Abstract
Simple Summary
Small mammals not only play an important role in ecosystems, but they also can transmit a wide range of pathogens to humans and domestic animals. The data on protozoan Sarcocystis parasites in orchard-dwelling small mammals are still scarce. Members of the genus Sarcocystis form sarcocysts in the muscles of intermediate hosts and develop sporocysts in the intestines of definitive hosts. In the present study, 679 muscle samples of small mammals, collected in commercial orchards and berry plantations in Lithuania, were screened for Sarcocystis parasites via DNA analysis. The prevalence of Sarcocystis spp. was low as only nine pooled muscle samples were found to contain the parasites examined. Four species were identified in the examined small mammals, including two potentially new Sarcocystis species that were detected in the muscles of voles. The phylogenetic results suggested that birds and mammals are the definitive hosts of the Sarcocystis spp. identified in the current study.
Abstract
Small mammals are an important group of wildlife that can transmit pathogens to humans and animals. There is a lack of comprehensive studies on the protozoan parasites of the genus Sarcocystis in agricultural areas. The aim of the current research was to evaluate the prevalence of Sarcocystis spp., and to identify the parasite species found in the skeletal muscles of rodents and insectivores from commercial orchards. A total of 679 muscle samples from small mammals, mainly rodents (n = 674), belonging to eight species were examined. Muscle samples were pooled into groups, then digested, and the presence of the Sarcocystis species was confirmed by molecular methods. The examined parasites were determined in five rodent species, Apodemus agrarius, A. flavicollis, Clethrionomys glareolus, Microtus arvalis, and M. oeconomus. The prevalence of Sarcocystis spp. was low: 2.23% in voles and 0.79% in mice. Based on a sequence comparison of cox1 and 28S rDNA, four species were identified: S. myodes, Sarcocystis cf. strixi, Sarcocystis sp. Rod1, and Sarcocystis sp. Rod2. This is the first report of S. myodes in A. agrarius, A. flavicollis, and M. arvalis. The identified species were most closely related to Sarcocystis spp., and were transmitted by predatory mammals and birds. Future studies are needed to describe the species morphologically, as well as to define the host spectrum and to evaluate their possible pathogenicity.
Keywords: small mammals, orchards, Lithuania, Sarcocystis, infection rates, genetic identification, phylogeny
1. Introduction
Small mammals are a group of mammals distinguished by their relatively low body mass, short lifespan, and high fertility rate. This group includes more than 2500 species of rodents, 450 species of insectivores (eulipotyphlans), about 20 species of tree shrews (order Scandentia), but also other taxa that are not considered in this paper, such as marsupials [1,2]. Small mammals are important components of the food chain [3,4,5,6] for more than 75 species of predators in Northern and Central Europe [7,8,9]. They can transmit pathogens to humans, especially in residential areas [10,11,12], and to farm or domestic animals [13,14,15,16]. The main problems they cause are leishmaniasis, schistosomiasis, and Leptospira, as well as Ricketsia at lower latitudes.
According to long-term trapping data [17,18], four species of small mammals are commonly found in Lithuania with a proportion that is over 10% in their communities—the bank vole (Clethrionomys glareolus), the yellow-necked mouse (Apodemus flavicollis), the striped field mouse (A. agrarius), and the common shrew (Sorex araneus). Proportions of other four small mammal species, the common vole (Microtus arvalis), the root vole (M. oeconomus), the field vole (M. agrestis), and the pygmy shrew (Sorex minutus), accounted for 2–10% of all trapped individuals [18].
Ecological studies of the small mammals in commercial orchards in Lithuania have been carried out only in recent years [19,20,21]. However, the parasites of small mammals in these habitats have not been studied in Lithuania. Commercial orchards are anthropogenic habitats that are frequently visited by humans; thus, parasite surveys in this habitat are important for assessing the one-health risk [22]. Rodent-carried zoonotic protozoans are a threat to humans in cities [23] and agricultural areas [24]. Various protozoan pathogens were found in rodents from agricultural areas [25,26,27]; however, data on Sarcocystis in orchard-dwelling rodents are scarce.
The genus Sarcocystis encompasses globally distributed abundant protozoan parasites that are characterized by a two-host prey–predator life cycle. Sarcocysts are formed in the extra-intestinal tissues of intermediate hosts, mainly in muscles and the central nervous system, while the sporulation of oocysts occurs in the small intestine of definitive hosts [28,29,30,31]. Until now more than 200 Sarcocystis species have been described in mammals, birds, and reptiles [29,31]. Some species of Sarcocystis are pathogenic to their intermediate hosts, wildlife, and farm animals, as well as to humans [30].
Among the small mammals, the composition of the Sarcocystis species has been most comprehensively examined in rodents. More than 40 Sarcocystis are known to use rodents as their intermediate hosts [32]. However, the vast majority of these species were described and characterized using morphological methods [29]. Whereas approximately one-third of these species—S. atheridis, S. dispersa [33], S. clethrionomyelaphis [34], S. cymruensis [30,35], S. glareoli, S. microti [36,37], S. muris [37,38], S. myodes [32], S. pantherophisi [39,40], S. ratti [35,41], S. singaporensis, S. zamani, and S. zuoi [42,43,44,45,46,47,48]—have been examined with the help of DNA sequence analysis. Meanwhile, only two Sarcocystis species have been described in tree shrews, S. scandentiborneensis [31] and S. tupaia [49] and three valid species S. attenuati [50], S. booliati, and S. russuli [51,52] are known to infect eulipotyphlans.
Previous Sarcocystis parasite studies examining the muscles of small mammals from Lithuania and involving large numbers of animals (≥590) were carried out in wild nature [53,54,55]. Sarcocystis spp. were identified by the microscopical detection of sarcocysts in squashed and methylene-blue stained preparations. These studies demonstrated low Sarcocystis spp. infection rates, varying from 2.07% to 11.01%, and the parasites detected have not yet been characterized to the species level [53,54,55]. In contrast, molecular techniques can provide more detailed information on Sarcocystis species characterization and inter-species evolutionary relationships that cannot be determined by microscopy [56,57]. Therefore, the main objectives of this work were to identify members of the Sarcocystis species by molecular analysis and to determine the phylogenetic relationships of the species found in the skeletal muscles of small mammals collected in Lithuanian orchards. The Sarcocystis spp. diagnosis technique was based on a pooling of samples, muscle digestion, nested PCR, and a Sanger sequencing of the amplified fragments.
2. Materials and Methods
2.1. Sample Collection
Small mammals were snap-trapped at 14 study sites, representing commercial orchards and berry plantations, across Lithuania in 2020 (Figure 1). We used the following standard trapping protocol [58]: in each sampling site, one to four lines with 25 traps at 5 m intervals were set, these were kept for three days and checked once a day in the morning. Bread soaked in sunflower oil was used as bait, and the bait was changed after rain or after it had been consumed by mammals, birds, insects, or slugs. In total, 679 small mammals belonging to eight species (A. agrarius, A. flavicollis, C. glareolus, M. agrestis, M. arvalis, M. oeconomus, Sorex araneus, and S. minutus) were trapped (Table 1). Skeletal muscle tissue from the individuals was used for the Sarcocystis infection study. All muscle tissues were frozen at −20 °C.
Figure 1.
Investigation sites in Lithuania with a detection of Sarcocystis pathogens in the rodents indicated: 1—Aukštikalniai, 2—Naradava, 3—Mieliūnai, 4—Užpaliai, 5—Kalpokai, 6—Ažuožeriai, 7—Tytuvėnai, 8—Taujėnai, 9—Dembava, 10—Barčiai, 11—Luksnėnai, 12—Gaurė, 13—Šešuolėliai, and 14—Žiežmariai.
Table 1.
The number of the examined species and individuals collected in the 14 sites. The number of pooled groups are presented in parenthesis.
Sample Site | Host Species | |||||||
---|---|---|---|---|---|---|---|---|
Apodemus agrarius | Apodemus flavicollis | C lethrionomys glareolus | Microtus agrestis | M icrotus arvalis | M icrotus oeconomus | S orex araneus | S orex minutus | |
Aukštikalniai | 11 (2) | 4 (1) | 36 (5) | 2 (1) | ||||
Naradava | 42 (5) | 36 (5) | 5 (1) | 6 (1) | ||||
Mieliūnai | 16 (2) | |||||||
Užpaliai | 24 (3) | 3 (1) | 69 (7) | 2 (1) | ||||
Kalpokai | 3 (1) | |||||||
Ažuožeriai | 7 (1) | 29 (3) | 40 (5) | 2 (1) | ||||
Tytuvėnai | 28 (3) | 28 (3) | 5 (1) | |||||
Taujėnai | 7 (1) | 6 (1) | ||||||
Dembava | 17 (2) | |||||||
Barčiai | 10 (1) | 9 (1) | 8 (1) | 8 (1) | ||||
Luksnėnai | 7 (2) | 42 (6) | 22 (2) | 10 (2) | 3 (1) | |||
Gaurė | 5 (1) | |||||||
Šešuolėliai | 13 (2) | 9 (1) | ||||||
Žiežmariai | 45 (5) | 54 (6) | 6 (1) |
2.2. Sample Pooling and Muscle Digestion
Due to the vast number of samples, the collected animals were combined, by species and sites, into pools of 91. The number of individuals per pool varied between two and 10, with an average of 7.46 ± 0.25 animals per group. The average number per pooled sample was 8.11 ± 0.48 for C. glareolus, 7.81 ± 0.41 for A. flavicollis, 7.68 ± 0.54 for A. agrarius, 7.65 ± 0.41 for M. arvalis, 5 for M. agrestis, 3 for S. minutus, and 2 for both M. oeconomus and S. araneus.
The muscles of each pool were cut into small pieces and digested with pepsin, as described previously in [57]. The amount of muscle per pooled sample varied approximately between 1 and 50 g. Briefly, the chopped muscles were suspended in 15 mL of 0.9% saline solution, homogenized in a commercial blender at top speed for 2 min with breaks, incubated with a digestion solution at 37 °C for 1 h, and then centrifugated two–three times at 1600 rpm for 6 min. A total of 200 µL of sediments was used for the DNA extraction.
2.3. Molecular Examination
Genomic DNA from the digested muscle samples was extracted with the help of a PureLink Microbiome DNA Purification Kit (Invitrogen by Thermo Fisher Scientific, Waltham, MA, USA), which was utilized according to the manufacturer’s instructions.
Nested PCR and subsequent sequencing were used for the detection of Sarcocystis spp. in the examined pooled muscle samples. It was aimed to amplify fragments of four genetic loci, 18S rDNA, 28S rDNA, cox1, and ITS1. These loci were most commonly applied for the identification of Sarcocystis spp.; this was achieved by using small mammals as their intermediate hosts [41,50]. Primers were designed by a Primer 3 Plus program [59]. For the selection of primers, the numerous sequences of Sarcocystis spp. that were isolated from the small mammals were retrieved from GenBank and aligned by a CLC Sequence Viewer 8.0 (QIAGEN, Aarhus, Denmark). The aim was to design the primers to theoretically amplify as many as possible of the Sarcocystis species from small mammals. The list of primers used in the study is presented in Table 2.
Table 2.
Oligonucleotide primers used for the nested PCR targeting: 18S rDNA, 28S rDNA, ITS1, and cox1.
Primer Name | Sequence | Region | Round of Nested PCR |
Ta, °C | Approximate Length of PCR Product a |
---|---|---|---|---|---|
Sgrau181 PS | AAGTATAAGCTTTTATACGGCGAAA | 18S rDNA | First | 61 | 900 |
Sgrau182 PS | TCGCAGTAGTTCGTCTTTAACAAA | ||||
Sgrau183 PS | TGGATAACCGTGGTAATTCTATG | Second | 59 | 750 | |
Sgrau184 PS | TCCCTATTAATCATTACTTCAGTCCTA | ||||
Sgrau281 PS | GCGGAGGAAAAGAAAATAACAAT | 28S rDNA | First | 61 | 900 |
Sgrau282 PS | CTATCGCTTAGGACCGGCTA | ||||
Sgrau283 PS | GTGAACAGGGAAGAGCTCAA | Second | 59 | 800 | |
Sgrau284 PS | CTCCACGTCTTCCTACTCATTG | ||||
SU1F b | GATTGAGTGTTCCGGTGAATTATT | ITS1 d | First | 59 | 1100 |
5.8SR2 b | AAGGTGCCATTTGCGTTCAGAA | ||||
SgrauITS3 PS | GGGAAGTTTTGTGAACCTTAACACT | Second | 57 | 950 | |
SgrauITS4 PS | ATTCTGCAATTCACATTGCGTTT | ||||
SF1 c | ATGGCGTACAACAATCATAAAGAA | cox1 | First | 59 | 1100 |
SR5 c | TAGGTATCATGTAACGCAATATCCAT | ||||
SgraucoF1 PS | GGTTTTGGTAACTACTTTGTACCG | Second | 59 | 660 | |
SgraucoR1 PS | ACCTCTAATCCTACGGTCATCA |
Ta the primer annealing temperatures used for PCR, a the length of the product, which varies depending on the Sarcocystis species. A comparison of the Sarcocystis species’ high variation in the length of loci was previously observed in ITS1 and in some domains of 18S rDNA and 28S rDNA [42,60,61]. PS the present study, b [62], c [61], d the region that contains complete ITS1, as well as short fragments of 18S rDNA and 5.8S rDNA.
The amplification of both steps of nested PCR was performed under the same conditions and via the same thermal protocol. PCRs were carried out in a 25 µL reaction volume containing 12.5 µL of DreamTaq PCR Master Mix (Thermo Fisher Scientific Baltics, Vilnius, Lithuania), 0.5 µM of each primer, 2 µL of template DNA, and 9.5 µL of nuclease-free water. The amplification started for 5 min at 95 °C, followed by 35 cycles of 45 s at 94 °C, 60 s at 52–60 °C (depending on the primer pair (Table 2)), 80 s at 72 °C, and ended with the final extension at 72 °C for 10 min. In each set of PCR positive and negative controls, water instead of template DNA were applied. During our previous investigations, the DNA extracted from the individual sarcocysts of S. ratti [41] and S. myodes [32] were used as positive controls. PCR products were visualized using 1.0% agarose gel electrophoresis.
The enzymatic purification of the amplified products was performed with alkaline phosphatase FastAP and exonuclease ExoI (Thermo Fisher Scientific Baltics, Vilnius, Lithuania). The amplification products were sequenced directly by using the forward and reverse second-step primers of the nested PCR. Sequencing was conducted using the Big-Dye®Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Vilnius, Lithuania) and the 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA); both were utilized according to the manufacturer’s instructions. The chromatograms obtained were pure, without double or poly peaks.
The resulted sequences were compared with those of various Sarcocystis spp. with Nucleotide BLAST (http://blast.ncbi.nlm.nih.gov/, accessed on 17 January 2023). The genetic comparison of the obtained sequences was also made using the Heatmapper program [63]. Multiple alignments of 28S rDNA and cox1 sequences were obtained with the MUSCLE algorithm when implemented in MEGA7 [64]. The selection of the nucleotide evolution model best fitting dataset, as well as the generation of the phylogenetic tree under the Bayesian inference, was made on TOPALi v2.5 [65]. The resulted phylograms were visualized and edited in MEGA7. The final alignment that was generated employing cox1 consisted of 619 nucleotide positions without any indels. Whereas the 28S rDNA alignment was composed of 956 nucleotide positions with gaps. The JC + G and HKY + G evolutionary models were set for the cox1 and 28S rDNA analysis, respectively. For an evaluation of the robustness of the suggested phylogeny, a bootstrap test with 1000 replicates was performed. The 28S rDNA and cox1 sequences of the Sarcocystis spp. that were isolated from the muscles of the small mammals obtained in the present study are available in GenBank (accession numbers OQ557453-OQ557461 and OQ558004-OQ558012, respectively).
2.4. Statistical Analysis
The prevalence estimates (in percent) and the 95% Cis for the small mammal species studied were calculated based on pooled samples [66,67]. We also calculated the prevalence and 95% CI for the investigation sites, as well as for the pooled samples of the voles, mice, and shrews (Table 3). The point estimation was conducted by employing the maximum likelihood method, maximizing the pooled likelihood function, and the CI was estimated by using a correction for skewness of the score function and the asymptotic confidence limits [68].
Table 3.
The detection rates of Sarcocystis spp. in the examined species of small mammals and in the analyzed localities. The prevalence from the pooled samples were calculated according to B.J. Biggerstaff and G. Hepworth [66,67,68], and by using the Excel program as presented in [67].
Sample | Number of Individuals Screened | Number of Pools Analyzed | Number of Positive Pools | Prevalence (95% Confidence Intervals) |
---|---|---|---|---|
Species | ||||
Apodemus agrarius | 146 | 19 | 1 | 0.68 (0.04–3.26) |
Apodemus flavicollis | 242 | 31 | 2 | 0.84 (0.15–2.75) |
Mice | 388 | 50 | 3 | 0.79 (0.21–2.12) |
Clethrionomys glareolus | 73 | 9 | 1 | 1.34 (0.08–6.43) |
Microtus agrestis | 10 | 2 | 0 | 0 |
Microtus arvalis | 199 | 26 | 4 | 2.16 (0.71–5.18) |
Microtus oeconomus | 4 | 2 | 1 | 24.87 (1.64–81.95) |
Voles | 292 | 39 | 6 | 2.23 (0.92–4.59) |
Sorex araneus | 2 | 1 | 0 | 0 |
Sorex minutus | 3 | 1 | 0 | 0 |
Shrews | 5 | 2 | 0 | 0 |
Total | 679 | 91 | 9 | 1.38 (0.68–2.52) |
Sites | ||||
1 | 53 | 9 | 2 | 3.77 (0.73–11.86) |
2 | 78 | 10 | 1 | 1.27 (0.08–6.09) |
3 | 35 | 4 | 0 | 0 |
4 | 17 | 2 | 1 | 5.32 (0.39–31.68) |
5 | 5 | 1 | 0 | 0 |
6 | 3 | 1 | 0 | 0 |
7 | 84 | 14 | 1 | 1.18 (0.07–5.67) |
8 | 16 | 2 | 0 | 0 |
9 | 89 | 12 | 0 | 0 |
10 | 22 | 3 | 0 | 0 |
11 | 13 | 2 | 0 | 0 |
12 | 61 | 7 | 1 | 1.65 (0.10–8.11) |
13 | 98 | 12 | 3 | 3.49 (0.94–9.57) |
14 | 105 | 12 | 0 | 0 |
Differences in the prevalence of the identified Sarcocystis spp. were evaluated by conducting a Chi-squared test, which was calculated in WinPepi, ver. 11.39, and by using an exact Fisher’s P for the small and medium sample sizes [69]. Regarding the comparison of the prevalence of Sarcocystis spp. between the species and species groups (voles, mice, and shrews), the effect size was expressed according to an adjusted Cohen’s w [70].
3. Results
3.1. Prevalence of Sarcocystis spp. in Small Mammals
By molecular methods, Sarcocystis spp. were confirmed in nine pooled samples. Of the eight host species examined, Sarcocystis spp. were identified in five rodent species, i.e., in the four pooled samples of M. arvalis, in two samples of A. flavicollis, and in a single sample of A. agrarius, C. glareolus, and M. oeconomus (Table 3). The samples of the host species, which were negative for the screened parasites, were small and consisted of up to 10 individuals and one to two pooled groups. The overall prevalence of Sarcocystis spp. accounted for 1.38% (95% CI = 0.68–2.52). It should be noted that the prevalence of the Sarcocystis spp. detected in voles was as much as three times higher (2.23%) than that in the mice of genus Apodemus (0.79%), though the difference was not significant (chi-square = 2.10, p = 0.15, Cohen’s w = 0.154, small effect size). Sarcocystis spp. were found in rodents collected in 6 out of the 14 localities 42.86% (95% CI = 17.66–68.42%). Parasites were determined in the northern, central, and eastern parts of Lithuania (Figure 1). The highest detection rates were established in Užpaliai (eastern Lithuania) with 5.32% and in Aukštikalniai (northern Lithuania) with 3.77%. The number of individuals tested in the localities where Sarcocystis were not detected ranged from 3 to 35 (in six localities) and from 89 to 105 in the two remaining localities.
3.2. Molecular Characterization of Sarcocystis spp. in Small Mammals
Amplification products were seen only after the second step of nested PCR. The amplification of four genetic loci was successful with positive controls. However, the molecular analysis of the analyzed samples was successful only when using primers that amplified 28S rDNA and cox1 products. The amplification and sequencing of 18S rDNA resulted in unspecific microorganisms and coccidia. While only unspecific bands, which were smaller than expected, were obtained with the primers targeting ITS1.
Overall, nine Sarcocystis spp. isolates were successfully characterized within partial cox1 and 28S rDNA. Based on the comparison of the obtained 619 bp long cox1 and 726–735 bp long 28S rDNA sequences, four Sarcocystis species (S. myodes, Sarcocystis cf. strixi, Sarcocystis sp. Rod1, and Sarcocystis sp. Rod2) were identified (Table 4). In particular, in this work, S. myodes—as previously described in C. glareolus [32]—was found in four rodent species: A. agrarius, A. flavicollis, C. glareolus, and M. arvalis. Sarcocystis cf. strixi was identified in a single sample of A. flavicollis. Sarcocystis sp. Rod1 was confirmed in M. arvalis and M. oeconomus, and Sarcocystis sp. Rod2 was detected in two pooled samples of M. arvalis.
Table 4.
Identification and genetic variability of the Sarcocystis spp. isolated from rodents collected in Lithuania.
Feature | Sarcocystis Species | |||
---|---|---|---|---|
S. myodes | Sarcocystis cf. strixi | Sarcocystis sp. Rod1 | Sarcocystis sp. Rod2 * | |
IH |
Apodemus agrarius, Apodemus flavicollis, Clethrionomys glareolus,
Microtus arvalis |
Apodemus flavicollis |
Microtus arvalis, Microtus oeconomus |
Microtus arvalis |
Sequence similarity | ||||
Cox1 | 100% S. myodes, 99.68% Sarcocystis sp. Rod1, 99.19% S. ratti, 95.80% S. strixi |
100% S. strixi, 99.52% S. lutrae, 99.52% S. lari | 99.68% S. myodes, 99.52% S. ratti, 95.48% S. strixi |
100% S. fulicae, 100% S. cornixi, 99.82% S. columbae, 99.82% S. corvusi, 99.82% S. turdusi, 99.82% S. halieti |
28S rDNA | 99.18–100% S. myodes, 97.28–97.82% Sarcocystis sp. Rod1, 95.92–96.46% S. ratti, 88.36–88.90% S. cymruensis, 88.35–88.89% S. muris |
98.91% S. strixi, 95.37% Sarcocystis sp. (MW349707), 95.24% S. lari, 94.97% S. turdusi | 97.28–97.82% S. myodes, 97.28–97.55% S. ratti, 90.24–90.26% S. cymruensis, 89.17% S. muris |
97.11–97.25% S. arctica, 97.12% S. lari, 97.12% S. lutrae |
* Sarcocystis sp. Rod2 was identified in two pooled samples of the same host species, M. arvalis, whereas the other Sarcocystis spp. were detected in a single pooled sample of the certain host species.
Two of the identified species, S. myodes and Sarcocystis sp. Rod1, had the highest genetic similarity with each other, as well as with the S. ratti from the black rat (Ratus rattus) [32,41]. At the cox1 gene, the sequences of S. myodes and Sarcocystis sp. Rod1 exhibited a difference of only 0.32%. In the case of the 28S rDNA gene, the sequences obtained from S. myodes in this study shared an identity ranging from 99.18% to 100%, as well as displayed a similarity of 97.28% to 97.82% when compared to the two sequences of Sarcocystis sp. Rod1. The two 28S rDNA sequences of Sarcocystis sp. Rod1 showed a difference of 0.27%. Regarding the cox1 gene, the sequences of Sarcocystis cf. strixi exhibited a 100% identity to S. strixi, which was isolated from the intestinal mucosal scraping of the barred owl (Strix varia) [71]. Additionally, they shared a 99.52% similarity with the S. lutrae obtained from predatory mammals [72] and the S. lari obtained from the birds of the family Laridae [73]. In contrast, the 28S rDNA sequences of Sarcocystis cf. strixi exhibited a similarity of 98.91% to S. strixi and less than 96% when compared to other Sarcocystis spp. Additionally, when analyzing the cox1 region, Sarcocystis sp. Rod2 could not be distinguished from several examples of Sarcocystis spp. that use birds as intermediate hosts. However, based on 28S rDNA, the sequences of Sarcocystis sp. Rod2 showed a similarity of up to 97.25% to the Sarcocystis spp. that utilize birds and predatory mammals (Carnivora) as their intermediate hosts [29].
The genetic comparison of nine cox1 sequences obtained in this study revealed the presence of four haplotypes, which corresponded to four identified Sarcocystis species (Figure 2a). In terms of the cox1 gene, the genetic differences between S. myodes and Sarcocystis sp. Rod1, as well as between Sarcocystis cf. strixi and Sarcocystis sp. Rod2, did not exceed 1%. On the other hand, the 28S rDNA gene exhibited higher interspecies variability compared to cox1 (Figure 2b). A total of seven 28S rDNA haplotypes were identified and, based on 28S rDNA, the differences between the four Sarcocystis species exceeded 2%, with intraspecific genetic variabilities of up to 0.8%.
Figure 2.
The genetic comparison between the Sarcocystis isolates obtained in this work was on the basis of the cox1 (a) and 28S rRNA (b) sequences. The GenBank accession numbers are shown next to the species names.
3.3. Phylogenetic Relationships between Identified Sarcocystis Species
Significantly higher bootstrap support values were obtained in the phylogenetic tree that was obtained using 28S rDNA sequences (Figure 3a) than those obtained in the tree constructed from cox1 sequences (Figure 3b). Based on both loci, four of the Sarcocystis species distinguished in the current work were remote from Sarcocystis spp. and were characterized by a rodent–snake life cycle. In general, Sarcocystis cf. strixi and Sarcocystis sp. Rod2 were most closely related with Sarcocystis spp., which use birds as their definitive hosts, while S. myodes and Sarcocystis sp. Rod1 were grouped together with Sarcocystis spp., which employ predatory mammals as their definitive hosts. In the 28S rDNA phylogram, the isolates of S. myodes composed a common cluster. Sarcocystis cf. strixi was grouped with the S. strixi from the barred owl (Strix varia) [71], and it was most closely related with the Sarcocystis sp. (MW349707) isolated from the intestinal mucosa of the boreal Tengmalm’s owl (Aegolius funereus) [74]. Sarcocystis sp. Rod1 was placed into one cluster together with the S. myodes and S. ratti described in the rodents from the Baltic States [32,41], and Sarcocystis sp. Rod2 was a sister taxon to the S. lutrae detected in various predatory mammals [72]. It is noteworthy that, on the basis of cox1, Sarcocystis sp. Rod1 was found to be more closely related to S. ratti than to S. myodes.
Figure 3.
The phylogenetic analysis of the selected Sarcocystis spp. based on cox1 (a) and 28S rDNA (b) sequences. Trees were generated using the Bayesian method, which was scaled according to the branch length and rooted on S. cruzi. Sequences generated in this work are presented in dark red, while the Sarcocystis spp. that uses rodents as their intermediate hosts are displayed in indigo. The bootstrap support values are indicated next to the branches. DH = definitive hosts.
4. Discussion
4.1. Evaluation of the Sarcocystis spp. Prevalence in Different Species of Small Mammals
By means of a molecular analysis, Sarcocystis spp. were detected in the skeletal muscles of two Apodemus species and three vole species of genus Clethrionomys and Microtus (Table 3) from orchards and berry plantations in Lithuania. The parasites analyzed were not found in the five individuals of the insectivorous mammals from the genus Sorex that belong to the order Eulipotyphla. The overall prevalence of Sarcocystis spp. was low, reaching 1.38%. Relatively higher, however, a not significant infection rate of Sarcocystis spp. was established in voles (2.23%) than in the mice of the genus Apodemus (0.79%).
The prevalence of Sarcocystis was not related to the abundance of small mammal species tested. The most numerous species were M. arvalis (28.7%), A. flavicollis (27.9%), A. agrarius (22.2%), and C. glareolus (12.0%) with respect to all of the trapped small mammals [21]—this being not in line with their infection rate (Table 3). Five of the sites where the infection was registered are age-old apple orchards (i.e., sites Aukštikalniai, Ažuožeriai, Tytuvėnai, Dembava, and Luksnėnai), and one site, Užpaliai, is a young raspberry plantation.
There is a lack of research on the prevalence of Sarcocystis spp. in small mammals worldwide [75]. Researchers have suggested that the infection rates of various Sarcocystis depend on the parasite species, intermediate host species, geographic area, as well as on the availability and abundance of definitive hosts in the area under study [32,50,75]. Previous studies conducted in Lithuania showed the tendency for Sarcocystis spp. infection rates to differ depending on the species of small mammals [53,54,55]. In two species of the genus Apodemus, A. agrarius and A. flavicollis, the prevalence of Sarcocystis spp. reached 1.18% [53,54]. Thus, the occurrence rate of the examined parasites in the mice of the genus Apodemus (Table 3) is in congruence with the previous studies carried out in Lithuania. The prevalence of Sarcocystis spp. in the three vole species most comprehensively examined in the country (C. glareolus, M. agrestis, and M. arvalis) ranged from 1.81 to 5.26% in the environs of Lake Drūkšiai [55], to 11.40 to 20% in the Kamasta landscape reserve [53]. Based on the data of the previous investigations conducted in Lithuania and the current study, the infection rates of the Sarcocystis spp. in the muscles of small mammals mainly depend on the host species and the environment.
4.2. Sarcocystis Species Identification and Richness in Small Mammals Inhabiting Orchards
The sequence comparison of cox1 and 28S rDNA indicated the presence of four Sarcocystis species (S. myodes, Sarcocystis cf. strixi, Sarcocystis sp. Rod1, and Sarcocystis sp. Rod2) in the small mammals that were collected in the orchards of Lithuania (Figure 3, Table 4). Sarcocystis myodes was originally described in the skeletal muscles of C. glareolus [32]; meanwhile, in the current work, this species was apart from the already known intermediate hosts found in A. agrarius, A. flavicollis, and M. arvalis. Thus, this Sarcocystis species is not strictly host-specific and could infect the mammals belonging to the families Cricetidae (C. glareolus, M. arvalis) and Muridae (A. agrarius, A. flavicollis). The intraspecific variation of S. myodes amounted to 0.82% within the 28S rDNA fragment analyzed. Based on 28S rDNA, S. myodes displayed a great genetic similarity to Sarcocystis sp. Rod1 (Figure 2 and Table 4), which was identified in two vole species—M. arvalis and M. oeconomus. Future research on the morphological and genetic characterization of Sarcocystis sp. Rod1, as well as on the determination of the spectrum of intermediate hosts, are needed.
Additionally, the results of the current study showed that one isolate from A. flavicollis was 100% identical to S. strixi within a 619 bp fragment of cox1. It also showed a 98.91% similarity with S. strixi (Table 4) (whose gamma gene knockout mice is an experimental intermediate host, and the barred owl is a definitive host [71]). In the previous study, 18S rDNA, 28S rRNA, and cox1 loci were used for the genetic characterization of S. strixi [71]. This Sarcocystis species was described in the USA. On the basis of the present work, it is very likely that A. flavicollis might be a natural intermediate host of S. strixi in Europe; however, further comprehensive investigations of Sarcocystis cf. strixi from the A. flavicollis on sarcocysts morphology, as well as the genetic identification in complete or nearly complete 18S rDNA, 28S rRNA, and cox1, are required. Furthermore, Sarcocystis sp. Rod2 were identified in the two isolates of M. arvalis and showed the greatest genetic similarity to the several Sarcocystis spp. (such as S. arctica, S. calchasi, S. columbae, S. cornixi, S. corvusi, S. fulicae, S. halieti, S. lari, S. lutrae, and S. turdusi) that use birds and predatory mammals as their intermediate hosts, as well as predatory or omnivorous birds as their definitive hosts [76,77,78,79,80,81,82]. Interestingly, the S. tupaia from small mammals—namely, from tree shrews (Tupaia belangeri chinensis)—also demonstrated the closest similarity within 18S rDNA to the various Sarcocystis species that are distinguished by a bird–bird life cycle [49].
The studies on Sarcocystis spp. in the genus Apodemus are very scarce, and only two species, S. microti and S. sebeki, have been described in these hosts [28,29,83]; this contrasts with the more than dozen Sarcocystis spp. detected in voles [32,39]. Previous investigations of Sarcocystis spp. in the voles and mice of the genus Apodemus relied mainly on morphological and life cycle studies [29], and only S. clethrionomyelaphis, S. glareoli, S. microti, and S. myodes have been examined by means of DNA sequence analysis [32,34,36,37,38]. Therefore, it is difficult to compare the species identified in this work with those previously described in the same or taxonomically closely related hosts. Our further research should be directed toward the isolation of individual sarcocysts from the muscles of small mammals. In addition, their characterization will be achieved via light and electron microscopy, as well as by DNA sequence analysis, at several loci.
It is noteworthy that, in the present study, only two species were reliably distinguished by an analysis of the partial cox1 sequences, while two species were identified using 28S rDNA (Figure 3, Table 4). When investigating the Sarcocystis spp. from small mammals, other previous studies have also indicated higher interspecific variability within 28S rDNA when compared to cox1 [30,32,41,75]. Apart from 28S rDNA and cox1, various genetic markers have been applied for the genetic identification of the Sarcocystis spp. in small mammals. Most of these species are characterized by 18S rDNA, 28S rDNA, and cox1 [41]. The first investigations of the ITS1 region in the Sarcocystis spp. from small mammals did not reveal significant BLAST similarity hits [30,41]. However, as the ITS1 sequence database accumulated, further examinations showed that this highly variable region could be very useful in differentiating the closely related Sarcocystis spp. from small mammals [32,50]. It has also been shown recently that a complete ITS1–5.8S rDNA–ITS2 region could be useful for the evolutionary studies of Sarcocystis spp. from small mammals [47]. Other investigators demonstrated that mitochondrial cytochrome b (cytb) was a better choice than 18S rDNA and cox1 for the discrimination of the closely related S. cymruensis and S. ratti that parasitize rats [35]. In addition to the genetic loci discussed, S. attenuati was characterized at two apicoplast genes—RNA polymerase beta subunit (rpoB) and caseinolytic protease C (clpC) [50]. The primary results indicated that these two apicoplast DNA loci can be potentially valuable for the discrimination of Sarcocystis spp. from small mammals. Considering the existing genetic studies on Sarcocystis spp. in small mammals, it is recommended that the Sarcocystis species identified in this study be further characterized in the future via more informative genetic markers. This would help in obtaining a more comprehensive understanding of their genetic profiles.
Small mammals can adapt to any terrestrial environment, including areas closely related to the human environment [84]. To the best of our knowledge, research on the extent of Sarcocystis spp. richness exclusively in orchards has not yet been conducted. The present study showed the presence of four Sarcocystis spp. in the muscle tissues of small mammals inhabiting orchards. Of these species, Sarcocystis sp. Rod1 and Sarcocystis sp. Rod2 are potentially new species. The possible pathogenicity of genetically determined Sarcocystis species should be further examined as small mammals have an important role in the epidemiology of numerous parasitic diseases [75].
4.3. Ecological and Phylogenetic Insights on the Definitive Hosts of Detected Sarcocystis Species
A coevolution of Sarcocystis spp. from small mammals to their definitive hosts, rather than to their intermediate hosts, have been shown in a series of studies [61,85]. Currently, possible definitive hosts of Sarcocystis species are suggested based on phylogenetic results [86,87,88,89]. The phylogenetic analysis of this work showed that the presumed definitive hosts of S. myodes and Sarcocystis sp. Rod1 are predatory mammals, while the assumed definitive hosts of Sarcocystis cf. strixi and Sarcocystis sp. Rod2 are birds of prey (Figure 3). Based on 28S rDNA, two main clades were defined in the phylogenetic group of Sarcocystis spp., whose identified or supposed definitive hosts are birds (Figure 3b). The second lesser species-numerous clades contained S. strixi (which employs the bared owl as a definitive host), the Sarcocystis cf. strixi from A. flavicollis, and the Sarcocystis sp. (MF162316) from the intestinal mucosa of the Tengmalm’s owl (Aegolius funereus) [71,74]. Thus, the definitive hosts of these Sarcocystis spp. are members of the order Strigiformes, whereas representatives of the genus Accipiter, Buteo, and Haliaeetus belong to the order Accipitriformes, which were identified as the definitive hosts of species-numerous phylogenetic clades by means of laboratory experiments or DNA analysis [36,37,76,79,80,81,82]. In view of what is stated above, the birds of prey of the order Accipitriformes are presumed to be the definitive hosts of Sarcocystis sp. Rod1.
The current study showed no evidence of the existence of the Sarcocystis species being transmitted by snakes in Lithuanian orchards. By contrast, a recent molecular study conducted in the peri-urban area in northeast Spain suggested at least three Sarcocystis spp., with a life cycle of rodents as intermediates hosts and snakes as definitive hosts [74]. Although the adder (Vipera berus) and grass snake (Natrix natrix) are not uncommon in Lithuania, with the grass snake being frequently encountered near human settlements, these snake species have not yet been observed in commercial orchards to date [90].
5. Conclusions
Based on the pooling of muscle samples, pepsin digestion, the nested PGR targeting of cox1 and 28S rRNA, and sequencing, a low Sarcocystis spp. prevalence (1.38%, 95% CI = 0.68–2.52) was determined in the small mammals that were collected from commercial orchards and berry plantations in Lithuania. According to the current knowledge, the infection rates of Sarcocystis spp. in small mammals are mostly dependent on the host species and environment.
Four Sarcocystis spp., S. myodes, Sarcocystis cf. strixi, Sarcocystis sp. Rod1, and Sarcocystis sp. Rod2, were identified in the present study. Three new intermediate hosts (A. agrarius, A. flavicollis, and M. arvalis) were confirmed for the recently described S. myodes. Molecular results suggest that A. flavicollis might be a natural intermediate host of S. strixi in Europe, and that Sarcocystis sp. Rod1 and Sarcocystis sp. Rod2 are potentially a new species. Phylogenetic analysis showed that mammals and birds are most likely the definitive hosts of S. myodes and Sarcocystis sp. Rod1, and Sarcocystis cf. strixi and Sarcocystis sp. Rod2, respectively. Additional genetic characterization that uses more genetic markers is required to further understand the detected Sarcocystis species. Moreover, a comprehensive morphological characterization of the Sarcocystis species discovered in this study should be carried out with light and electron microscopy. Additionally, it is crucial to investigate the definitive hosts and ascertain the potential pathogenicity of the identified parasites.
Acknowledgments
We are grateful to Eglė Rudaitytė-Lukošienė for her advice and assistance in carrying out molecular studies.
Author Contributions
Conceptualization, D.B., P.P. and L.B.; methodology, P.P. and D.B.; validation, L.B., P.P., D.Š. and D.B.; formal analysis, P.P. and L.B.; investigation, V.S., D.Š., P.R. and L.B.; resources, D.B.; data curation, V.S.; visualization P.P., V.S. and L.B.; writing—original draft preparation, P.P. and L.B.; writing—review and editing, all authors. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
The study was conducted in accordance with Lithuanian legislation (the Republic of Lithuania Law on the Welfare and Protection of Animals No. XI-2271, “Requirements for the Housing, Care and Use of Animals for Scientific and Educational Purposes”, approved by Order No B1-866, 31 October 2012 of the Director of the State Food and Veterinary Service (Paragraph 4 of Article 16) and European legislation (Directive 2010/63/EU) on the protection of animals and post hoc approved by the Animal Welfare Committee of the Nature Research Centre, protocol No GGT-8). Snap trapping was justifiable as we studied the reproduction parameters, as well as collected tissues and internal organs for an analysis of pathogens, elemental content, and stable isotopes (not covered in this publication).
Data Availability Statement
The 28S rDNA and cox1 sequences of Sarcocystis spp. obtained in the present study were submitted to the GenBank database under accession numbers OQ557453-OQ557461 and OQ558004-OQ558012, respectively.
Conflicts of Interest
The authors declare no conflict of interest.
Funding Statement
This research received no external funding, and it was conducted under a long-term research program of the Nature Research Centre.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Wilson D.E., Lacher T.E., Mittermeier R.A. Handbook of the Mammals of the World. Volume 7 Lynx Edicions; Barselona, Spain: 2017. [Google Scholar]
- 2.Burgin C., Colella J., Kahn P., Upham N. How many species of mammals are there? J. Mammal. 2018;99:1–14. doi: 10.1093/jmammal/gyz052. [DOI] [Google Scholar]
- 3.Malecha A.W., Antczak M. Diet of the European polecat Mustela putorius in an agricultural area in Poland. Folia. Zool. 2013;62:48–53. doi: 10.25225/fozo.v62.i1.a7.2013. [DOI] [Google Scholar]
- 4.Grabham A.A., Ventress G., Hayward M.W. The diet of denning female European pine martens (Martes martes) in Galloway Forest District, South West Scotland, Great Britain. Mammal. Res. 2019;64:87–97. doi: 10.1007/s13364-018-0398-5. [DOI] [Google Scholar]
- 5.Gryz J., Krauze-Gryz D. Changes in the tawny owl Strix aluco diet along an urbanisation gradient. Biologia. 2019;74:279–285. doi: 10.2478/s11756-018-00171-1. [DOI] [Google Scholar]
- 6.Avotins A., Avotins A., Sr., Ķerus V., Aunins A. Numerical response of owls to the dampening of small mammal population cycles in Latvia. Life. 2023;13:572. doi: 10.3390/life13020572. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Halle S. Diel pattern of predation risk in microtine rodents. Oikos. 1993;68:510–518. doi: 10.2307/3544919. [DOI] [Google Scholar]
- 8.Fargallo J.A., Martinez–Padilla J., Vinuela J., Blanco G., Torre I., Vergara P., De Neve L. Kestrel prey dynamic in a Mediterranean region: The effect of generalist predation and climatic factors. PLoS ONE. 2009;4:4311. doi: 10.1371/journal.pone.0004311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Terraube J., Arroyo B., Madders M., Mougeot F. Diet specialisation and foraging efficiency under fluctuating vole abundance: A comparison between generalist and specialist avian predators. Oikos. 2011;120:234–244. doi: 10.1111/j.1600-0706.2010.18554.x. [DOI] [Google Scholar]
- 10.Balčiauskienė L., Balčiauskas L., Vitkauskas V., Podėnas S. Indoor small mammals in Lithuania: Some morphometrical, body condition, and reproductive characteristics. Zool. Ecol. 2015;25:305–313. doi: 10.1080/21658005.2015.1086098. [DOI] [Google Scholar]
- 11.Balčiauskas L., Balčiauskienė L. On the doorstep, rodents in homesteads and kitchen gardens. Animals. 2020;10:856. doi: 10.3390/ani10050856. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Mazza V., Dammhahn M., Lösche E., Eccard J.A. Small mammals in the big city: Behavioural adjustments of non-commensal rodents to urban environments. Glob. Chang. Biol. 2020;26:6326–6337. doi: 10.1111/gcb.15304. [DOI] [PubMed] [Google Scholar]
- 13.Delattre P., Pascal M., Le Pesteur M.H., Giraudoux P., Damange J.P. Ecological and epidemiological characteristics of Echinococcus multilocularis during a complete population cycle of the secondary host (Microtus arvalis) Can. J. Zool. 1988;66:2740–2750. doi: 10.1139/z88-401. [DOI] [Google Scholar]
- 14.Pikula J., Treml F., Beklova M., Holešovská Z., Pikulova J. Geographic information systems in epidemiology–ecology of common vole and distribution of natural foci of Tularaemia. Acta Vet. Brno. 2002;71:379–387. doi: 10.2754/avb200271030379. [DOI] [Google Scholar]
- 15.Sinski E., Pawelczyk A., Bajer A., Behnke J.M. Abundance of wild rodents, ticks and environmental risk of Lyme borreliosis: A longitudinal study in an area of Mazury Lakes district of Poland. Ann. Agr. Env. Med. 2006;13:295–300. [PubMed] [Google Scholar]
- 16.Jeske K., Schulz J., Tekemen D., Balčiauskas L., Balčiauskienė L., Hiltbrunner M., Ulrich R.G. Cocirculation of Leptospira spp. and multiple orthohantaviruses in rodents, Lithuania, Northern Europe. Transbound. Emerg. Dis. 2022;69:e3196–e3201. doi: 10.1111/tbed.14470. [DOI] [PubMed] [Google Scholar]
- 17.Prūsaitė J. Lietuvos fauna. Žinduoliai. Mokslas; Vilnius, Lithuania: 1988. [Google Scholar]
- 18.Balčiauskas L., Balčiauskienė L. Small mammal diversity changes in a Baltic country, 1975–2021: A review. Life. 2022;12:1887. doi: 10.3390/life12111887. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Balčiauskas L., Balčiauskienė L., Stirkė V. Mow the grass at the mouse’s peril: Diversity of small mammals in commercial fruit farms. Animals. 2019;9:334. doi: 10.3390/ani9060334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Stirkė V., Balčiauskas L., Balčiauskienė L. Spatiotemporal variation of small mammal communities in commercial orchards across the small country. Agriculture. 2022;12:632. doi: 10.3390/agriculture12050632. [DOI] [Google Scholar]
- 21.Balčiauskas L., Stirkė V., Balčiauskienė L. Abundance and population structure of small rodents in fruit and berry farms. Life. 2023;13:375. doi: 10.3390/life13020375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lerner H., Berg C. The concept of health in One Health and some practical implications for research and education: What is One Health? Infect. Ecol. Epidemiology. 2015;5:25300. doi: 10.3402/iee.v5.25300. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Galán-Puchades M.T., Trelis M., Sáez-Durán S., Cifre S., Gosálvez C., Sanxis-Furió J., Pascual J., Bueno-Marí R., Franco S., Peracho V., et al. One health approach to zoonotic parasites: Molecular detection of intestinal protozoans in an urban population of Norway rats, Rattus norvegicus, in Barcelona, Spain. Pathogens. 2021;10:311. doi: 10.3390/pathogens10030311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Perec-Matysiak A., Bunkowska-Gawlik K., Zalesny G., Hildebrand J. Small rodents as reservoirs of Cryptosporidium spp. and Giardia spp. in south-western Poland. Ann. Agr. Env. Med. 2015;22:1–5. doi: 10.5604/12321966.1141359. [DOI] [PubMed] [Google Scholar]
- 25.Webster J.P., Macdonald D.W. Cryptosporidiosis reservoir in wild brown rats (Rattus norvegicus) in the UK. Epidemiol. Infect. 1995;115:207–209. doi: 10.1017/S0950268800058271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Lõhmus M., Albihn A. Gastrointestinal pathogens in rodents overwintering in human facilities around Uppsala, Sweden. J. Wildlife Dis. 2013;49:747–749. doi: 10.7589/2013-02-028. [DOI] [PubMed] [Google Scholar]
- 27.Kilonzo C., Li X., Vivas E.J., Jay-Russell M.T., Fernandez K.L., Atwill E.R. Fecal shedding of zoonotic food-borne pathogens by wild rodents in a major agricultural region of the central California coast. Appl. Environ. Microb. 2013;79:6337–6344. doi: 10.1128/AEM.01503-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Odening K. The Present State of Species-Systematics in Sarcocystis Lankester, 1882 (Protista, Sporozoa, Coccidia) Syst. Parasitol. 1998;41:209–233. doi: 10.1023/A:1006090232343. [DOI] [Google Scholar]
- 29.Dubey J.P., Calero-Bernal R., Rosenthal B.M., Speer C.A., Fayer R. Sarcocystosis of Animals and Humans. 2nd ed. CRC Press; Boca Raton, FL, USA: 2016. [Google Scholar]
- 30.Antunes Murata F.H., Cerqueira-Cézar C.K., Thompson P.C., Tiwari K., Mowery J.D., Verma S.K., Rosenthal B.M., Sharma R.N., Dubey J.P. Sarcocystis cymruensis: Discovery in western hemisphere in the brown rat (Rattus norvegicus) from Grenada, West Indies: Redescription, molecular characterization, and transmission to IFN- gene knockout mice via sporocysts from experimentally infected domestic cat (Felis catus) Parasitol. Res. 2018;117:1195–1204. doi: 10.1007/s00436-018-5799-5. [DOI] [PubMed] [Google Scholar]
- 31.Ortega Pérez P., Wibbelt G., Brinkmann A., Galindo Puentes J.A., Tuh F.Y.Y., Lakim M.B., Nitsche A., Wells K., Jäkel T. Description of Sarcocystis scandentiborneensis sp. nov from treeshrews (Tupaia minor, T. tana) in Northern Borneo with annotations on the utility of COI and 18S rDNA sequences for species delineation. Int. J. Parasitol. Parasites Wildl. 2020;12:220–231. doi: 10.1016/j.ijppaw.2020.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Rudaitytė-Lukošienė E., Jasiulionis M., Balčiauskas L., Prakas P., Stirkė V., Butkauskas D. Morphological and Molecular Description of Sarcocystis myodes n. sp. from the Bank Vole (Clethrionomys glareolus) in Lithuania. Biology. 2022;1:512. doi: 10.3390/biology11040512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Doležel D., Koudela B., Jirků M., Hypsa V., Oborník M., Votýpka J., Modrý D., Slapeta J.R., Lukes J. Phylogenetic analysis of Sarcocystis spp. of mammals and reptiles supports the coevolution of Sarcocystis spp. with their final hosts. Int. J. Parasitol. 1999;29:795–798. doi: 10.1016/s0020-7519(99)00018-1. [DOI] [PubMed] [Google Scholar]
- 34.Hu J.J., Liu T.T., Liu Q., Esch G.W., Chen J.Q. Sarcocystis clethrionomyelaphis Matuschka, 1986 (Apicomplexa: Sarcocystidae) infecting the large oriental vole Eothenomys miletus (Thomas) (Cricetidae: Microtinae) and its phylogenetic relationships with other species of Sarcocystis Lankester, 1882. Syst. Parasitol. 2015;91:273–279. doi: 10.1007/s11230-015-9572-1. [DOI] [PubMed] [Google Scholar]
- 35.Zeng H., Guo Y., Ma C., Deng S., Hu J., Zhang Y. Redescription and molecular characterization of sarcocysts of Sarcocystis cymruensis from Norway rats (Rattus norvegicus) and Sarcocystis ratti from black rats (R. rattus) in China. Parasitol. Res. 2020;119:3785–3791. doi: 10.1007/s00436-020-06883-1. [DOI] [PubMed] [Google Scholar]
- 36.Votýpka J., Hypsa V., Jirků M., Flegr J., Vávra J., Lukes J. Molecular phylogenetic relatedness of Frenkelia spp. (Protozoa, Apicomplexa) to Sarcocystis falcatula Stiles 1893: Is the genus Sarcocystis paraphyletic? J. Eukaryot. Microbiol. 1998;45:137–141. doi: 10.1111/j.1550-7408.1998.tb05081.x. [DOI] [PubMed] [Google Scholar]
- 37.Mugridge N.B., Morrison D.A., Johnson A.M., Luton K., Dubey J.P., Votýpka J., Tenter A.M. Phylogenetic relationships of the genus Frenkelia: A review of its history and new knowledge gained from comparison of large subunit ribosomal ribonucleic acid gene sequences. Int. J. Parasitol. 1999;29:957–972. doi: 10.1016/s0020-7519(99)00062-4. [DOI] [PubMed] [Google Scholar]
- 38.Gajadhar A.A., Marquardt W.C., Hall R., Gunderson J., Ariztia-Carmona E.V., Sogin M.L. Ribosomal RNA sequences of Sarcocystis muris, Theileria annulata and Crypthecodinium cohnii reveal evolutionary relationships among apicomplexans, dinoflagellates, and ciliates. Mol. Biochem. Parasitol. 1991;45:147–154. doi: 10.1016/0166-6851(91)90036-6. [DOI] [PubMed] [Google Scholar]
- 39.Verma S.K., Lindsay D.S., Rosenthal B.M., Dubey J.P. Ancient, globally distributed lineage of Sarcocystis from sporocysts of the eastern rat snake (Pantherophis alleghaniensis) and its relation to neurological sequalae in intermediate hosts. Parasitol. Res. 2016;115:2697–2704. doi: 10.1007/s00436-016-5086-2. [DOI] [PubMed] [Google Scholar]
- 40.Verma S.K., Lindsay D.S., Mowery J.D., Rosenthal B.M., Dubey J.P. Sarcocystis pantherophisi n. sp., from eastern rat snakes (Pantherophis alleghaniensis) as definitive hosts and interferon gamma gene knockout mice as experimental intermediate hosts. J. Parasitol. 2017;103:547–554. doi: 10.1645/17-2. [DOI] [PubMed] [Google Scholar]
- 41.Prakas P., Kirillova V., Gavarāne I., Grāvele E., Butkauskas D., Rudaitytė-Lukošienė E., Kirjušina M. Morphological and molecular description of Sarcocystis ratti n. sp. from the black rat (Rattus rattus) in Latvia. Parasitol. Res. 2019;118:2689–2694. doi: 10.1007/s00436-019-06393-9. [DOI] [PubMed] [Google Scholar]
- 42.Mugridge N.B., Morrison D.A., Jäkel T., Heckeroth A.R., Tenter A.M., Johnson A.M. Effects of sequence alignment and structural domains of ribosomal DNA on phylogeny reconstruction for the protozoan family Sarcocystidae. Mol. Biol. Evol. 2000;17:1842–1853. doi: 10.1093/oxfordjournals.molbev.a026285. [DOI] [PubMed] [Google Scholar]
- 43.Šlapeta J.R., Kyselová I., Richardson A.O., Modrý D., Lukeš J. Phylogeny and sequence variability of the Sarcocystis singaporensis Zaman and Colley, (1975) 1976 ssrDNA. Parasitol. Res. 2002;88:810–815. doi: 10.1007/s00436-002-0657-9. [DOI] [PubMed] [Google Scholar]
- 44.Hu J.J., Meng Y., Guo Y.M., Liao J.Y., Song J.L. Completion of the life cycle of Sarcocystis zuoi, a parasite from the Norway rat, Rattus norvegicus. J. Parasitol. 2012;98:550–553. doi: 10.1645/GE-2831.1. [DOI] [PubMed] [Google Scholar]
- 45.Lau Y.L., Chang P.Y., Subramaniam V., Ng Y.H., Mahmud R., Ahmad A.F., Fong M.Y. Genetic assemblage of Sarcocystis spp. in Malaysian snakes. Parasit. Vectors. 2013;6:257. doi: 10.1186/1756-3305-6-257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Abe N., Matsubara K., Tamukai K., Miwa Y., Takami K. Molecular evidence of Sarcocystis species in captive snakes in Japan. Parasitol. Res. 2015;114:3175–3179. doi: 10.1007/s00436-015-4564-2. [DOI] [PubMed] [Google Scholar]
- 47.Watthanakaiwan V., Sukmak M., Hamarit K., Kaolim N., Wajjwalku W., Muangkram Y. Molecular characterization of the ribosomal DNA unit of Sarcocystis singaporensis, Sarcocystis zamani and Sarcocystis zuoi from rodents in Thailand. J. Vet. Med. Sci. 2017;79:1412–1418. doi: 10.1292/jvms.16-0086. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Mohd Fadil N.F., Tengku-Idris T.I.N., Shahari S., Fong M.Y., Lau Y.L. Molecular evidence of Sarcocystis species infecting reptiles in peninsular Malaysia. Iran. J. Parasitol. 2019;14:623–630. [PMC free article] [PubMed] [Google Scholar]
- 49.Xiang Z., Rosenthal B.M., He Y., Wang W., Wang H., Song J., Shen P.Q., Li M.L., Yang Z. Sarcocystis tupaia, sp. nov., a new parasite species employing treeshrews (Tupaiidae, Tupaia belangeri chinensis) as natural intermediate hosts. Parasitol. Int. 2010;59:128–132. doi: 10.1016/j.parint.2009.12.003. [DOI] [PubMed] [Google Scholar]
- 50.Hu J., Sun J., Guo Y., Zeng H., Zhang Y., Tao J. Infection of the Asian gray shrew Crocidura attenuata (Insectivora: Soricidae) with Sarcocystis attenuati n. sp. (Apicomplexa: Sarcocystidae) in China. Parasite. Vector. 2022;15:13. doi: 10.1186/s13071-021-05136-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Dissanaike A.S., Poopalachelvam M. Sarcocystis booliati n. sp. and a parasite of undetermined taxonomic position, Octoplasma garnhami n. gen. n. sp., from the Moonrat, Echinosorex gymnurus. Southeast Asian J. Trop. Med. Public. Health. 1975;6:175–185. [PubMed] [Google Scholar]
- 52.Pak S.M., Sklyarova O.N., Dymkova N.D. Sarcocysts (Sporozoa, Apicomplexa) of some wild mammals. Izvest. Akad. Nauk. Kazakh. Ser. Biol. 1991;5:35–40. (In Russian) [Google Scholar]
- 53.Grikienienė J., Mažeikytė R. Investigation of sarcosporidians (Sarcocystis) of small mammals in Kamasta landscape reserve and its surroundings. Acta Zool. Litu. 2000;10:55–68. doi: 10.1080/13921657.2000.10512336. [DOI] [Google Scholar]
- 54.Grikienienė J., Malakauskas M., Mažeikytė R., Balčiauskas L., Senutaitė J. Muscle parasites (Sarcocystis, Trichinella, Alaria) of wild mammals in Lithuania. Theriol. Litu. 2001;1:29–46. [Google Scholar]
- 55.Grikienienė J. Investigations into Endoparasites of Small Mammals in the Environs of Lake Drūkšiai. Acta Zool. Litu. 2005;15:109–114. doi: 10.1080/13921657.2005.10512384. [DOI] [Google Scholar]
- 56.Prakas P., Rehbein S., Rudaitytė-Lukošienė E., Butkauskas D. Molecular identification of Sarcocystis species in diaphragm muscle tissue of European mouflon (Ovis gmelini musimon) from Austria. Parasitol. Res. 2021;20:2695–2702. doi: 10.1007/s00436-021-07212-w. [DOI] [PubMed] [Google Scholar]
- 57.Prakas P., Bea A., Juozaitytė-Ngugu E., Olano I., Villanúa D., Švažas S., Butkauskas D. Molecular identification of Sarcocystis halieti in the muscles of two species of birds of prey from Spain. Parasite. Vector. 2021;14:414. doi: 10.1186/s13071-021-04921-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Balčiauskas L. Methods of Investigation of Terrestrial Ecosystems, Part. I. Animal Surveys. VU Leidykla; Vilnius, Lithuania: 2004. p. 183. [Google Scholar]
- 59.Untergasser A., Cutcutache I., Koressaar T., Ye J., Faircloth B.C., Remm M., Rozen S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012;40:115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Holmdahl O.J., Morrison D.A., Ellis J.T., Huong L.T. Evolution of ruminant Sarcocystis (Sporozoa) parasites based on small subunit rDNA sequences. Mol. Phylogenet. Evol. 1999;11:27–37. doi: 10.1006/mpev.1998.0556. [DOI] [PubMed] [Google Scholar]
- 61.Gjerde B. Phylogenetic relationships among Sarcocystis species in cervids, cattle and sheep inferred from the mitochondrial cytochrome c oxidase subunit I gene. Int. J. Parasitol. 2013;43:579–591. doi: 10.1016/j.ijpara.2013.02.004. [DOI] [PubMed] [Google Scholar]
- 62.Gjerde B. Molecular characterisation of Sarcocystis rileyi from a Common Eider (Somateria mollissima) in Norway. Parasitol. Res. 2014;113:3501–3509. doi: 10.1007/s00436-014-4062-y. [DOI] [PubMed] [Google Scholar]
- 63.Babicki S., Arndt D., Marcu A., Liang Y., Grant J.R., Maciejewski A., Wishart D.S. Heatmapper: Web-enabled heat mapping for all. Nucleic. Acids. Res. 2016;44:W147–W153. doi: 10.1093/nar/gkw419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Kumar S., Stecher G., Tamura K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016;33:1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Milne I., Wright F., Rowe G., Marshall D., Husmeier D., McGuire G. TOPALi: Software for automatic identification of recombinant sequences Within DNA multiple alignments. Bioinformatics. 2004;20:1806–1807. doi: 10.1093/bioinformatics/bth155. [DOI] [PubMed] [Google Scholar]
- 66.Biggerstaff B.J. Confidence intervals for the difference of two proportions estimated from pooled samples. JABES. 2008;13:478–496. doi: 10.1198/108571108X379055. [DOI] [Google Scholar]
- 67.Biggerstaff B.J. PooledInfRate, Version 4.0: A Microsoft® Office Excel© Add-In to Compute Prevalence Estimates from Pooled Samples. Centers for Disease Control and Prevention, Fort Collins, CO, U.S.A. [(accessed on 10 January 2023)];2009 Available online: https://www.cdc.gov/westnile/resourcepages/mosqSurvSoft.html.
- 68.Hepworth G. Confidence intervals for proportions estimated by group testing with groups of unequal size. J. Agr. Biol. Envir. St. 2005;10:478–497. doi: 10.1198/108571105x81698. [DOI] [Google Scholar]
- 69.Abramson J.H. WINPEPI updated: Computer programs for epidemiologists, and their teaching potential. Epidemiol. Perspect. Innov. 2011;8:1. doi: 10.1186/1742-5573-8-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Sawilowsky S.S. New effect size rules of thumb. J. Mod. Appl. Stat. Methods. 2009;8:597–599. doi: 10.22237/jmasm/1257035100. [DOI] [Google Scholar]
- 71.Verma S.K., von Dohlen A.R., Mowery J.D., Scott D., Cerqueira-Cézar C.K., Rosenthal B.M., Dubey J.P., Lindsay D.S. Sarcocystis strixi n. sp. from a Barred Owl (Strix varia) definitive host and interferon gamma gene knockout mice as experimental intermediate host. J. Parasitol. 2017;103:768–777. doi: 10.1645/16-173. [DOI] [PubMed] [Google Scholar]
- 72.Máca O. Molecular Identification of Sarcocystis lutrae (Apicomplexa: Sarcocystidae) from the Raccoon Dog, Nyctereutes procyonoides, and the Common Raccoon, Procyon lotor, in the Czech Republic. Parasit. Vector. 2020;13:231. doi: 10.1186/s13071-020-04108-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Prakas P., Kutkienė L., Butkauskas D., Sruoga A., Žalakevičius M. Description of Sarcocystis lari sp. n. (Apicomplexa: Sarcocystidae) from the great black-backed gull, Larus marinus (Charadriiformes: Laridae), on the basis of cyst morphology and molecular data. Folia Parasitol. 2014;61:11–17. doi: 10.14411/fp.2014.002. [DOI] [PubMed] [Google Scholar]
- 74.Máca O., Kouba M., Korpimäki E., González-Solís D. Molecular identification of Sarcocystis sp. (Apicomplexa, Sarcocystidae) in offspring of Tengmalm’s Owls, Aegolius funereus (Aves, Strigidae) Front. Vet. Sci. 2021;8:804096. doi: 10.3389/fvets.2021.804096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Fernández-Escobar M., Millán J., Chirife A.D., Ortega-Mora L.M., Calero-Bernal R. Molecular survey for cyst-forming coccidia (Toxoplasma gondii, Neospora caninum, Sarcocystis spp.) in Mediterranean periurban micromammals. Parasitol. Res. 2020;119:2679–2686. doi: 10.1007/s00436-020-06777-2. [DOI] [PubMed] [Google Scholar]
- 76.Mayr S.L., Maier K., Müller J., Enderlein D., Gruber A.D., Lierz M. Accipiter hawks (Accipitridae) confirmed as definitive Hosts of Sarcocystis turdusi, Sarcocystis cornixi and Sarcocystis sp. ex Phalacrocorax carbo. Parasitol. Res. 2016;115:3041–3047. doi: 10.1007/s00436-016-5059-5. [DOI] [PubMed] [Google Scholar]
- 77.Kirillova V., Prakas P., Calero-Bernal R., Gavarāne I., Fernández-García J.L., Martínez-González M., Rudaitytė-Lukošienė E., Martínez-Estéllez M.Á.H., Butkauskas D., Kirjušina M. Identification and genetic characterization of Sarcocystis arctica and Sarcocystis lutrae in red foxes (Vulpes vulpes) from Baltic States and Spain. Parasit. Vector. 2018;11:173. doi: 10.1186/s13071-018-2694-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Juozaitytė-Ngugu E., Švažas S., Šneideris D., Rudaitytė-Lukošienė E., Butkauskas D., Prakas P. The role of birds of the family Corvidae in transmitting Sarcocystis protozoan parasites. Animals. 2021;11:3258. doi: 10.3390/ani11113258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Rogers K.H., Arranz-Solís D., Saeij J.P.J., Lewis S., Mete A. Sarcocystis calchasi and other Sarcocystidae detected in predatory birds in California, USA. Int. J. Parasitol. Parasites Wildl. 2021;17:91–99. doi: 10.1016/j.ijppaw.2021.12.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Máca O., González-Solís D. Role of three bird species in the life cycle of two Sarcocystis spp. (Apicomplexa, Sarcocystidae) in the Czech Republic. Int. J. Parasitol. Parasites Wildl. 2022;17:133–137. doi: 10.1016/j.ijppaw.2022.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81.Máca O., González-Solís D. White-Tailed Eagle (Haliaeetus albicilla) as the definitive Host of Sarcocystis lutrae in the Czech Republic. Front. Vet. Sci. 2022;9:981829. doi: 10.3389/fvets.2022.981829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Šukytė T., Butkauskas D., Juozaitytė-Ngugu E., Švažas S., Prakas P. Molecular confirmation of Accipiter birds of prey as definitive hosts of numerous Sarcocystis species, including Sarcocystis sp., closely related to pathogenic S. calchasi. Pathogens. 2023;12:752. doi: 10.3390/pathogens12060752. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Kim T.H., Han J.H., Chang S.N., Kim D.S., Abdelkader T.S., Seok S.H., Park J.H., Oh H.S., Kim J.T., Lee B.H., et al. Detection of sarcocystic infection in a wild rodent (Apodemus agrarius chejuensis) captured on Jeju island. Lab. Anim. Res. 2011;27:357–359. doi: 10.5625/lar.2011.27.4.357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Nevo E. Adaptive convergence and divergence of subterranean mammals. Annu. Rev. Ecol. Syst. 1979;10:269–308. doi: 10.1146/annurev.es.10.110179.001413. [DOI] [Google Scholar]
- 85.Šlapeta J.R., Modrý D., Votýpka J., Jirků M., Lukeš J., Koudela B. Evolutionary relationships among Cyst-Forming Coccidia Sarcocystis spp. (Alveolata: Apicomplexa: Coccidea) in endemic African tree vipers and perspective for evolution of heteroxenous life cycle. Mol. Phylogenet. Evol. 2003;27:464–475. doi: 10.1016/S1055-7903(03)00018-6. [DOI] [PubMed] [Google Scholar]
- 86.Moré G., Regensburger C., Gos M.L., Pardini L., Verma S.K., Ctibor J., Serrano-Martínez M.E., Dubey J.P., Venturini M.C. Sarcocystis masoni, n. sp. (Apicomplexa: Sarcocystidae), and redescription of Sarcocystis aucheniae from Lama (Lama glama), Guanaco (Lama guanicoe) and Alpaca (Vicugna pacos) Parasitology. 2016;143:617–626. doi: 10.1017/S003118201600007X. [DOI] [PubMed] [Google Scholar]
- 87.Prakas P., Butkauskas D., Juozaitytė-Ngugu E. Molecular and morphological description of Sarcocystis kutkienae sp. nov. from the common raven (Corvus corax) Parasitol. Res. 2020;119:4205–4210. doi: 10.1007/s00436-020-06941-8. [DOI] [PubMed] [Google Scholar]
- 88.Máca O., González-Solís D. Sarcocystis cristata sp. nov. (Apicomplexa, Sarcocystidae) in the imported great blue turaco Corythaeola cristata (Aves, Musophagidae) Parasit. Vector. 2021;14:56. doi: 10.1186/s13071-020-04553-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Berra Y., Moré G., Helman E., Argibay H.D., Orozco M.M. Identification of a new Sarcocystis sp. in marsh deer (Blastocerus dichotomus) from wetlands of Argentina. Int. J. Parasitol. Parasites Wildl. 2023;20:39–45. doi: 10.1016/j.ijppaw.2022.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Balčiauskas L., Trakimas G., Juškaitis R., Ulevičius A., Balčiauskienė L. Atlas of Lithuanian Mammals, Amphibians and Reptiles. 2nd ed. Akstis; Vilnius, Lithuania: 1999. p. 112. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The 28S rDNA and cox1 sequences of Sarcocystis spp. obtained in the present study were submitted to the GenBank database under accession numbers OQ557453-OQ557461 and OQ558004-OQ558012, respectively.