Wostl E, Riyanto A, Kurniawan N, Smith EN, Grismer LL. (2016) Redescription Cyrtodactyluslateralis (Werner) (Squamata: Gekkonidae) and Phylogeny of the Prehensile-tailed Cyrtodactylus. Zootaxa 4107(4): 517–540. 10.11646/zootaxa.4107.4.3 [DOI] [PubMed] [Google Scholar]
  9. Hillis DM, Bull JJ. (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Systematic Biology 42(2): 182–192. 10.1093/sysbio/42.2.182 [DOI] [Google Scholar]
  10. Johnson CB, Quah ESH, Anuar S, Muin MA, Wood Jr PL, Grismer JL, Onn CK, Ahmad N, Bauer AM, Grismer LL. (2012) Phylogeography, geographic variation, and taxonomy of the Bent-toed Gecko Cyrtodactylusquadrivirgatus Taylor, 1962 from Peninsular Malaysia with the description of a new swamp dwelling species. Zootaxa 3406: 39–58. 10.11646/zootaxa.3406.1.3 [DOI] [Google Scholar]
  11. Kumar S, Stecher G, Tamura K. (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870–1874. 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Letunic I, Bork P. (2021) Interactive Tree Of Life (iTOL) version 5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Research 49(W1): W293–W296. 10.1093/nar/gkab301 [DOI] [PMC free article] [PubMed]
  13. Macey JR, Schulte JA II, Larson A, Tuniyev BS, Orlov N, Papenfuss TJ. (1999a) Molecular phylogenetics, tRNA evolution, and historical biogeography in anguid lizards and related taxonomic families. Molecular Phylogenetics and Evolution 12(3): 250–272. 10.1006/mpev.1999.0615 [DOI] [PubMed] [Google Scholar]
  14. Macey JR, Wang Y, Ananjeva NB, Larson A, Papenfuss TJ. (1999b) Vicariant patterns of fragmentation among gekkonid lizards of the genus Teratoscincus produced by the Indian collision: A molecular phylogenetic perspective and an area cladogram for Central Asia. Molecular Phylogenetics and Evolution 12(3): 320–332. 10.1006/mpev.1999.0641 [DOI] [PubMed] [Google Scholar]
  15. Miller MA, Pfeiffer W, Schwartz T. (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Proceedings of the Gateway Computing Environments Workshop (GCE), Nov. 2010. New Orleans, LA, 1–8. 10.1109/GCE.2010.5676129 [DOI]
  16. Murthy BHCK, Bauer A, Lajmi A, Agarwal I, Giri VB. (2015) A new rock dwelling Hemidactylus (Squamata: Gekkonidae) from Chhattisgarh, India. Zootaxa 4021(2): 334–350. 10.11646/zootaxa.4021.2.5 [DOI] [PubMed] [Google Scholar]
  17. O’Connell KA, Smart U, Sidik I, Riyanto A, Kurniawan N, Smith EN. (2019) Diversification of bent-toed geckos (Cyrtodactylus) on Sumatra and west Java. Molecular Phylogenetics and Evolution 134: 1–11. 10.1016/j.ympev.2019.01.021 [DOI] [PubMed] [Google Scholar]
  18. Oliver PM, Sistrom M, Richards S. (2012) Phylogeny and systematics of Melanesia’s most diverse gecko lineage (Cyrtodactylus, Gekkonidae, Squamata). Zoologica Scripta 41(5): 437–454. 10.1111/j.1463-6409.2012.00545.x [DOI] [Google Scholar]
  19. Riyanto A, Grismer LL, Wood Jr PL. (2015) Cyrtodactylusrosichonariefi sp. nov. (Squamata: Gekkonidae), a new swamp-dwelling Bent-toed gecko from Bunguran Island (Great Natuna), Indonesia. Zootaxa 3964(1): 114–124. 10.11646/zootaxa.3964.1.8 [DOI] [PubMed] [Google Scholar]
  20. Riyanto A, Fauzi MA, Sidik I, Mumpuni Irham M, Kurniawan N, Ota H, Okamoto T, Hikida T, Grismer LL. (2021) Another New Bent-toed Gecko, genus Cyrtodactylus Gray 1837 (Squamata: Gekkonidae), from Borneo. Zootaxa 5026(2): 286–300. 10.11646/zootaxa.5026.2.8 [DOI] [PubMed] [Google Scholar]
  21. Siler CD, Oaks JR, Esselstyn JA, Diesmos AC, Brown RM. (2010) Phylogeny and biogeography of Philippine bent-toed geckos (Gekkonidae: Cyrtodactylus) contradict a prevailing model of Pleistocene diversification. Molecular Phylogenetics and Evolution 55 [2010]: 699–710. 10.1016/j.ympev.2010.01.027 [DOI] [PubMed] [Google Scholar]
  22. Taylor EH. (1962) New oriental reptiles. The University of Kansas Science Bulletin 43: 209–263. 10.5962/bhl.part.13346 [DOI] [Google Scholar]
  23. Teynie A, David P, Ohler A. (2010) Note on a collection of amphibians and reptiles from Western Sumatra (Indonesia), with the description of a new species of the genus Bufo. Zootaxa 2416(1): 1–43. 10.11646/zootaxa.2416.1.1 [DOI]
  24. Wood Jr PL, Heinicke MP, Jackman TR, Bauer AM. (2012) Phylogeny of Bent-toed geckos (Cyrtodactylus) reveals a west to east pattern of diversification. Molecular Phylogenetics and Evolution 65(3): 992–1003. 10.1016/j.ympev.2012.08.025 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Cyrtodactylus awalriyantoi
Supplementary material 1

Morphometric and meristic data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Yuni Ahda, Fitra Arya Dwi Nugraha, Djong Hon Tjong, Nia Kurniawan, Yunico Amardi, Muhammad Alif Fauzi, Si-Min Lin

Data type

Morphology (.xlsx file)

Explanation note

This file contain the measurement on morphometric characters and meristic, examined on the type series specimen.

Supplementary material 2

Comparison with C.quadrivirgatus

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Yuni Ahda, Fitra Arya Dwi Nugraha, Djong Hon Tjong, Nia Kurniawan, Yunico Amardi, Muhammad Alif Fauzi, Si-Min Lin

Data type

Morphology (.xlsx file)

Explanation note

This file contains the comparison between C.awalriyantoi sp. nov. with C.quadrivirgatus from type series (Taylor 1962) and from Peninsular Malaysia population (Johnson et al. 2012).

Data Availability Statement

All of the data that support the findings of this study are available in the main text or Supplementary Information.


Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES