Skip to main content
Virology Journal logoLink to Virology Journal
. 2023 Jul 14;20:150. doi: 10.1186/s12985-023-02111-1

A quadruple fluorescence quantitative PCR method for the identification of wild strains of african swine fever and gene-deficient strains

Xuezhi Zuo 1,2,#, Guorui Peng 1,#, Yingju Xia 1, Lu Xu 1, Qizu Zhao 1, Yuanyuan Zhu 1, Cheng Wang 1,2, Yebing Liu 1, Junjie Zhao 1, Haidong Wang 1,, Xingqi Zou 2,
PMCID: PMC10347796  PMID: 37452402

Abstract

Background

Originating in Africa, African swine fever (ASF) was introduced to China in 2018. This acute and highly virulent infectious disease affects domestic pigs. The World Organization for Animal Health has listed it as a statutory reportable disease, and China has listed it as a category A infectious disease.

Methods

Primers and probes were designed for four ASFV genes (B646L, EP402R, MGF505-3R, and A137R). The primers/probes were highly conserved compared with the gene sequences of 21 ASFV strains.

Results

After optimization, the calibration curve showed good linearity (R2 > 0.99), the minimum concentration of positive plasmids that could be detected was 50 copies/µL, and the minimum viral load detection limit was 102 HAD50/mL. Furthermore, quadruple quantitative polymerase chain reaction (qPCR) with nucleic acids from three porcine-derived DNA viruses and cDNAs from eight RNA viruses did not show amplification curves, indicating that the method was specific. In addition, 1 × 106, 1 × 105, and 1 × 104 copies/µL of mixed plasmids were used for the quadruple qPCR; the coefficient of variation for triplicate determination between groups was < 2%, indicating the method was reproducible.

Conclusions

The results obtained by testing clinical samples containing detectable EP402R, MGF505-3R, and A137R strains with different combinations of gene deletions were as expected. Therefore, the established quadruple qPCR method was validated for the molecular diagnosis of ASF using gene-deleted ASFV strains.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12985-023-02111-1.

Keywords: A137R, B646L, EP402R, African swine fever, Quadruple qPCR, MGF505-3R

Introduction

African swine fever (ASF) is a highly contagious viral disease caused by the African swine fever virus (ASFV), a double-stranded DNA virus belonging to the Asfarviridae family, which has 24 known genotypes [1, 2]. Its genome ranges between 170 and 193 kbp in length and encodes 68 structural proteins and > 100 non-structural proteins [3]. The virus comprises four layers of protein shells and an endogenous genome with a significantly more complex structure than many other viruses. In addition, its multilayered structure plays an important role in its replication and survival [4].

The p72 protein encoded by the B646L gene of ASFV is a major coat protein expressed at a late stage with a differential sequence in the C-terminal region [3]. Thus far, ASFV has been classified into 24 genotypes based on partial sequencing of the B646L gene encoding p72 [1, 2]. The main strains prevalent in China are genotypes II (reported in 2018) [5] and I (reported in 2021) [6]. In addition, the EP402R gene encodes a late expressed CD2v protein, a glycoprotein similar to the surface adhesion receptor CD2v on T lymphocytes [7].Viral CD2v protein is involved in the adsorption of erythrocytes, the binding of extracellular virus particles to erythrocytes [7], host immune regulation, virulence, and induction of protective immune responses [8]. Multigene family (MGF) proteins are widely distributed in ASFV and are generally classified into five families: MGF-100, MGF-110, MGF-300, MGF-360, and MGF-505 [9]. MGF proteins are reported to be early expressed proteins [10] and are key players in multiple stages of transcription, translation, virulence, and immune escape in virally infected host cells [11]. The A137R protein is expressed late during the viral replication cycle, inhibits the interferon signaling pathway, and plays an important role in evading the innate immune response [12]. In the artificial construction of gene-deleted strains, genes such as EP402R, MGF, and A137R are usually targeted; therefore, establishing corresponding detection methods is necessary for clinical applications.

The diagnosis of ASFV involves a virus isolation–erythrocyte adsorption assay (HAD), polymerase chain reaction (PCR), real-time fluorescent quantitative PCR (qPCR), and isothermal amplification techniques. Virus isolation is a confirmatory method, and its corresponding assay (the erythrocyte adsorption assay) is time-consuming and can be used only to validate strains with erythrocyte adsorption characteristics. Moreover, it must be conducted in a biosafety level III laboratory to measure viral activity in samples and is dependent on the presence of actively replicating virus, which may be absent if the sample has not been correctly stored, resulting in inactivation, thus limiting its clinical applications [13]. The isothermal amplification technique is suitable for rapid on-site detection. However, its sensitivity is slightly less than that of fluorescent PCR. Furthermore, although the PCR method has good specificity, its sensitivity is relatively low, the procedure is cumbersome, and aerosol contamination can easily occur, limiting its applications [14]. However, fluorescent PCR, which has high sensitivity, good specificity, and a convenient procedure, is gradually becoming the main method for ASFV diagnosis. In this technique, the highly sensitive qPCR is the standard method [15].

Because using multiple methods and experiments to detect multiple genes is time-consuming and laborious, only a few genes have been detected using the currently available qPCR methods. In this study, we designed primers/probes for four ASFV genes (B646L, EP402R, MGF505-3R, and A137R) and established a quadruple fluorescent qPCR assay to diagnose ASF and differentiate gene-deleted strains from wild-type strains.

Materials and methods

Design of primers and probes

Primers/probes for amplifying B646L, EP402R, A137R, and MGF505-3R were designed using Primer3 (https://primer3.org/) and were subjected to BLAST analysis. The primers/probes were compared with several ASFV strains published in GenBank using SnapGene software (www.snapgene.com/). The primers/probes (Table 1) were all synthesized by Sangon Biotech (Shanghai, China).The sequences and sizes of the target fragments amplified by the designed primer probes in the Georgia 2007/1 strain are shown in Supplementary file 1, Figs. 1, 2, 3 and 4.

Table 1.

Primer/probe sequences

Target gene Primer/probe Sequences (5'–3')
B646L B646L-F GAACGTGAACCTTGCTA
B646L-R GGAAATTCATTCACCAAATCC
B646L-P 6-FAM-TAAAGCTTGCATCGCA-MGB
EP402R EP402R-F GACACCACTTCCATACATGAAC
EP402R-R GGACGCATGTAGTAAATAGGT
EP402R-P Cy5-CAGTCGTTATCAGTATAA-MGB
A137R A137R-F CTTGAAATCCCTGAGGAACG
A137R-R CGATGTCCCGAAATGAGTCT
A137R-P Texas Red-CACCGCCTGGCATGA-MGB
MGF505-3R MGF505-3R-F GAGCTGTTGTTGTCATGGGA
MGF505-3R-R GGATTTTGAATCAGCGGCAA
MGF505-3R-P VIC-CCCCGCTACGCCGTCGTAGGAGCCC-MGB

Fig. 1.

Fig. 1

(A–D) The primers/probes of B646L(A), EP402R(B), A137R(C), and MGF505-3R(D) with the gene sequence comparison of African swine fever virus (ASFV) endemic strains in China and other countries. The red boxes correspond to the sequence for upstream primers, the blue boxes to the sequence for probes, and the black boxes to the sequence for downstream primers

Fig. 2.

Fig. 2

Plot of standard curve equations for B646L, EP402R, A137R, and MGF505-3R genes in the quadruple quantitative polymerase chain reaction. B646L: y = -3.737x + 43.838, R2 = 0.9962. EP402R: y = -3.707 + 43.388, R2 = 0.997. A137R: y = -3.832x + 43.918, R2 = 0.994. MGF505-3R: y = -4.316x + 43.696, R2 = 0.9922

Fig. 3.

Fig. 3

Curves 1–4 represent B646L, MGF505-3R, A137R, and ER402R gene amplification profiles of African swine fever virus, respectively, and 5–16 represent pseudorabies virus, porcine parvovirus, porcine circovirus II, foot and mouth disease virus, classical swine fever virus, porcine epidemic diarrhea virus, transmissible gastroenteritis virus, swine influenza virus, Japanese encephalitis virus, porcine reproductive and respiratory syndrome virus, bovine viral diarrhea virus, and negative control, respectively

Fig. 4.

Fig. 4

Amplification curves for (A) the genotype II African swine fever virus (ASFV) blood sample, (B) the genotype II ASFV liver sample, (C) the genotype II ASFV spleen sample, (D) the genotype II ASFV lung sample, (E) the genotype I cell sample, and (F) the ASFV ΔA137RΔEP402R cell sample. Numbers 1–5 indicate ASFV B646L, MGF505-3R, A137R, ER402R, and negative control amplification curves, respectively

Plasmid construction and nucleic acid extraction

With reference to the ASFV HuB20 strain (GenBank sequence number: MW521382), full-length B646L, EP402R, A137R, and MGF505-3R genes were synthesized, ligated into the pUC57 vector, and used as a positive control. The recombinant plasmids were named pUC57-B646L, pUC57-EP402R, pUC57-A137R, and pUC57-MGF505-3R; their concentrations were converted to copy numbers after measuring their OD260 using a Nanodrop-1000 microspectrophotometer (Thermo Fisher Scientific; Waltham, MA, USA). The four recombinant plasmids were mixed so that the concentration of each recombinant plasmid was 2.5 × 108 copies/µL. Next, the mixed plasmids were diluted to 1 × 108 copies/µL, and 10-fold dilutions were performed to obtain 1 × 100 copies/µL; 1 × 102 copies/µL of the mixed plasmids was twice diluted in half to obtain 25 copies/µL. Lastly, clinical and diluted samples from the 108–100 HAD50 ASFV blood series were subjected to nucleic acid extraction using the QIAamp DNA Mini Kit (Cat No. 51,306; Qiagen, Hilden, Germany).

Quadruple fluorescence quantitative PCR method optimization

Using a LightCycler 480II fluorescent qPCR instrument (Roche Holding AG, Basel, Switzerland), 2× HyperProbe Mixture (CWBIO, Cat No. CW3003M, Beijing, China) was selected as the premix required for the reaction, and the primer/probe concentration, annealing temperature, and cycle number were optimized. Next, the total system (Table 2) was optimized to 25 µL. Predenaturation at 95 °C for 30 s, denaturation at 95 °C for 10 s, and annealing/extension at 58 °C for 20 s were the qPCR reaction conditions. Because of interference between the fluorescence channels, the color compensation procedure was 95 °C for 30 s, 65 °C for 1 min, and 85 °C continuous.

Table 2.

Quadruple quantitative polymerase chain reaction mixture components

Reagents Volume (µL)
2× HyperProbe Mixture 12.5
B646L-F (20 µM) 0.3
B646L-R (20 µM) 0.3
B646L-P (10 µM) 0.2
EP402R-F (20 µM) 0.2
EP402R-R (20 µM) 0.2
EP402R-P (10 µM) 0.4
A137R-F (10 µM) 0.4
A137R-R (10 µM) 0.4
A137R-P (10 µM) 0.6
MGF505-3R-F (10 µM) 0.2
MGF505-3R-R (10 µM) 0.2
MGF505-3R-P (10 µM) 0.1
DNA 3
ddH2O 6
Total 25

ddH2O, double-distilled water

Establishment of a standard curve

A 10-fold serial dilution of 1 × 106 copies/µL of the mixed plasmid to 102 copies/µL was used as a template for quadruple qPCR amplification. Based on the cycle threshold (Ct) and copy number of the template, a standard curve was generated, and its slope and coefficient of determination (R2) were determined.

Sensitivity.

Mixed plasmids of 1 × 103, 1 × 102, 50, 25, and 1 copies/µL were used as reaction templates to test the sensitivity of the quadruple qPCR. In brief, blood samples with a viral load of 108 HAD50 ASFV were diluted 10-fold to 100 HAD50, and nucleic acids were extracted to test the sensitivity of quadruple qPCR for detecting nucleic acid templates representing different viral loads.

Specificity and reproducibility

The specificity of the quadruple qPCR was determined using nucleic acids of foot and mouth disease virus (FMDV), bovine viral diarrhea virus (BVDV), porcine epidemic diarrhea virus (PEDV), pseudorabies virus (PRV), porcine parvovirus (PPV), porcine reproductive and respiratory syndrome virus (PRRSV), swine influenza virus (SIV), porcine circovirus II (PCVII), Japanese encephalitis virus (JEV), classical swine fever virus (CSFV), transmissible gastroenteritis virus (TGEV), and ASFV kept in the WOAH reference laboratory of the China Veterinary Drug Inspection Institute. In addition, 1 × 106 to 1 × 104 copies/µL of mixed plasmids were used as templates for triplicate determinations, performed within and between groups of mixed plasmids of each gradient, to test the reproducibility of the quadruple qPCR. The standard deviation and coefficient of variation were calculated.

Clinical sample testing

The clinical samples collected included blood, liver, spleen, Hubei/2019 genotype II ASFV lung, Genotype 1 ASFV cell samples, and Artificial construction ASFV ΔA137RΔEP402R cell sample. Nucleic acids were extracted from these six samples (200 µL each) and were eluted with 50 µL of eluent, of which 3 µL each was used for the quadruple qPCR. The total system, with each primer/probe, ddH2O, and 2× HyperProbe Mixture is presented in Table 2. The reaction conditions are described in Sect. 2.3.

Declarations

All treatments for viruses were performed in a Biosafety Level III Laboratory of the China Veterinary Drug Inspection Institute.

Results

Primer probe design

The gene sequence comparison of the prevalent ASFV strains in China and other countries revealed that the designed primers/probes matched conserved regions in B646L, EP402R, and A137R of ASFV genotypes I and II. In addition, the MGF505-3R primers/probes were conserved in genotype I Benin 97/1 (AM712239), genotype I OURT 88/3 (NC_044957), HeN/ZZ-P1/2021 (MZ945536), and SD/DY-I/2021 (MZ945537), and in genotype II strain L60 (KM262844) (Fig. 1 and Supplementary file 2). Therefore, we inferred that the B646L primer/probe could be used to confirm ASFV, after which the primers/probes of EP402R, A137R, and MGF505-3R were used to distinguish between the wild-type and gene-deleted ASFV strains.

Standard curves

The standard curves obtained using 1 × 106 to 1 × 102 copies/µL of mixed plasmids as templates demonstrated good linearity. Moreover, the slopes of the standard curve equations for B646L, EP402R, A137R, and MGF505-3R were − 3.737, -3.707, -3.832, and − 4.316, respectively; the coefficients of determination (R2) were 0.9962, 0.9970, 0.9940, and 0.9922, respectively (Fig. 2 and Supplementary file 3 Figs. 1, 2, 3 and 4). This data indicates that the amplification efficiency of the method was good, and the fit was excellent.

Minimum detection limit and result determination

Among the mixed plasmids of 1 × 103, 1 × 102, 50 × 101, 25 × 101, and 1 × 101 copies/µL, the minimum limit of detection was 50 × 101 copies/µL for B646L, EP402R, A137R, and MGF505-3R, while their Ct values were 39.22, 39.19, 39.76, and 37.30, respectively (Table 3). Furthermore, the minimum limit of detection of 102 HAD50/mL was determined using a 10-fold serial dilution of 108 HAD50 ASFV blood samples. The Ct values of B646L, EP402R, A137R, and MGF505-3R in 102 HAD50 nucleic acids were 39.62, 37.93, 38.13, and 35.92, respectively (Table 4).

Table 3.

Cycle threshold values of plasmids with different copy numbers for each gene

B646L EP402R A137R MGF505-3R
Repeat Mean SD Repeat Mean SD Repeat Mean SD Repeat Mean SD
1 × 103 copies/µL 32.55 32.51 0.12 33.59 33.10 0.42 33.98 33.63 0.33 30.53 30.35 0.37
32.38 32.86 33.60 30.60
32.60 32.85 33.32 29.92
1 × 102 copies/µL 37.34 37.03 0.27 38.34 38.35 0.22 37.69 37.61 0.33 36.73 36.13 0.78
36.93 38.14 37.89 36.41
36.83 38.58 37.25 35.25
50 copies/µL 39.55 39.22 0.30 38.42 39.19 0.67 39.90 39.76 0.40 36.97 37.30 0.60
39.15 39.51 39.31 36.94
38.95 39.64 40.09 38.00
25 copies/µL

SD, standard deviation.

Table 4.

Cycle threshold values of nucleic acids with different viral loads for each gene

B646L EP402R A137R MGF505-3R
Repeat Mean SD Repeat Mean SD Repeat Mean SD Repeat Mean SD
107 HAD50 22.90 22.77 0.27 22.95 22.83 0.19 21.80 21.61 0.28 18.48 18.09 0.35
22.46 22.62 21.28 17.98
22.95 22.94 21.74 17.80
106 HAD50 25.60 25.59 0.06 25.47 25.50 0.21 24.42 24.43 0.30 21.23 21.41 0.27
25.53 25.31 24.13 21.26
25.64 25.72 24.73 21.72
105 HAD50 28.72 28.62 0.09 28.65 28.73 0.10 27.74 27.82 0.12 24.90 25.05 0.20
28.54 28.69 27.77 24.96
28.59 28.84 27.95 25.28
104 HAD50 31.93 31.89 0.18 32.01 32.15 0.24 31.44 31.27 0.41 27.90 28.49 0.52
31.70 32.01 30.80 28.78
32.05 32.43 31.57 28.79
103 HAD50 35.71 35.17 0.47 34.40 34.87 0.49 34.73 34.25 0.49 32.32 32.18 0.26
34.90 34.82 33.75 31.89
34.89 35.39 34.28 32.35
102 HAD50 41.07 39.62 1.27 37.47 37.93 0.47 39.10 38.13 1.12 33.92 35.92 2.34
38.68 37.91 36.91 38.49
39.11 38.41 38.39 35.34
101 HAD50
100 HAD50

HAD, virus isolation–erythrocyte adsorption assay; SD, standard deviation.

The criteria for determining negative and positive results were based on the results for known low viral load, low copy-number positive plasmid samples, and sensitivity. For B646L, a Ct ≤ 37 was considered positive, and Ct > 40 was considered negative. For EP402R, a Ct ≤ 38 was considered positive, and Ct > 40 was considered negative. For A137R, a Ct ≤ 37 was considered positive, and Ct > 40 was considered negative. For MGF505-3R, a Ct ≤ 36 was considered positive, and Ct > 38 was considered negative. For each gene, no Ct value was considered negative, and values between the positive and negative cut-offs were considered suspicious.

Specificity and reproducibility of the experimental results

DNA (PRV, PPV, and PCVII) and RNA viruses (FMDV, CSFV, PEDV, TGEV, SIV, JEV, PRRSV, and BVDV) did not show amplification curves in the quadruple qPCR; only the positive control for ASFV showed typical amplification (Fig. 3), indicating that the established method had good specificity.

The 1 × 106 to 1 × 104 copies/µL of mixed plasmids showed good reproducibility in the three replicates between groups within the quadruple qPCR, with coefficients of variation of less than 2% in all cases (Table 5).

Table 5.

Intra-group reproducibility of the quadruple quantitative polymerase chain reaction groups

Target

gene

Concentration

(copies/µL)

Intra-group replication Repeated between groups
Mean SD CV% Mean SD CV%
B646L 1 × 106 21.70 0.05 0.2 21.93 0.21 1
1 × 105 24.92 0.03 0.1 25.15 0.2 0.8
1 × 104 29.23 0.06 0.2 29.76 0.47 1.6
EP402R 1 × 106 21.23 0.03 0.1 21.43 0.21 1
1 × 105 24.62 0.06 0.2 24.77 0.19 0.8
1 × 104 28.97 0.22 0.8 29.40 0.38 1.3
A137R 1 × 106 20.97 0.03 0.1 21.24 0.24 1.1
1 × 105 24.56 0.13 0.5 24.74 0.20 0.8
1 × 104 29.14 0.23 0.8 29.62 0.42 1.4
MGF505-3R 1 × 106 17.97 0.02 0.1 18.31 0.32 1.7
1 × 105 21.86 0.11 0.5 22.26 0.37 1.7
1 × 104 26.94 0.20 0.7 27.50 0.52 1.9

SD, standard deviation; CV, coefficient of variation.

Quadruple qPCR method validation

The clinical samples tested using the established quadruple qPCR showed the expected amplification. ASFV nucleic acids from the blood, liver, spleen, and lungs showed amplification; however, the MGF505-3R of genotype I ASFV and the A137R and EP402R of ASFVΔA137RΔEP402R did not show amplification (Fig. 4).

Discussion

Since its discovery, the continuous spread of ASF has significantly affected the global supply of pork products and has devastated food security and animal health and welfare [16]. China’s pig production capacity has decreased significantly since the disease was introduced in 2018. Because of the insidiousness and complexity of ASFV transmission, the epidemic remains unresolved [17]. Although ASF has long been identified, it lacks a safe and effective vaccine. Therefore, an effective diagnostic method is critical for controlling the epidemic. Consequently, we designed primers/probes for four genes, B646L, EP402R, A137R, and MGF505-3R. Notably, the p72 protein, the main capsid protein of ASFV encoded by the B646L gene, is often used as the first choice for diagnosing epidemic ASFV [1821]. In addition, CD2v, encoded by the EP402R gene, is vital for ASFV diagnosis [22, 23]. Furthermore, EP402R, MGF, and A137R are known virulence genes whose deletion can substantially reduce the virulence of the virus in pigs [2330]. Therefore, these genes are expected to serve as alternative deletion genes for gene deletion vaccines, and establishing corresponding identification methods is necessary. Moreover, mutant strains such as CD2v-deletion strains with low pathogenicity have previously been identified [31]. We considered that targeting these ASFV genes would be necessary to confirm the diagnosis and pathogenic strains involved in ASFV infection. Thus, we developed a suitable quadruple PCR method that showed high sensitivity and specificity.

The B646L, EP402R, and A137R primers/probes used in this study were conserved in genotypes I and II ASFV. In addition, the MGF505-3R primers/probes were conserved in genotype I Benin 97/1 (AM712239), L60 (KM262844), and genotype II ASFV. However, deletions were found in OURT 88/3 (NC_044957) and in the frequently isolated Chinese genotypes HeN/ZZ-P1/2021 (MZ945536) and SD/DY-I/2021 (MZ945537). With this method, we inferred that a sample with positive results for B646L, EP402R, and A137R and negative results for MGF505-3R could contain genotype I ASFV. Moreover, we verified this result with a known genotype I ASFV cytotoxic sample (see Fig. 4E), and the results were consistent with our hypothesis.

To verify the specificity of the method, we performed amplification using nucleic acids of three porcine-derived DNA viruses (PRV, PPV, and PCVII) and eight porcine-derived RNA viruses (FMDV, CSFV, PEDV, TGEV, SIV, JEV, PRRSV, and BVDV). None of these 11 nucleic acids showed amplification curves; only the positive ASFV control showed typical amplification (see Fig. 3), indicating that the method was specific for diagnosing ASFV without interference from other pathogens. Regarding reproducibility, the coefficient of variation was calculated for triplicate determination within each group, and the results obtained for all four genes were < 2% less than that of other ASFV qPCR diagnostic methods [32]. This result indicated that our method was reproducible, with minimal deviation in the results obtained from each experiment, and that batch differences do not affect the determination of the results.

Regarding sensitivity, the minimum limit of detection for all four genes was 50 copies/µL and 102 HAD50/mL. Moreover, our method was more sensitive for the detection of B646L and EP402R than other qPCR methods [33]. Because of the interference of the fluorescent groups in each probe of the quadruple qPCR, the hydrolysis efficiency of the probes was affected, changing the amplification efficiency. However, these effects were within a reasonable range, and the determination of negative results was unaffected. In addition, the method allowed the simultaneous detection of four genes, shortening the time of multigene detection.

A limitation of our study is that only four genes could be detected as only a maximum of four fluorescence channels are available in the current fluorescence PCR instruments. In the future these instruments may improve to include more fluorescence channels, which would allow for detection of additional genes.

In conclusion, we established a quadruple qPCR method for B646L, EP402R, A137R, and MGF505-3R to distinguish ASFV wild-type strains from gene-deleted strains based on current research. This method is the only qPCR method that can simultaneously detect four ASFV genes with conserved primer/probe sequences with high sensitivity, specificity, and reproducibility, providing a comprehensive diagnosis of ASFV.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1 (10.5KB, docx)
Supplementary Material 2 (62.6KB, docx)
Supplementary Material 3 (137.1KB, docx)

Acknowledgements

We thank Shanxi Agricultural University and the Biosafety Level III Laboratory of China Veterinary Drug Inspection Institute for their support towards the completion of this study.

Abbreviations

ASF

African swine fever

ASFV

African swine fever virus

BVDV

Bovine viral diarrhea virus

CSFV

Classical swine fever virus

FMDV

Foot and mouth disease virus

HAD

Virus isolation–erythrocyte adsorption assay

JEV

Japanese encephalitis virus

MGF

Multigene family

PCVII

Porcine epidemic diarrhea virus

PEDV

Porcine epidemic diarrhea virus

PPV

Porcine parvovirus

PRRSV

Porcine reproductive and respiratory syndrome virus

PRV

Pseudorabies virus

qPCR

Quantitative polymerase chain reaction

SIV

Swine influenza virus

TGEV

Transmissible gastroenteritis virus

Author contributions

ZXQ, XYJ, and ZQZ designed the experimental protocol. ZXZ and PGR completed the experiment. ZXZ wrote and submitted the manuscript. WC, XL, ZYY, LYB, and ZJJ assisted in the experiment and provided guidance. ZXQ and WHD revised the manuscript. All authors read and approved the final version of the submitted manuscript.

Funding

This work was funded by the National Key Research and Development Program of China (2021YFD1800105-1), the “SixNew” Project of Agriculture and Rural Department of Shanxi Province, and the Fund for Shanxi “1331Project” Key Innovative Research Team (No. 20211331-16).

Author Contributions.

ZXQ, XYJ, and ZQZ designed the experimental protocol. ZXZ and PGR completed the experiment. ZXZ wrote and submitted the manuscript. WC, XL, ZYY, LYB, and ZJJ assisted in the experiment and provided guidance. ZXQ and WHD revised the manuscript. All authors read and approved the final version of the submitted manuscript.

Data Availability

All data generated or analysed during this study are included in this published article and its supplementary information files.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Xuezhi Zuo and Guorui Peng contributed equally to this work and share first authorship.

Contributor Information

Haidong Wang, Email: wanghaidong@sxau.edu.cn.

Xingqi Zou, Email: zouxingqi@163.com.

References

  • 1.Bastos ADS, Penrith M-L, Crucière C, Edrich JL, Hutchings G, Roger F, et al. Genotyping field strains of african swine fever virus by partial p72 gene characterisation. Arch Virol. 2003;148:693–706. doi: 10.1007/s00705-002-0946-8. [DOI] [PubMed] [Google Scholar]
  • 2.Quembo CJ, Jori F, Vosloo W, Heath L. Genetic characterization of african swine fever virus isolates from soft ticks at the wildlife/domestic interface in Mozambique and identification of a novel genotype. Transbound Emerg Dis. 2017;1–12. 10.1111/tbed.12700. [DOI] [PMC free article] [PubMed]
  • 3.Alejo A, Matamoros T, Guerra M, Andrés G. A proteomic atlas of the African swine fever virus particle. J Virol. 2018;92:e01293-18. doi:10.1128/JVI.01293-18. [DOI] [PMC free article] [PubMed]
  • 4.Liu S, Luo Y, Wang Y, Li S, Zhao Z, Bi Y, et al. Cryo-EM structure of the African swine fever virus. Cell Host & Microbe. 2019;26:1–8. doi:10.1016/j.chom.2019.11.004. [DOI] [PubMed]
  • 5.Zhao D, Liu R, Zhang X, Li F, Wang J, Zhang J, et al. Replication and virulence in pigs of the first african swine fever virus isolated in China. Emerg Microbes Infect. 2019;8:438–47. doi: 10.1080/22221751.2019.1590128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sun E, Huang L, Zhang X, Zhang J, Shen D, Zhang Z, et al. Genotype I african swine fever viruses emerged in domestic pigs in China and caused chronic infection. Emerg Microbes Infect. 2021;10:2183–93. doi: 10.1080/22221751.2021.1999779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Borca MV, Kutish GF, Alfonso CL, Itusta P, Carrillo C, Brun A, et al. An african swine fever virus gene with similarity to the T-lymphocyte surface antigen CD2 mediates hemadsorption. Virology. 1994;199:463–8. doi: 10.1006/viro.1994.1146. [DOI] [PubMed] [Google Scholar]
  • 8.Chaulagain S, Delhon GA, Khatiwada S, Rock DL. African swine fever virus CD2v protein induces β-interferon expression and apoptosis in swine peripheral blood mononuclear cells. Viruses. 2021;13:1480. doi: 10.3390/v13081480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chapman DAG, Tcherepanov V, Upton C, Dixon LK. Comparison of the genome sequences of non- pathogenic and pathogenic African swine fever virus isolates. J Gen Virol. 2008;89:397–408. doi:10.1099/vir.0.83343-0. [DOI] [PubMed]
  • 10.Ramirez-Medina E, Vuono E, Silva E, Rai A, Valladares A, Pruitt S, et al. Evaluation of the deletion of MGF110-5L-6L on swine virulence from the pandemic strain of african swine fever virus and use as a DIVA marker in vaccine candidate ASFV-G-∆1177L. J Virol. 2022;96:e00597–22. doi: 10.1128/jvi.00597-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zhu Z, Chen H, Liu L, Cao Y, Jiang T, Zou Y, et al. Classification and characterization of multigene family proteins of african swine fever viruses. Brief Bioinform. 2021;22:bbaa380. doi: 10.1093/bib/bbaa380. [DOI] [PubMed] [Google Scholar]
  • 12.Sun M, Yu S, Ge H, Wang T, Li Y, Zhou P, et al. The A137R protein of african swine fever virus inhibits type I interferon production via the autophagy-mediated lysosomal degradation of TBK1. J Virol. 2022;96:e0195721. doi: 10.1128/jvi.01957-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gallardo C, Soler A, Rodze I, Nieto R, Cano-Gómez C, Fernandez-Pinero J, Arias M. Attenuated and non-haemadsorbing (non-HAD) genotype II African swine fever virus (ASFV) isolated in Europe, Latvia 2017. Transbound Emerg Dis. 2019;66:1399 – 404. doi:10.1111/tbed.13132. [DOI] [PubMed]
  • 14.Belák A, Thorén P. Molecular diagnosis of animal diseases: some experiences over the past decade. Expert Rev Mol Diagn. 2002;1(4):434–43. doi: 10.1586/14737159.1.4.434. [DOI] [PubMed] [Google Scholar]
  • 15.Qiu Z, Li Z, Yan Q, Li Y, Xiong W, Wu K, et al. Development of diagnostic tests provides technical support for the control of african swine fever. Vaccines. 2021;9:343. doi: 10.3390/vaccines9040343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ward MP, Tian K, Nowotny N. African swine fever, the forgotten pandemic. Transbound Emerg Dis. 2021;68:2637–9. doi: 10.1111/tbed.14245. [DOI] [PubMed] [Google Scholar]
  • 17.Wu K, Liu J, Wang L, Fan S, Li Z, Li Y, et al. Current state of global african swine fever vaccine development under the prevalence and transmission of ASF in China. Vaccines. 2020;8:531. doi: 10.3390/vaccines8030531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Caixia W, Songyin Q, Ying X, Haoyang Y, Haoxuan L, Shaoqiang W, et al. Development of a blocking ELISA kit for detection of ASFV antibody based on a monoclonal antibody against full-length p72. J AOAC Int. 2022;105:1428–36. doi: 10.1093/jaoacint/qsac050. [DOI] [PubMed] [Google Scholar]
  • 19.Geng R, Sun Y, Li R, Yang J, Ma H, Qiao Z, et al. Development of a p72 trimer-based colloidal gold strip for detection of antibodies against african swine fever virus. Appl Microbiol Biotechnol. 2022;106:2703–14. doi: 10.1007/s00253-022-11851-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wang Y, Xu L, Noll L, Stoy C, Porter E, Fu J, et al. Development of a real-time PCR assay for detection of african swine fever virus with an endogenous internal control. Transbound Emerg Dis. 2020;67:2446–54. doi: 10.1111/tbed.13582. [DOI] [PubMed] [Google Scholar]
  • 21.Zhu W, Meng K, Zhang Y, Bu Z, Zhao D, Meng G. Lateral flow assay for the detection of african swine fever virus antibodies using gold nanoparticle-labeled acid-treated p72. Front Chem. 2021;9:804981. doi: 10.3389/fchem.2021.804981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lv C, Zhao Y, Jiang L, Zhao L, Wu C, Hui X, et al. Development of a dual ELISA for the detection of CD2v-unexpressed lower-virulence mutational ASFV. Life. 2021;11:1214. doi: 10.3390/life11111214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Niu Y, Zhang G, Zhou J, Liu H, Chen Y, Ding P, et al. Differential diagnosis of the infection caused by wild-type or CD2v-deleted ASFV strains by quantum dots-based immunochromatographic assay. Lett Appl Microbiol. 2022;74:1001–7. doi: 10.1111/lam.13691. [DOI] [PubMed] [Google Scholar]
  • 24.Hemmink JD, Khazalwa EM, Abkallo HM, Oduor B, Khayumbi J, Svitek N, et al. Deletion of the CD2v gene from the genome of ASFV-Kenya-IX-1033 partially reduces virulence and induces protection in pigs. Viruses. 2022;14:1917. doi: 10.3390/v14091917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pérez-Núñez D, Sunwoo SY, García-Belmonte R, Kim C, Vigara-Astillero G, Riera E, et al. Recombinant african swine fever virus Arm/07/CBM/c2 lacking CD2v and A238L is attenuated and protects pigs against virulent korean Paju strain. Vaccines. 2022;10:1992. doi: 10.3390/vaccines10121992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Koltsova G, Koltsov A, Krutko S, Kholod N, Tulman ER, Kolbasov D. Growth kinetics and protective efficacy of attenuated ASFV strain Congo with deletion of the EP402 gene. Viruses. 2021;13:1259. doi: 10.3390/v13071259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Fan Y, Chen W, Jiang C, Zhang X, Sun Y, Liu R et al. Host responses to live-attenuated ASFV (HLJ/18-7GD). Viruses. 2022;14; 2003. 10.3390/v14092003. [DOI] [PMC free article] [PubMed]
  • 28.Li D, Liu Y, Qi X, Wen Y, Li P, Ma Z, et al. African swine fever virus MGF-110-9L-deficient mutant has attenuated virulence in pigs. Virol Sin. 2021;36:187–95. doi: 10.1007/s12250-021-00350-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bourry O, Hutet E, Le Dimna M, Lucas P, Blanchard Y, Chastagner A, et al. Oronasal or intramuscular immunization with a thermo-attenuated ASFV strain provides full clinical protection against Georgia 2007/1 challenge. Viruses. 2022;14:2777. doi: 10.3390/v14122777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Gladue DP, Ramirez-Medina E, Vuono E, Silva E, Rai A, Pruitt S, et al. Deletion of the A137R gene from the pandemic strain of african swine fever virus attenuates the strain and offers protection against the virulent pandemic virus. J Virol. 2021;95:e0113921. doi: 10.1128/jvi.01139-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Sun E, Zhang Z, Wang Z, He X, Zhang X, Wang L, et al. Emergence and prevalence of naturally occurring lower virulent african swine fever viruses in domestic pigs in China in 2020. Sci China Life Sci. 2021;64:752–65. doi: 10.1007/s11427-021-1904-4. [DOI] [PubMed] [Google Scholar]
  • 32.Yang H, Peng Z, Song W, Zhang C, Fan J, Chen H, et al. A triplex real-time PCR method to detect african swine fever virus gene-deleted and wild type strains. Front Vet Sci. 2022;9:943099. doi: 10.3389/fvets.2022.943099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Cao S, Lu H, Wu Z, Zhu S. A duplex fluorescent quantitative PCR assay to distinguish the genotype I and II strains of african swine fever virus in chinese epidemic strains. Front Vet Sci. 2022;9:998874. doi: 10.3389/fvets.2022.998874. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (10.5KB, docx)
Supplementary Material 2 (62.6KB, docx)
Supplementary Material 3 (137.1KB, docx)

Data Availability Statement

All data generated or analysed during this study are included in this published article and its supplementary information files.


Articles from Virology Journal are provided here courtesy of BMC

RESOURCES