Microglia-derived TGF-β1 ligand maintains microglia homeostasis via autocrine mechanism and is critical for normal cognitive function in adult mouse brain

Abstract

While TGF-β signaling is essential for microglial function, the cellular source of TGF-β ligand and its spatial regulation remains unclear in the adult CNS. Our data support that microglia, not astrocytes or neurons, are the primary producers of TGF-β1 ligands needed for microglial homeostasis. Microglia (MG)-Tgfb1 inducible knockout (iKO) leads to the activation of microglia featuring a dyshomeostatic transcriptomic profile that resembles disease-associated microglia (DAMs), injury-associated microglia, and aged microglia, suggesting that microglial self-produced TGF-β1 ligands are important in the adult CNS. Interestingly, astrocytes in MG-Tgfb1 iKO mice show a transcriptome profile that closely aligns with A1-like astrocytes. Additionally, using sparse mosaic single-cell microglia iKO of TGF-β1 ligand, we established an autocrine mechanism for TGF-β signaling. Importantly MG-Tgfb1 iKO mice show cognitive deficits, supporting that precise spatial regulation of TGF-β1 ligand derived from microglia is critical for the maintenance of brain homeostasis and normal cognitive function in the adult brain.

Introduction

Microglia are commonly known as the resident immune cells in the central nervous system (CNS), but their roles expand beyond that of innate immunity. At homeostasis, microglia play a variety of regulatory roles such as surveilling the brain parenchyma for injury or disease, phagocytosis, and synaptic pruning^1–4. In addition to their homeostatic role, microglia are vital in inflammatory response initiation and regulation. In the case of injury or inflammation, microglia dynamically alter their function on a spectrum of activation states ranging from the more pro-inflammatory M1-like state to the anti-inflammatory M2-like state^5–7. Previous studies have shown that transforming growth factor beta (TGF-β) signaling is required for the development of microglia during the embryonic stage⁸. Specifically, a cleverly designed “CNS-specific” Tgfb1 knockout (KO) mouse model was developed by overexpressing the Tgfb1 gene in T-cells (via an Il-2 Promoter) in a global Tgfb1 KO mouse model, which depletes CNS TGF-β1 constitutively but partially compensates peripheral TGF-β1 levels⁸. Using this mouse model, it was reported that in the absence of TGF-β1 in the CNS during development, microglia do not establish their signature gene expression, supporting that TGF-β1 is critical for normal microglial development⁸. While this study supported the importance of TGF-β1 in microglial development, whether TGF-β signaling is required in mature microglia to maintain their survival and function in adult brain is not known. Moreover, the serum levels of TGF-β1 in this “CNS” Tgfb1 KO mouse model were undetectable⁸, resulting in a potential confound due to altered TGF-β1 levels in peripheral tissues and serum which could have indirect effects on microglia maturation.

Recently, using an inducible myeloid-specific TGF-β type 2 receptor (TGF-βR2) KO mouse model (Cx3cr1^CreER-Tgfbr2^fl/fl), Zoller et al. have shown that TGF-β signaling, via TGF-βR2 in adult microglia, is necessary for maintaining the ramified morphology and certain features of microglial homeostasis⁹. However, inducible knockout (iKO) of Tgfbr2 in adult microglia only leads to a “primed” state in microglia without any effects on many microglia homeostatic signature genes such as P2ry12, Tmem119, Hexb, and Sal1⁹. These studies, while supporting the importance of TGF-β signaling in microglia maturation during developmental stages and maintaining certain features of homeostasis in adulthood, also generate some standing questions regarding the critical requirements of TGF-β signaling in maintaining microglia signature gene expression in the adult CNS. Additionally, the precise cellular source of TGF-β ligands and the spatial/temporal regulation of components of the TGF-β signaling pathway cross different cell types in the CNS and its functional relevance have yet to be identified, leaving some major gaps in our knowledge regarding the regulation of this important signaling pathway in the adult brain.

While it is assumed that many different cell types can be sources of TGF-β ligands in the CNS at homeostasis^10–15, the actual production of TGF-β ligands in different cell types in the brain has not been established. Additionally, a previous study hints at a highly precise spatially localized regulation of the activation of TGF-β ligand through the interaction of LRRC33 and αVβ8 integrin¹⁶. However, whether TGF-β ligand is regulated by a diffusible paracrine mechanism locally or whether the ligand is more strictly regulated via an autocrine manner in the CNS is not known. We aim to address these major gaps in the field in this study. Using cell-type specific conditional or inducible KO models of the Tgfb1 gene, we demonstrate that microglia- but not neuron- or astrocyte-derived TGF-β1 ligand is critical for the maintenance of homeostatic microglia in the adult brain. Furthermore, the loss of microglia-derived TGF-β1 ligands also leads to the presence of reactive astrocytes in the brain and causes cognitive deficits in adult mice. Additionally, our study shows that the total TGF-β1 ligand level is substantially lower in the brain compared to serum or peripheral TGF-β1 levels, and that the adult brain has accordingly established a precise spatially controlled mechanism to regulate ligand production to maintain homeostasis in individual microglia, dependent on microglial autocrine TGF-β signaling. Our data also show that TGF-β1 is enriched in microglia, while TGF-β2 is instead enriched in astrocytes. Interestingly, following Tgfb1 gene deletion in microglia, Tgfb3 is upregulated in the Tgfb1 KO microglia. However, at least up to 8 weeks following global microglial Tgfb1 deletion, neither the astrocytic Tgfb2 nor the upregulated Tgfb3 in microglia is able to compensate for the function of Tgfb1 or rescue the dyshomeostatic phenotype in Tgfb1 KO microglia, suggesting distinct expression and functions of the different ligands in CNS. In this study, we also address the questions of microglia-astrocyte crosstalk and the functional relevance of microglial TGF-β signaling in the adult CNS. With the importance of TGF-β signaling becoming more recognized in injury, neurodegeneration, and aging in the CNS, our study provides new insights into the mechanisms of how TGF-β signaling can be regulated on a single-cell level via microglia autocrine mechanism in the adult CNS and opens new directions for future studies in understanding how TGF-β1 ligand production and downstream signaling in recipient cells can occur under these conditions.

RESULTS

Myeloid-specific Tgfb1 gene deletion in CNS microglia leads to decreased microglial TGF-β signaling without affecting spleen or serum TGF-β1 level in the Cx3cr1^CreER-Tgfb1 iKO mouse line.

To identify the cell type(s) in the CNS that provide TGF-β1 ligand to microglia and other TGF-β1 responsive cells, we first examined scRNAseq data sets published in previous studies^17,18. Interestingly, highly enriched Tgfb1 mRNA levels in adult mouse microglia are observed in multiple scRNAseq datasets^17,18. Further analysis of these data shows that astrocytes, neurons, and oligodendrocytes have minimal Tgfb1 expression. While OPCs and endothelial cells have moderate Tgfb1 expression, it is substantially lower compared to microglia Tgfb1 mRNA levels (Supplementary Fig 1A,B)^17,18. To validate microglia Tgfb1 expression, we carried out a combined RNAscope/IHC analysis to examine the cellular expression pattern of TGF-β1 in the adult mouse brain. Our data show that indeed Tgfb1 mRNA is enriched in IBA1 positive microglia, but was not detected in neurons (Supplementary Fig 1C). Tgfb1 mRNA is also detected in a small population of non-IBA1+ cells, which could be endothelial cells or OPCs. Interestingly, mRNA for the type 1 TGF-β1 receptor (TGF-βR1 or ALK5) is also detected in microglia, supporting that microglia can be both ligand-producing and responding cells for TGF-β1 signaling. To examine whether microglia are a major contributor to TGF-β1 production in the brain, we depleted microglia from the adult mouse brain using the well-established CSFR1 antagonist PLX5622 (1200ppm in diet) following our previously published protocol, which resulted in more than 90% of microglia ablation reported by us and other studies^19–21. After successful microglia ablation, we examined the total Tgfb1 mRNA in cortical tissue from control or microglia-ablated mouse brain. The qRT-PCR analysis shows that the PLX5622 treatment leads to a substantial depletion of microglia in the adult brain, indicated by a significant decrease of Iba1 mRNA levels in brain tissue (<5% of WT levels), accompanied by a 70% decrease in total Tgfb1 mRNA levels (Supplementary Fig 1E). Since microglia compose only 5–10% of total brain cells^22,23, microglia ablation leading to a 70% decrease in total Tgfb1 mRNA levels in the brain supports that microglia are a major component for TGF-β1 ligand production.

Next, to establish direct functional relevance of microglia-produced TGF-β1 ligand to microglia homeostasis, the Cx3cr1^CreER line²⁴ was crossed with the Tgfb1^fl/fl line to enable tamoxifen (TAM)-induced TGF-β1 ligand loss in microglia in adulthood. To confirm the efficiency of Tgfb1 gene deletion in microglia in the inducible MG-Tgfb1 KO mice, in our recent study, we sorted microglia using an R26-YFP reporter allele (which labels 90% of total microglia in adult mouse brain) at 3 weeks following TAM treatment in Cx3cr1^CreERTgfb1^wt/wtR26-YFP and Cx3cr1^CreERTgfb1^fl/flR26-YFP mice²⁵. We demonstrate a significant decrease (99.8%) in Tgfb1 mRNA levels from sorted YFP+ microglia in Cx3cr1^CreER+/−-Tgfb1^fl/fl mice in comparison to control microglia (Cx3cr1^CreER+/−, Tgfb1^wt/wt)²⁵. To examine whether peripheral serum or tissue TGF-β1 levels are also affected in our MG-Tgfb1 iKO mice, we measured the TGF-β1 protein levels in the serum and spleen using ELISA analysis. In contrast to the previous “CNS-Tgfb1” constitutive KO mouse model which completely abolished serum TGF-β1 levels⁸, our Cx3cr1^CreERTgfb1 iKO mice do not show any difference in TGF-β1 protein levels in the serum or spleen between the Cx3cr1^CreER WT and the Cx3cr1^CreERTgfb1^fl/fl mice at 3 weeks after TAM treatment (Supplemental Fig 2), confirming the minimal interference in peripheral TGF-β1 ligand levels. Interestingly, ELISA results also show that compared to the high levels of TGF-β1 ligand in the spleen and serum (Control and iKO Spleen = 5.7 or 5.9pg/ug protein: Control and iKO serum= 1.9 or 1.8pg/ug protein), total brain TGF-β1 levels are substantially lower (below the detect limit of the ELISA assay), a result that is consistent with a recent previous study²⁵. Due to the limitation of this analysis method, we were not able to confirm loss of TGF-β1 ligand on a protein level in our Cx3cr1-Tgfb1 iKO mice directly using ELISA assay. Similarly, our results were also confirmed using FACS analysis on surface TGF-β1 levels. FACS analysis showed no difference in TGF-β1 expression levels in CD11b+/CD45+ spleenocytes between control and Cx3cr1^CreERTgfb1 iKO mice, while CD11b+/CD45+ cells from the brain show very low levels of TGF-β1 signal. This further supports that CNS TGF-β1 levels are substantially lower compared to peripheral tissue, making detection of the TGF-β1 protein in the CNS a challenge. Due to the very low signal of TGF-β1 staining in brain CD11b+/CD45+ cells, we could not compare the level of surface TGF-β1 expression between control and Cx3cr1^CreER-Tgfb1 iKO mice. Nevertheless, the qRT-PCR analysis from sorted brain microglia demonstrates that the Cx3cr1^CreERTgfb1^fl/fl transgenic line can efficiently delete the Tgfb1 gene in microglia cells specifically with minimal interference on systemic serum or spleen TGF-β1 levels²⁵. Additionally, RNAseq of the sorted WT and Tgfb1 iKO microglia confirms the complete loss of the floxed exon 3 from Tgfb1 mRNA in iKO mice while not affecting mRNA counts of exon 4 which is downstream of the 3’ loxP site (Fig 1 E).

Figure 1. Validation of loss of Tgfb1 loxP-flanked exon 3 in microglial mRNA and the TGF-β downstream signaling effector (pSMAD3) in Cx3cr1^CreER(Jung)Tgfb1^fl/fl iKO mice following tamoxifen administration.

(A) Mouse model used and experimental timeline. (B) Representative IHC showing pSMAD3, IBA1, and DAPI in control animals and iKO animals. (C,D) Quantification of pSMAD3 nuclear immunoreactivity median intensity in both IBA1+ cells (C) and IBA1− cells (D). (E) Based on RNAseq analysis of sorted MG from Control or Cx3cr1^CreER(Jung)Tgfb1^fl/fl iKO mice, aligned reads that matched to exon3 (the loxP-flanked exon) or exon4 (the exon downstream of the floxed exon) show that exon 3 is significantly lower in MG-Tgfb1 iKO microglia compared to control microglia while exon 4 is unaffected. Mean±SE, * = p<0.05. Student’s t-test. Scale bar = 100µm. SMAD3 bar graphs show individual image averages, however statistics were carried out using the average cell intensity for a single animal (control n=4, iKO n=3). RNA-seq graph shows a single data point per animal.

To further circumvent the challenge of direct detection of TGF-β1 protein, we analyzed the downstream effector of TGF-β1 signaling, i.e., the nuclear localized phosphorylated SMAD3 (pSMAD3) protein levels. Co-immunohistochemistry analysis shows that in control mice (Cx3cr1^CreER+/−Tgfb1^wt/wt + TAM), pSMAD3 is detected in both IBA1+ microglia cells and IBA1− cells in the brain (Fig 1B, C, D). Interestingly, MG-specific deletion of the Tgfb1 gene leads to a specific and significant decrease of pSMAD3 immunoreactivity exclusively in IBA1+ microglia, without affecting the pSMAD3 immunostaining in IBA1− cells (Fig 1 B–D). This specific loss of TGF-β1 signaling (pSMAD3) in microglia from MG-Tgfb1 iKO mice confirms that microglia TGF-β1 signaling depends on microglia produced TGF-β1 ligand which cannot be compensated for by other cells.

Microglia-derived TGF-β1 ligand is critical to maintain microglial homeostasis and astrocyte quiescence in the adult CNS.

Next, we evaluated whether the loss of microglia-derived TGF-β1 ligand affects microglia morphology and homeostatic status. At 5- and 8-weeks post TAM administration, substantial morphological changes in microglia in MG-Tgfb1 iKO mice were observed (Fig 1B and Fig 2D, E - IBA1 staining in green). This change in morphology of IBA1+ cells in the iKO mice suggests loss of ramification and potential activation of microglia, which prompted us to carry out further detailed morphological analysis and examination of the homeostatic microglia signature genes. Two independent Cx3cr1^CreER mouse drivers were used in this study to confirm the phenotypes. Following microglial Tgfb1 knockout, microglia in Cx3cr1^{CreER(Littman)24} Tgfb1 iKO mice showed less ramification indicated by decreased total branch length (Fig 3F, control=323µm, 5wk iKO=167µm, 8wk iKO=190µm) and processes terminal end number (control=26, 5wk iKO=16, 8wk iKO=17) compared to control microglia. Moreover, Tgfb1 iKO microglia showed decreased expression of homeostatic microglia signature genes such as P2ry12 and Tmem119 (Fig 2C–E) and an upregulation of CD68 expression. These results agree with an impaired microglial homeostatic status; however, our observed phenotype is more severe than that of a previous study in which adult microglial TGF-β signaling was abolished via KO of TGF-βR2⁹, supporting that loss of microglia-derived TGF-β1 ligand cannot be compensated by potential TGF-β1 ligand production in other cell types in the adult CNS. These results support that microglial TGF-β1 signaling relies on TGF-β1 ligand produced by microglia. Interestingly, an increase in reactive astrocytes (indicated by upregulated GFAP expression, Fig 2I) was also observed both at 5 weeks and 8 weeks after TAM treatment in the Cx3cr1^{CreER(Littman)}Tgfb1^fl/fl mice but not in the Cx3Cr1^{CreER(Littman)}Tgfb1^wt/wt +TAM or the cre(−)Tgfb1^fl/fl +TAM mice. We first examined and quantified the phenotype in microglia and astrocytes in the cortex of the Cx3cr1^{CreER(Littman)}Tgfb1^fl/fl line (Fig 2) and observed a similar phenotype for both microglia and astrocytes at other brain regions as well (Supplementary Fig 3 showing hippocampus as another example, note that unlike cortical astrocytes which are mostly GFAP−, hippocampal astrocytes are already GFAP+ during homeostasis in WT mice).

Figure 2. Microglia-specific Tgfb1 gene deletion results in loss of homeostasis of microglia and in increased reactive astrocytes in cortex of the adult mouse brain.

(A) Mouse model for targeting microglial Tgfb1 and timeline. (B) 3D reconstruction of control and iKO microglia. Representative immunohistochemistry images of IBA1, TMEM119, P2RY12, CD68, and GFAP in the cortex of (C) Control animals, (D) Cx3cr1^CreER(Litt)Tgfb1^fl/fl knockouts 5 weeks after tamoxifen administration, and (E) Cx3cr1^{CreER (Litt)}Tgfb1^fl/fl knockouts 8 weeks after tamoxifen administration. Quantification of (F) total microglial process length, (G) microglial process terminal end numbers, (H) % of CD68 immunoreactive positive area, and (I) GFAP immunoreactive positive area fraction. Mean±SE, * = p<0.05, ** = p<0.01, *** = P<0.001. Student’s t-test. ( > 40 microglia were quantified for each animal and the average from one mouse was plotted as a single data point in the figure panel and treated as n=1 for statistical analysis). Scale bar = 100µm.

Figure 3. Astrocyte-specific or forebrain neuronal specific Tgfb1 gene deletion in the Aldh1l1^CreER or Camk2a^CreER drivers does not affect the homeostasis of microglia or GFAP expression in astrocytes in adult mouse brain (cortex).

(A) Astrocyte iKO mouse model and experimental timeline. (B, C) Representative immunohistochemistry images of cortex from TAM treated (8 weeks post) control (B) Aldh1l1^CreERTgfb1^wt/wt and (C) iKO Aldh1l1^CreER Tgfb1^fl/fl tissue showing IBA1, TMEM119, P2RY12, CD68, and GFAP immunostaining. Quantification of microglia ramification via (D) process terminal end numbers, (E) total process length, and (H) % of CD68+ immunoreactive area. (G) quantification of astrocyte reactivity using GFAP immunoreactive positive area fraction. (H) Neuronal iKO mouse model and experimental timeline. (I, J) Representative images of TAM treated (8 Weeks post) control Camk2a^CreERTgfb1^wt/wt (I) and iKO Camk2^CreER Tgfb1^fl/fl tissue showing IBA1, TMEM119, P2RY12, CD68, and GFAP immunoreactivity. Quantification of microglia ramification via (K) process terminal end number, (L) total process length, and (M) CD68+ immunoreactive % area. (N) Quantification of astrocyte reactivity using GFAP+ immunoreactive area fraction. Mean±SE ( > 40 microglia were quantified for each animal and the average from one mouse was plotted as a single data point in the figure panel and treated as n=1 for statistical analysis). ns=not significant., Scale bar = 100µm.

During the course of this study, we observed and reported non-TAM dependent leakiness in floxed reporter alleles in the Cx3cr1^{CreER(Littman)} line²⁴ and became aware of TAM-induced off-target cre activity in this line caused by neonatal TAM injections which could potentially confound our observed microglial phenotype²⁶. Although we did not treat control or Cx3cr1^{CreER(Littman)}Tgfb1 iKO mice until the age of 6–8 weeks, to further increase the rigor of our study, we generated a second independent MG-Tgfb1 iKO line using the Cx3cr1^CreER(Jung) line²⁷, in which we and others have recently demonstrated less non-TAM dependent leakiness in reporter alleles and the absence of TAM-induced neonatal or adult off-target effects^25,28. Using this second independent Cx3cr1^CreERTgfb1 iKO mouse line, we confirmed the same microglia and astrocytes activation phenotype in Cx3cr1^CreER(Jung)Tgfb1^fl/fl mice treated with TAM, while two control groups i.e. Cx3cr1^CreER(Jung)Tgfb1^wt/wt + TAM treatment or Cx3cr1^CreERTgfb1^fl/fl + vehicle injections show no phenotype (Supplemental Fig. 4). All subsequent experiments for microglia-specific Tgfb1 iKO were therefore carried out in the Cx3cr1^CreER(Jung)Tgfb1^fl/fl mouse line.

TGF-β1 ligand produced by astrocytes is not necessary for maintenance of glial homeostasis.

Previous studies have also suggested that TGF-β ligands produced by astrocytes could also play important roles in blood brain barrier formation, stabilization, and maturation, as well as neuroprotection following injury or disease^29–31. Therefore, we next investigated whether astrocyte-specific deletion of the Tgfb1 gene would also lead to alterations in microglia morphology and gene expression changes such as P2ry12, Tmem119, and Cd68. Additionally, we aimed to investigate whether loss of the astrocytic Tgfb1 gene could also induce changes in astrocyte reactivity as observed in Cx3cr1^CreERTgfb1 iKO mice. To target adult astrocytes, Aldh1l1^CreER mice³² were crossed with Tgfb1^fl/fl mice to generate astrocytic Tgfb1 iKO mice (Aldh1l1^CreERTgfb1^fl/fl). At 8-weeks following TAM administration, microglia morphology and astrocyte state were analyzed. Microglial morphology remained unchanged in Aldh1l1^CreERTgfb1^fl/fl animals compared to control mice (Aldh1l1^CreERTgfb1^wt/wt mice or Tgfb1^fl/fl mice) (Fig 3 for cortex and Supplementary Fig 5 for hippocampus as example). Additionally, no changes were observed in homeostatic microglia signature genes (P2ry12 or Tmem119). Nor did we observe upregulation of CD68 in microglia or an increase in GFAP expression in astrocytes when comparing the Aldh1l1^CreERTgfb1^fl/fl animals to wildtype controls at 8 weeks after TAM treatment (Fig 3 F, G and Supplementary Fig 5). This result further confirms that astrocytic TGF-β1 production is not required for the maintenance of microglia and astrocyte homeostasis.

Additionally, we also generated the constitutive astrocytic Tgfb1 KO mice using the mGfap^cre driver line³³, which targets a large population of astrocytes constitutively starting from neonatal stages³³, to ensure that a larger population of astrocytes (95% of cortical astrocytes labeled with Ai14 reporter)³⁴ will have the TGF-β1 ligand KO. Comparing the morphology of mGfap^CreTgfb1^fl/fl microglia to wildtype controls, there were no changes in the ramification of microglia in this independent astrocytic-Tgfb1 cKO mouse line (Supplementary Fig 6 for cortex and Supplementary Fig 7 for hippocampus). We next examined the expression of the homeostatic microglia signature genes such as P2ry12 and Tmem119 and did not observe any difference between mGfap^creTgfb1^fl/fl mice and control mice. CD68 expression in microglia and astrocytic GFAP expression were also unchanged. These results together support that under normal physiological conditions, adult astrocytes do not produce TGF-β1 ligand necessary for homeostatic maintenance in both microglia and astrocytes. It remains to be determined whether under injury or pathological conditions astrocytes could upregulate TGF-β1 ligand to modulate glial responses to injury or neurodegeneration.

Forebrain excitatory neurons do not produce TGF-β1 ligand for neighboring microglia.

Next, we investigated whether neurons are an additional critical source for TGF-β1 ligand production for adult microglia. To this end, we generated a forebrain excitatory neuron-specific Tgfb1 iKO mouse model. To target forebrain neurons, a Camk2a^CreER line³⁵ was crossed with the Tgfb1^fl/fl line to induce TGF-β1 ligand KO in excitatory neurons³⁵. Camk2a^CreER has been reported to recombine in a widespread manner in the cortex, hippocampus, and striatum³⁵. Eight weeks after TAM administration, microglial morphology remained unchanged in the CamkII^CreERTgfb1^fl/fl mice compared to wildtype controls (Fig 3 for cortex and Supplementary Fig 8 for hippocampus). Additionally, no alterations in TMEM119 or P2RY12 expression in microglia nor an increase in GFAP expression was observed. This supports that microglia do not critically rely on neuronal TGF-β1 ligand to maintain homeostasis in the adult brain.

Tmem119^CreER and P2ry12^CreER microglia-specific CreER mouse lines lead to lower-efficiency gene deletion of TGF-β1 in subsets of microglia and result in mosaic activation of adult brain microglia

The Cx3cr1^CreER line has previously been reported to also target border associated macrophages (BAMs) that reside in the pia and vasculature^25,28. Additionally, the two Cx3cr1^CreER mouse lines replace the endogenous Cx3cr1 gene with the cre expression cassette, resulting in heterozygosity for the Cx3cr1 gene in both control (Cx3cr1^CreERTgfb1^wt/wt) and in iKO (Cx3cr1^CreERTgfb1^fl/fl) mice^24,27. In an effort to further improve the targeting specificity for parenchymal microglia, the Tmem119^CreER and P2ry12^CreER mouse lines have recently been generated, utilizing homeostatic microglia signature gene promoters to drive creER cassette expression without affect the endogenous gene expression of Tmem119 or P2ry12^36,37. Our recent study reports that the Tmem119^CreER and the P2ry12^CreER mouse lines do show less TAM-independent “leaky” recombination events with the drawback of lower recombination efficiency, leading to only a subset of microglia being recombined in these two mouse lines (based on R26-YFP reporter gene expression and qRT-PCR results in sorted microglia)^25,28. To examine whether mosaic gene deletion of the TGF-β1 ligand in a subset of parenchyma microglia would generate any phenotype in microglia, we crossed Tmem119^CreER and P2ry12^CreER with the Tgfb1^fl/fl line to generate two parenchymal-microglia specific Tgfb1 iKO lines.

Our recent study shows that the R26-YFP reporter (which has a larger floxed stop cassette between the two loxP site, 2.7kb) has more stringent TAM-regulated cre recombination compared to the Ai9 R26-CAG-tdTomato reporter (0.9 kb between two loxP sites). Our study also shows that compared to the Cx3Cr1^CreERTgfb1 iKO line, P2ry12^CreERTgfb1 iKO mice show significantly lower efficiency of Tgfb1 gene deletion (~50% decrease in floxed Tgfb1 exon 3 mRNA levels) in sorted YFP+ microglia cells after TAM treatment²⁵. To investigate whether this incomplete deletion of microglial Tgfb1 could still produce the disruption of microglial homeostasis we observed in the Cx3Cr1^CreERTgfb1 iKO lines, we next evaluated microglial morphology in P2ry12^CreER and Tmem119^CreERTgfb1 iKO mice. Consistent with the mosaic recombination of the R26-YFP reporter gene and the partial reduction of Tgfb1 mRNA levels in adult microglia in the P2ry12^CreER mouse line, three weeks after TAM administration, we observed distinct islands of YFP+ microglia patches with activated microglia morphology in both the Tmem119^CreERTgfb1 and P2ry12^CreERTgfb1 iKO mice (Fig 4B, D, E). In addition to the mosaic and patchy morphological changes, we also observed a decrease in expression of homeostatic microglia signature genes P2ry12 and Tmem119 in these patches of microglia (Fig 4B, D, E). The morphological changes and loss of P2ry12 and Tmem119 expression were not observed in control Tmem119^CreERTgfb1^wt/wt or P2ry12^CreERTgfb1^wt/wt TAM mice or in Tmem119^CreERTgfb1^fl/fl and P2ry12^CreERTgfb1^fl/fl mice treated with vehicle only. Notably, the distinct mosaic patches of the few Tgfb1 KO microglia which showed altered morphology and loss of expression of homeostatic microglia signature genes are surrounded by wildtype microglia cells which can produce the TGF-β1 ligand (Fig 4B, D, E). This raises the interesting question of whether individual microglia rely on self-produced TGF-β1 ligand that is secreted in an autocrine manner or whether individual microglia could utilize the TGF-β1 ligand from neighboring microglia. To further investigate the mechanism of microglia-produced TGF-β1 ligand via an autocrine or paracrine mechanism, we further designed a sparse labeling strategy using the more robust Cx3cr1^CreER mouse line with a diluted TAM regimen as detailed below.

Figure 4. Mosaic deletion of Tgfb1 gene in subsets of parenchyma microglia in the P2ry12^creER Tgfb1 ^fl/fl or the Tmem119^CreERTgfb1^fl/fl iKO mice leads to distinct patches of dyshomeostatic microglia in the adult mouse brain.

(A) P2ry12^CreER mouse driver to induce Tgfb1 KO in P2RY12+ microglia and experimental timeline. We recently showed that these lines have a 50% decrease in exon3 of Tgfb1 mRNA in reporter positive microglia²⁵. (B) TAM treated (5 weeks post) Control and P2ry12^CreERTgfb1 ^fl/fl iKO representative images showing immunohistochemistry for IBA1, TMEM119, and P2RY12. (C) Tmem119^CreER mouse driver to induce tgfb1 KO in TMEM119+ microglia and experimental timeline. (D) TAM treated (5 weeks post) Control and Tmem119^creERTgfb1 ^fl/fl iKO representative images showing immunohistochemistry for YFP, IBA1, P2RY12 and (E) YFP, TMEM119, and GFAP immunostaining. White dotted outlines indicate microglia with downregulated TMEM119 and/or P2RY12 expression. White arrows depict YFP− cells that also show loss of P2RY12 expression. Yellow arrowheads show YFP+ cells in either WT or iKO mice that still maintained P2RY12 or TMEM119 expression. Representative results from n=3–5 mice/group. Scale bar = 100µm.

Mosaic knockout of TGF-β1 ligand in sparse single microglia reveals the autocrine mechanism of TGF-β1 signaling regulation that provides precise spatial and temporal regulation of microglia homeostasis.

To further investigate the spatial resolution of TGF-β1 ligand production by individual microglia and investigate whether individual microglia rely on self-produced TGF-β1 ligand using an autocrine mechanism, we designed a mosaic sparse recombination strategy using the Cx3cr1^CreER(Jung)Tgfb1^fl/fl line with a titrated TAM dilution. To accomplish this, we tested a TAM dosage of 1:50 and 1:7–1:10 of the concentration (180mg/kg) that is utilized in our full dose recombination. Our results (Supplementary Fig 9) show that for both the 1:50 and 1:7–1:10 TAM dosages, we observed very sparse YFP+ cells in the parenchyma that are also P2RY12+ (suggesting sparse recombination can occur in parenchymal microglia instead of BAMs). This result supports the feasibility of inducing sparse gene deletion in individual microglia surrounded by WT microglia using a titration of TAM dosage. Since the 1:7–1:10 dosage range provided recombination events that are sufficiently sparse, we carried out our subsequent experiments with this range of dosage. A diluted dose of 1:7 (18mg/kg) of TAM was given over the course of 3 days to Cx3cr1^CreER(Jung)Tgfb1^fl/flR26-YFP or control mice. This resulted in sparse labeling of microglia in the Cx3cr1^CreER(Jung) line, allowing for single-cell analysis of whether microglia depend on self-secreted TGF-β1 ligand to maintain their homeostasis. Remarkably, at 2–3 weeks post TAM administration, we observed isolated sparse individual IBA1+ cells in the parenchyma of the Cx3cr1^CreER(Jung)Tgfb1^fl/fl TAM-treated mice that presented with altered morphology (less ramified), accompanied by a decrease in TMEM119 and P2RY12 expression (Fig 5C, supp Video 1). Interestingly, these sparse mutated single IBA1+ cells are in the brain parenchyma and do not show typical blood vessel-associated macrophage morphology (Fig 5C). Some of these single morphologically-changed, TMEM119− microglia are YFP+ but they are not exclusively YFP+ suggesting that at this low level of TAM dosage, the recombination of the R26-YFP allele can happen independently from the deletion of targeted floxed genes on a single cell level, a result that is also supported by our recent study using dual reporter alleles in microglia²⁵. In Cx3cr1^CreERTgfb1^wt/wtR26-YFP TAM-treated mice, we observed a similar frequency of sparse YFP+ microglia but did not find any individual non-BAM microglia that show this phenotype of activated microglia (marked by loss of TMEM119 expression and altered morphology), suggesting that the sparse individual “activated” microglia in the Cx3cr1^CreERTgfb1^fl/fl mice is due to loss of TGF-β1 ligand in these single sparse microglia.

Figure 5. Sparse Tgfb1 induced-knockout in individual adult microglia supports an autocrine mechanism of microglial TGF-β ligand production and signaling regulation.

(A) Mouse model used to induce Tgfb1 KO in mosaic sparse individual microglia and experimental timeline depicting titrated dose of tamoxifen. (B-D) Representative images showing IBA1, TMEM119, and YFP expression and co-localization in control tissue at 2 weeks post tamoxifen (B) and sparse iKO tissue at 2 weeks (C) showing loss of TMEM119 expression in sparse individual microglia and (D) reversal of TMEM119 expression in the sparse Tgfb1 iKO brain at 8 weeks post tamoxifen. The yellow dotted outline in (C) highlights singular microglia showing loss of homeostatic TMEM119 expression. White arrows highlight YFP+ cells showing no loss of homeostatic TMEM119 expression. Note that at this low dosage of TAM, the recombination of individual floxed alleles (R26-YFP reporter or the floxed Tgfb1 gene) occurs independently of each other, therefore YFP+ cells do not always indicate a sparse Tgfb1 KO microglia, consistent with our recent study²⁵. Representative results from n=3–5 mice/group from different cohorts of TAM treatment. Scale bar = 100µm.

To further confirm this hypothesis, we carried out a combined IHC/RNAscope using the same TGF-β1 RNAscope probe we used to confirm microglial TGF-β1 expression (Fig 6B). Indeed, we observed loss of TGF-β1 RNAscope probe hybridization in the individual microglia that specifically showed altered morphology accompanied by the loss of TMEM119 expression, while surrounding IBA1+/TMEM119+ microglia showed normal TGF-β1 RNAscope signal (Fig 6B). We further carried out immunostaining for the detection of the downstream signaling effector of TGF-β1 signaling (pSMAD3) in the mosaic sparse MG-Tgfb1 iKO brain and confirmed that loss of pSMAD3 is detected specifically in sparse individual microglia that are TMEM119− and morphologically altered (Fig 6C and Supplementary Fig10–11 for additional image examples). Therefore, our results suggest that microglia show a precise spatial regulation of autocrine TGF-β1 signaling reliant on self-produced TGF-β1 ligands under homeostatic physiological conditions. We next asked whether this loss of homeostasis in individual Tgfb1 KO microglia at 2–3 weeks post TAM is sustained with time or whether, with surrounding wildtype microglia, the individual Tgfb1 KO microglia can regain homeostasis. Interestingly, at 8 weeks post TAM treatment in sparse MG-Tgfb1 iKO mice, the phenotype of sparse TMEM119 negative and morphologically altered microglia are no longer observed (Fig 5D). This suggests that these sparse Tgfb1 KO microglia can regain homeostasis (indicated by normal ramified morphology and restoration of TMEM119 expression) at 8 weeks after TAM treatment in a sparse mosaic MG-Tgfb1 gene deletion model.

Figure 6. In-situ RNA-scope and IHC double labeling confirm loss of Tgfb1 RNA and downregulation of TGF-β downstream signaling (pSMAD3) in dyshomeostatic individual microglia in the sparse Tgfb1 iKO model.

(A) The mouse model used to examine sparse iKO in microglia and experimental timeline with TAM dosage. (B) Representative image showing combined immunohistochemistry staining (for IBA1, TMEM119, DAPI) and Tgfb1 RNA-scope hybridization. (B1–3) Surrounding normal microglia showing TMEM119 expression and Tgfb1 RNA presence. (B4) A single microglia cell with loss of TMEM119 expression and loss of Tgfb1 mRNA. White arrows were used to mark normal cells in the central panel. Yellow arrowhead used to mark individual iKO microglia. Note that tissue treatment for RNAscope analysis makes the IHC condition less ideal for morphology evaluation than regular IHC staining, however, IBA1 and TMEM119 expression are still distinguishable for individual WT or iKO microglia. (C) Representative image showing co-immunohistochemical staining with DAPI, IBA1, TMEM119, and pSMAD3. (C1–5) Surrounding normal microglia showing TMEM119 expression and pSMAD3 immunostaining. (C6) A single microglia cell with loss of TMEM119 expression and loss of pSMAD3 labeling. The yellow arrow (microglia #6) marks the individual iKO microglia. Representative results from n=3 iKO mice. Scale bar = 10µm. For additional representative images see Supplementary Figs 10 and 11.

Loss of microglia-derived TGF-β1 ligand leads to transcriptomic changes indicating an activated state in both microglia and astrocytes in Cx3cr1-Tgfb1 iKO mice.

To further characterize the transcriptional changes following the loss of microglial TGF-β1 ligand, microglia and astrocytes were sorted from the Cx3cr1^CreER(Jung)Tgfb1^fl/flR26-YFP and Cx3cr1^{CreER (Jung)}Tgfb1^wt/wtR26-YFP animals 3 weeks after TAM administration based on YFP expression or ASCA2 immunolabeling (astrocyte staining, Supplementary Fig 12 and Fig 7)³⁸ and subjected to RNAseq analysis. Purity of samples collected using this sorting method is validated by qRT-PCR for microglia and astrocytic signature genes respectively (Supplementary Fig 12D). We sorted brain microglia based on recombined YFP reporter expression (which labels about 90% parenchyma microglia in whole brain) instead of CD11b⁺/CD45^low to avoid the potential caveat that loss of TGF-β signaling in microglia may alter CD45 expression and selectively enrich for a subpopulation of microglia in the KO brain. PCA analysis shows that wildtype microglia samples and Tgfb1 iKO microglia distinctively clustered together (Fig 7C). The heatmap shows significantly differentially expressed genes (fold change >= |1.5| and adj.pvalue < 0.05). In contrast to a recent study using Cx3cr1^CreERTgfbr2^fl/fl receptor inducible KO mice, which reported no changes in many homeostatic microglia signature genes in KO mice⁹, we observed a large set of differentially expressed genes (Heatmap Fig 7D) including downregulation of many microglia homeostatic signature genes (P2ry12, Tmem119, Sall1, etc. Fig7E, K) and upregulation of immune response regulating genes (Tnf, Il1b, Interferon responsive genes, Fig 7E, K). Using gene set enrichment analysis (GSEA) we observed upregulation of several pathways related to immune response, immune cell recruitment, and interferon response (Supplemental Fig 10B). We also observed downregulation in platelet aggregation pathway genes (Supplemental Fig 10C). For astrocytes, we observed upregulation of multiple A1-like genes (Serping1, Ifit3, Gbp3, Fig 7J, L) and interestingly we also observed an increased interferon response (Irf7, Irf9, Fig 7J). Consistently, GSEA analysis also showed increased interferon activity and decreased metabolic functions (NADH, Mitochondria, Acetyl Coa, Supplemental Fig 10D, E) which suggests a transition from metabolic support functions to an activated pro-inflammatory state in astrocytes from the MG-Tgfb1 iKO brain. These data suggest that microglia and astrocytes had disrupted homeostatic functional activity after the loss of microglial TGF-β1.

Figure 7. Transcriptomic analysis of microglia and astrocyte cells sorted from Cx3Cr1^CreER(Jung)Tgfb1^fl/fl mice.

(A) Mouse model used to induce Tgfb1 KO and YFP reporter in microglia. (B) Summary of transcriptomic changes in microglia or astrocytes pertaining to both inflammatory responses and critical TGF-β signaling component genes. (C, H) PCA analysis plot of microglia and astrocyte samples. Note that one astrocyte sample from iKO mice clustered irregularly in the PCA plot which has an RNA Integrity Number (RIN) below 8 (red circle). (D, I) Heatmap of expression of significantly differentially expressed genes in microglia and astrocytes from control and iKO samples. (E, J) Volcano plot showing expression log fold changes. (K) Microglial differential gene expression observed across various gene sets including, homeostatic microglia genes^39–42, stage 1 and 2 disease-associated microglia (DAM) genes⁴⁰, injury exposed microglial (TBI)⁴², amyloid beta exposed microglia^39,41,42, and aged microglia^41,42. (L) Astrocytic differential gene expression was observed across different gene sets including, homeostatic astrocyte genes, A1, and A2 genes. Z-scores were calculated and plotted to display differential gene expression⁴³. The astrocyte sample that had an RIN< 8 was excluded from this analysis.

We next wanted to compare the transcriptomic profile of the Cx3cr1^CreERTgfb1^fl/fl microglia and astrocytes in relation to previously characterized non-homeostatic microglial states. For microglia, we censured multiple previous studies to generate a list of signature genes associated with aging, CNS injury (Traumatic brain injury-TBI), and amyloid-beta pathological conditions^39–43. We observed that three weeks after loss of microglial TGF-β1 ligand, microglia showed down regulation of microglial homeostatic genes (Hexb, P2ry12, Tmem119, Cst3, Cd33, Cx3cr1, Fig 7K) suggesting dyshomeostasis. We also observed increased expression of aging microglia signature genes (ex. Ifitm3, Ccl12, Il1b Ccl2, Lgals3, Fig 7K) and injury-associated TBI signature genes such as Irf7, Igf1, Cxcl10, Ccl12, Axl, Cd63, and Cybb. Recently amyloid beta-induced microglial transcriptomic changes have been profiled into DAM 1 and DAM 2 stages, the transition of which depends on TREM2 signaling^39–42. Interestingly, Tgfb1 iKO microglia resembles upregulation of a subset of amyloid beta-associated microglia profile genes, while showing down regulation of other amyloid beta profile genes. Upon further examination, we noted that the upregulated genes in iKO microglia represent DAM 1 signature genes (B2m, Apoe, Tyrobp, but a decrease in Trem2 levels) while downregulated genes in iKO microglia represent DAM 2 signature genes (Ccl6, Cst7, Cd9, Csf1, Itgax) which correlates well with the downregulation of TREM2 in iKO microglia. Additionally, after the loss of microglial TGF-β1, consistent with the observed reactivity in astrocytes by upregulation of GFAP protein, we observed downregulation of some astrocytic homeostasis genes (Aldh1l1, Acsl6, Aldoc), upregulation of A1 associated genes (Gbp3, Gbp2, Gbp6, Psmb8, Fig 7), and no discernable changes in the A2 associated genes (Fig 7L). This suggests that astrocytes might be adapting a neurotoxic-like (A1-like) rather than a neuroprotective (A2-like) profile.

Transcriptomic data from microglia and astrocytes also reveal interesting expression patterns of critical components of the TGF-β signaling pathways. Consistent with qRT-PCR data from sorted microglia and astrocytes (Supplementary Fig. 12D) and our data showing no observable changes following astrocytic TGF-β1 KO (Fig 3, Supplemental Fig 5, 6, & 7), RNA-seq data shows Tgfb1, Tgfbr1, Tgfbr2, and Lrrc33 (a protein that is critical for latent TGF-β1 ligand activation) are all significantly enriched in microglia compared to astrocytes (% mRNA levels in microglia vs astrocytes: Tgfb1=500%, Tgfbr1=9500%, Tgfbr2=2600%, Lrrcc33=500%). Instead, astrocytes express Tgfb2, which is absent in microglia, suggesting Tgfb2 might have a potential role in astrocyte function. Interestingly, we observed multiple compensatory mechanisms in response to MG-Tgfb1 deletion: (1) an up-regulation of Tgfb3 gene in microglia and no change of Tgfb2 levels in astrocytes, (2) the upregulation of Lrrc33 in microglia, a gene that has been demonstrated to be critical in activating the latent TGF-β ligand¹⁶, (3) down regulation of Smad7, which is a negative regulator of the TGF-β signaling pathway. Moreover, we observed a down-regulation of Smad3 and Tgfbr1 but not Tgfbr2 mRNA, suggesting a TGF-β signaling-dependent feedforward regulation of Smad3 and Tgfbr1 expression (Fig 7B, Supplementary Fig 15).

Loss of Microglia-derived TGF-β1 ligand leads to cognitive deficits in the Cx3cr1^CreER(Jung)Tgfb1 iKO mice without affecting general locomotor function and motor learning.

We next investigated whether the aging- and DAM-associated microglia profile and the induction of reactive astrocytes in the MG-Tgfb1 iKO could affect neurological function in young adult mice. Full dosage TAM was used in this experiment to achieve maximum changes in microglia and astrocytes in the adult brain. A behavioral battery was used to examine general locomotion, motor coordination/learning, and cognitive function involving learning and memory. We first assessed voluntary movement in control and MG-Tgfb1 iKO mice at 5 weeks after TAM injection using an automated open field locomotion tracking system and monitored mice for 23 hours with free access to food and water (Omnitech electronics INC, Columbus, OH ). We did not observe any change in general locomotion in the Cx3cr1^CreERTgfb1^fl/fl +TAM animals compared to Cx3cr1^CreERTgfb1^wt/wt +TAM controls during the exploratory phase (1 hour after naïve exposure to the chamber), or during the light or the dark cycle (Fig 8K–N). Next, we carried out an acceleration rotarod test to evaluate motor coordination and motor learning. We specifically used a three-trial acceleration paradigm that starts at 1rpm and increases to 35rpm over the course of 5 minutes to evaluate their starting motor coordination, and how their performance improves over each trial. The Cx3cr1^CreERTgfb1^fl/fl + TAM animals did not show a difference in performance compared to control Cx3cr1^CreERTgfb1^wt/wt + TAM group in the rotarod test, suggesting that motor coordination and motor learning are not affected in the MG-Tgfb1 iKO mice. However, interestingly, when we evaluated the cognitive function (spatial learning/memory) in control and MG-Tgfb1 iKO mice using a 2-day Barnes Maze learning paradigm, Cx3cr1^CreERTgfb1^fl/fl TAM group showed an increase in latency to reach the escape hole and higher error trial numbers to locate the hole compared to the control mice, suggesting impaired spatial learning in the Cx3cr1^CreERTgfb1^fl/fl iKO mice. Importantly, Cx3cr1^CreERTgfb1^fl/fl mice that received vehicle treatment do not show any difference compared to control mice in any of the above behavioral tests (Fig 7C–J), demonstrating that the behavioral deficits in cognitive function measured by Barnes Maze in the Cx3cr1^CreERTgfb1^fl/fl + TAM mice are specifically caused by TAM-induced deletion of the microglial-Tgfb1 gene in these mice. These data support that microglia-derived TGF-β1 ligand is critical in maintaining microglia homeostasis, astrocyte quiescence, and normal cognitive function in the adult brain.

Figure 8. Behavioral assessment of full dosage Veh or TAM treated Cx3cr1^CreERTgfb1^wt/wt or Cx3cr1^CreERTgfb1^fl/fl mice to evaluate general motor function, motor coordination and learning, and learning and memory.

(A) Mouse model used to induce Tgfb1 KO in microglia. (B) Experimental timeline, showing the order of behavioral measurements. (C-J) Behavioral measurements in vehicle-treated Cx3cr1^CreERTgfb1^wt/wt or Cx3cr1^CreERTgfb1^fl/fl mice showing open field test (OFT) of the first hour in locomotion chamber (C) average speed and (D) total distance traveled. (E,F) average speed and total distance during the light and dark cycles in a 23-hour period. G) Accelerated rotarod learning test. (H-J) Barnes maze test showing (H) average speed during testing (I) latency to locating the target hole and (J) number of error trails before locating the target hole. (n=8 for each group). (K-R) Behavioral measurements from TAM-treated control and iKO mice showing open field test (OFT) of the first hour in locomotion chamber (K) average speed and (L) total distance traveled. (M, N) average speed and total distance during the light and dark cycles in a 23-hour period. (O) Accelerated rotarod learning test. (P-R) Barnes maze test showing (P) average speed during testing (Q) latency to locating the target hole and (R) number of error trails before locating the target hole. (control n=19, iKO n=13) (ns=not significant, * p<0.05, Student’s t-test)

Discussion

Furthering our understanding of how TGF-β1 signaling is precisely regulated in the brain can provide important insight into microglia function during steady state and disease conditions. Our study addresses several critical gaps in our knowledge about CNS TGF-β ligand production and regulation and sheds light on how alteration of a single cytokine gene (Tgfb1) in microglia could causally contribute to cognitive deficits in young adult mice in the absence of brain injury or other disease model.

Currently, the prevailing understanding on the source of TGF-β1 ligand in the CNS has been speculated to be coming from multiple cell types and that TGF-β ligands can be widely shared among different cell types^{11–14,30,31,37,44–47}. Several reviews have proposed the sharing of TGF-β1 amongst all the cell types, despite not yet having a well-rounded understanding of TGF-β1 ligand production and distribution^10–15. CNS cell-type specific inducible TGF-β ligand gene deletion has not been studied previously and our study clarifies which cell types produce TGF-β1 ligands that are critical for maintaining microglia homeostasis in the adult mouse brain under physiological states. Our data support that microglia-produced TGF-β1 ligand is required for microglial homeostasis and subsequent astrocyte quiescence in the CNS. We used multiple microglia-CreER drivers to rigorously investigate this phenotype. Two independent Cx3cr1^CreERTgfb1 iKO mouse lines both lead to a global loss of microglia homeostasis revealed by morphological changes and downregulation of homeostatic gene expression such as Tmem119 and P2ry12 without affecting serum or spleen levels of TGF-β ligand (demonstrated by both ELISA and FACS). We also show that astrocytic (via either inducible Aldh1l1^CreER line or constitutive postnatal deletion via the mGfap^Cre driver) or neuronal (via inducible Camk2^CreER line) deletion of the Tgfb1 gene does not affect microglia morphology or expression of signature homeostatic microglia genes. Recent studies by us and others show that the Cx3cr1^CreER mouse lines^24,27 recombine a portion of splenocyte macrophages even after the waiting period of >3 weeks, therefore, there is a possibility that the changes in microglia phenotype observed in the Cx3cr1^CreERTgfb1 iKO mice could be due to parenchyma microglia population depletion and peripheral macrophage replacement in the brain. Alternatively, the activation of Tgfb1 KO BAMs (which are also targeted by the Cx3cr1^CreER lines) could subsequently activate the rest of the parenchyma microglia. However, results from the P2ry12^CreERTgfb1^fl/fl mice and Tmem119^CreERTgfb1^fl/flR26-YFP mice also showed morphological and homeostatic microglial marker expression changes in the mosaic patches of YFP+ cells (indicating they were P2ry12+ or Tmem119+ at the time of TAM administration), supporting that the parenchymal resident microglia are altering their phenotype in response to deletion of Tgfb1 gene, rather than being replaced or indirectly altered by peripheral monocytes or macrophages.

Additionally, by using low TAM dosage to achieve sparsely mosaic Tgfb1 KO in very few individual microglia, our data supports that not only do microglia produce their own ligand to regulate their quiescent state, but they likely do so in an autocrine manner since Tgfb1 gene deletion in sparsely distributed individual microglia leads to downregulation in TGF-β signaling (pSMAD3) and phenotypic changes in individual cells despite their surrounding WT microglia population. This data suggests that microglia regulate TGF-β signaling and related downstream pathways in a spatially precise manner which is consistent with the very low concentration of TGF-β1 ligand in brain tissue compared to spleen and serum levels. This mechanism is of particular importance in relation to disease or injury response since the glial activation cascade could be reliant on local fluctuating TGF-β1 levels. Importantly, TGF-β is synthesized as a latent form (L-TGF-β) whose activation requires release of the mature c-terminal domain from non-covalently bound latency-associated peptide (LAP)^16,48,49. One recent study also suggested a possible highly localized mechanisms responsible for the releasing of the mature TGF-β1 ligand from the non-covalently bound prodomain (LAP) based on the coordinated molecular action of microglia-expressed LRRC33 (functioning as a LAP binding protein) and αVβ8 integrin¹⁶, possibly expressed on other cell types such as astrocytes.

While this microglial autocrine mechanism appears to be the primary mechanism for TGF-β1 signaling in microglia during homeostasis, interestingly, we observed that sparse individual KO microglia surrounded by WT microglia can recover to homeostatic state (measured by morphology and expression of TMEM119 and P2RY12) at 8 weeks after the loss of native TGF-β1 ligand production (Fig 5D). Note that on the populational level (with full TAM dosage and when most microglia are Tgfb1 KO) at 8 weeks, microglia in the Cx3cr1^CreERTgfb1 iKO mice still show morphological changes and loss of TMEM119 and P2RY12 expression. This suggests that the milieu environment of surrounding WT microglia is able to “reset” the sparse individual Tgfb1 KO microglia in the sparsely mosaic KO mice but not when the majority of the microglia are KO cells that are activated. The mechanism for this recovery and to what extent the remaining “normal” microglia can help “reset” the mosaic activated microglia is not clear and warrants further investigation in future studies. Interestingly, our RNAseq data from the full dose TAM treated MG-Tgfb1 iKO mice show that not Tgfb2 but Tgfb3 levels are upregulated in the MG-Tgfb1 KO microglia (supplementary table 4), raising the interesting question of whether upregulated microglial TGF-β3 levels are able to compensate for the loss of TGF-β1 ligand in microglia. Previous studies have shown that Tgfb1- and Tgfb3-specific single KO mice have different phenotypes and that the swapping of the code sequence between Tgfb1 and Tgfb3 gene only leads to partial rescue of the phenotypes, suggesting non-overlapping functions of the two ligands, which is also supported by unique biophysical properties between the two ligands in recent studies⁵⁰. Our results also suggest that upregulation of the TGF-β3 detected at 3 weeks post TAM in Tgfb1-KO microglia was not able to rescue the phenotype in microglia at up to 8 weeks post TAM in full dosage recombined mice. Interestingly, a recent study presented Cryo-EM structures which show that LRRC33 only presents L-TGF-β1 but not the -β2 or -β3 isoforms due to the differences of key residues on the growth factor domains¹⁶. This molecular selectivity offered by microglia-expressed LRRC33 could possibly explain why upregulated TGF-β3 expression in the TGF-β1 KO microglia could not compensate the loss of TGF-β1 ligand and rescue the phenotype in microglia in full TAM dosage MG-Tgfb1 iKO mice. RNAseq data from sorted microglia and astrocytes from WT or MG-Tgfb1 iKO brains also reveal interesting cell type specific transcriptomic regulation of the TGF-β signaling components in different cells during homeostasis or in response to the disturbance of TGF-β signaling. Specifically, we found that TGF-β1 is mainly enriched in microglia while TGF-β2 is enriched in astrocytes. Correspondingly, microglia express LRRC33 which preferentially presents TGF-β1 instead of TGF-β2 or -β3 for ligand activation. These patterns might explain why deletion of microglial TGF-β1 but not astrocytic TGF-β1 leads to the observed phenotypes in both microglia and astrocytes. Interestingly, loss of microglial TGF-β1 ligand also leads to down-regulation of Smad3 and the TGF-βR1 but not TGF-βR2 in microglia, suggesting a feedforward regulation of TGF-β signaling on the expression of SMAD3 and TGF-βR1 which facilitates further TGF-β signaling. Conversely, Tgfb1 KO microglia also upregulate Tgfb3 and Nrros (LRRC33) while downregulating the inhibitory Smad7, reflecting an attempt to compensate for the loss of TGF-β signaling in KO microglia. These gene expression changes reflect a highly dynamic regulation of this critical signaling pathway and supports the precise spatially regulated autocrine mechanism in microglia. Consistently, none of these changes in the TGF-β signaling components are observed in astrocytes, indicating that the transcriptomic changes observed in astrocytes in the MG-Tgfb1 iKO mice are likely not due to direct loss of TGF-β signaling in astrocytes. Whether genetic deletion of TGF-β2 or deletion of the type 1 or type 2 receptors in astrocytes would lead to activation of astrocytes warrants further investigation in future studies.

In the absence of the endogenous microglia-derived TGF-β1 ligand, microglia showed reduced ramification, decreased parenchymal homeostatic microglia signature gene expression, increased pro-inflammatory cytokine expression, and upregulation of interferon response genes. The expression profile of the Tgfb1 iKO microglia aligned with damage associated microglia (DAMs)^40,42, which have been described using both injury models (TBI)⁴² and disease states (amyloid beta pathology)^39–42. Additionally, these transcriptomic profile changes also corresponded with observed gene expression changes in aging microglia^41,42, suggesting that TGF-β1 signaling in microglia can provide vital insights into injury, neurodegenerative disease, and aging. The microglial Tgfb1 iKO phenotype observed in our study is consistent with that described after constitutive Tgfbr2 deletion in myeloid cells by the Cx3cr1^Cre promoter during development⁵¹, which are more severe than the phenotype observed when Tgfbr2 was deleted at P30⁵¹ or in a separate study at 2 months of age using the adult Cx3cr1^CreERTgfbr2 inducible mice²⁶. Factors such as the dosage and route of TAM treatment, efficiency of recombination of the floxed genes and whether cre-mediated recombination leads to complete absence of the target protein, or a truncated protein can all contribute to severity of the phenotypes. One specific potential caveat regarding the adult Cx3cr1^CreERTgfbr2^fl/fl iKO study⁹ is that KO microglia were sorted from Cx3cr1^CreER(+/wt) mice which are heterozygous for the Cx3cr1 gene while control microglia are sorted from Cx3cr1^CreER(wt/wt) mice which has both alleles of the Cx3cr1 gene. Heterozygosity of Cx3cr1 has previously been reported to cause changes in gene expression or function in microglia^52–56 and therefore might introduce additional confounds to the data interpretation. Additionally, both previous studies^9,51 used the same Tgfbr2 floxed mouse line⁵⁷ which has shown deletion of exons 2/3 do not alter the reading frame of the remaining exons leading to a truncated protein with normal serine/threonine kinase activity. This could potentially introduce an additional confound. In our study, we utilized a Tgfb1 floxed mouse model (065809-JAX with 0.5kb of floxed region) which leads to a frame shift and results in complete absence of the active TGF-β1 ligand. This might explain the much more robust phenotypes in our adult iKO mice.

We also observed transcriptomic changes in astrocytes in the MG-Tgfb1 ligand mice, featuring GFAP protein upregulation and increased interferon response genes. While GFAP is a pan-reactive marker, RNAseq data also shows upregulation of multiple A1-like neurotoxic astrocyte markers. Interestingly, deletion of Tgfb1 gene in astrocytes via the constitutive mGfap^Cre driver line or the inducible Aldh1l1^CreER line did not induce morphological changes in microglia, nor GFAP expression in astrocytes, suggesting the activation of astrocytes in the MG-Tgfb1 iKO mice is likely secondary to microglial profile change instead of direct loss of TGF-β signaling in astrocytes. This is consistent with the absence of Tgfb1 gene in astrocytes which instead express Tgfb2. Loss of TGF-β signaling in microglia leads to upregulation of multiple pro-inflammatory cytokines which could in turn mediate the crosstalk between KO microglia and neighboring astrocytes. One such potential crosstalk can be through TNF signaling since it has been shown that TNF can promote A1-like astrocyte activation and the TGF-β1 ligand knockout microglia shows an increase in TNFα in KO microglia⁵⁸.

Lastly, the behavioral analysis in the Cx3cr1^CreER(Jung)Tgfb1 mice shows that at 5 weeks following TAM treatment, there are significant deficits in the spatial learning and memory of MG-Tgfb1 iKO mice without affecting the general locomotion function or motor learning. During the preparation of this paper, a recent study also reported a deficit in learning using a Morris Water Maze test in Crybb1^CreSmad4 cKO mice⁵⁹. The Crybb1^Cre driver targets embryonic macrophages (with some off-target recombination in OPCs and neurons) and therefore the observed learning deficits could result from a deficit of neurons and projections during development⁵⁹. However, our data show that adult microglia critically rely on self-derived TGF-β1 ligand to maintain homeostasis and TAM-induced deletion of the TGF-β1 ligand in adult microglia leads to learning deficits in adult mice, suggesting an ongoing reliance on microglia-derived TGF-β1 ligand and TGF-β1 signaling in microglia to maintain normal cognitive function in adulthood. This result may have important implications for the role of microglial-TGF-β1 signaling in cognitive deficits observed during aging, neurodegenerative diseases, or after CNS injury. While constant basal TGF-β1 signaling is necessary for microglial homeostasis, TGF-β1 levels change with aging, injury, and disease^10,11,13,31. Our results support that dysregulated microglia due to loss of TGF-β1 ligand with the transcriptomic features of DAMs and aged microglia might play a causal role in driving the cognitive deficits observed in these disease conditions and targeting TGF-β signaling might be a potentially therapeutic strategy to mitigate these deficits.

STAR Methods

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Yu Luo (luoy2@ucmail.uc.edu).

Materials availability

This study did not generate new unique reagents.

Data and code availability

• RNA-seq data have been deposited at GEO and are publicly available as of the date of publication. Accession numbers are listed in the key resources table.

• Microscopy data and behavioral test data reported in this paper will be shared by the lead contact upon request.

• No original code was generated in this study.

• Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Key Resources Table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Goat Iba1 antibody	Abcam	Cat# ab5076, RRID: AB_2224402
Rabbit Iba1 antibody	Wako	Cat# 019-19741, RRID:AB_839504
Rabbit GFP antibody	Invitrogen	Cat# A11122, RRID: AB_268094
Chicken GFP antibody	Aves	Cat# GFP-1010, RRID: AB_2307313
Rat P2RY12 antibody	BioLegend	Cat#848002, RRID: AB_2650634
Rabbit anti-Mouse P2RY12 antibody	AnaSpec	Cat#55043A, RRID: AB_2298886
Rabbit anti-Green Fluorescent Protein (GFP) Polyclonal Antibody	Invitrogen	Cat#A11122, RRID: AB_221569
Recombinant Anti-Smad3 (phospho S423 + S425) antibody	Abcam	Cat# ab52903, RRID: AB_882596
GFAP	Sigma Aldrich	Cat# G3893, RRID: AB_477010
CD68	BioRad	Cat# MCA1957T, RRID: AB_2074849
NEUN	BioLegend	Cat# 834501, RRID: AB_2796508
Tgfb1 FACS antibody (clone TW7-16B4)	Biolegend	Cat# 141404, RRID:AB_10943504
Anti-mouse CD16/32 antibody	ThermoFisher	Cat#14-0161-86, RRID:AB_467135
CD45 antibody (clone 30-F11)	Biolegend	Cat# 103108, RRID:AB_312973
CD11b antibody (clone M1/70)	Biolegend	Cat# 101236, RRID:AB_312784
ASCA2 antibody, anti-mouse, APC	Miltenyi Biotec	Cat# 130-123-284, RRID: AB_2811488
Donkey anti-Goat IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ Plus 488	Thermo Fisher Scientific	Cat# A32814, RRID: AB_2762838
Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 555	Thermo Fisher Scientific	Cat# A-21432, RRID: AB_2535853
Cy3-AffiniPure Donkey Anti-Rat IgG (H+L)	Jackson ImmunoResearch	Cat# 712-165-153, RRID: AB_234066
Alexa Fluor 647-AffiniPure Donkey Anti-Rat IgG (H+L)	Jackson ImmunoResearch	Cat# 712-605-153, RRID: AB_2340694
Cy3-AffiniPure Donkey Anti-Rabbit IgG (H+L)	Jackson ImmunoResearch	Cat#715-165-152
Alexa Fluor 647-AffiniPure Donkey Anti-Rabbit IgG (H+L)	Jackson ImmunoResearch	Cat# 711-605-152, RRID: AB_2492288
Chemicals, peptides, and recombinant proteins
Tamoxifen	Sigma	T5648-5G
Sunflower seed oil	Sigma	S5007
100% Ethanol	Sigma	493546-1L
Percoll	GE	17-0891-01
10x HBSS	Thermo Fisher Scientific	14185052
1x HBSS	Thermo Fisher Scientific	14175079
DAPI	Sigma	D9542
DNaseI	Roche	10104159001
Bovine Serum Albumin	Sigma	9048-46-8
Normal Donkey Serum	Jackson ImmunoResearch	017-000-121
Triton-100x	Sigma	T8787
Deposited data
RNA-seq data	This paper	GEO: GSE236032
Experimental Models: Organisms/strains
Mouse: B6.129P2(Cg)-Cx3cr1tm2.1(cre/ERT2)Litt/WganJ	The Jackson Laboratory	IMSR Cat# 021160 RRID: IMSR_JAX:021160
Mouse: B6.129P2(C)-Cx3cr1tm2.1(cre/ERT2)Jung/J	The Jackson Laboratory	IMSR Cat# 020940 RRID: IMSR_JAX:020940
Mouse: B6(129S6)-P2ry12em1(icre/ERT2)Tda/J	The Jackson Laboratory	IMSR Cat# 034727 RRID: IMSR_JAX:034727
Mouse: C57BL/6-Tmem119em1(cre/ERT2)Gfng/J	The Jackson Laboratory	IMSR Cat# 031820 RRID: IMSR_JAX:031820
Mouse: B6.129X1-Gt(ROSA)26Sortm1(EYFP)Cos/J	The Jackson Laboratory	IMSR Cat# 006148 RRID: IMSR_JAX:006148
Mouse: C57BL/6J-Tgfb1em2Lutzy/Mmjax	The Jackson Laboratory	IMSR Cat# 065809-JAX RRID: MMRRC_065809-JAX
Oligonucleotieds
Primers: Hbms (Probe #79)	Integrated DNA Technologies	F: TCCCTGAAGGATGTGCCTAC R: ACAAGGGTTTTCCCGTTTG
Primers: Hprt1 (Probe #22)	Integrated DNA Technologies	F: TGATAGATCCATTCCTATGACTGTAGA R: AAGACATTCTTTCCAGTT AAA GTT GAG
Primers: Iba1 (Probe #3)	Integrated DNA Technologies	F: GGATTTGCAGGGAGGAAAA R: TGGGATCATCGAGGAATTG
Primers: Tmem119 (Probe #63)	Integrated DNA Technologies	F: AGGGAGCAAAGCCTGTGAA R: TGACCGCTGAGCACCTCT
Primers: P2ry12 (Probe #102)	Integrated DNA Technologies	F: CCCGGAGACACT CATATCCTT R: GTCCCAGGGGAGAAGGTG
Primers: S100β (Probe #78)	Integrated DNA Technologies	F: GACTCCAGCAGCAAAGGTG R: AGACATCAATGAGGGCA ACC
Primers: Glast (Probe #77)	Integrated DNA Technologies	F: CATTGCAGTGGACTGGTTTC R: CTGCTCCGAGGGAGTCAC
Primers: Glt1 (Probe #103)	Integrated DNA Technologies	F: GATGCCTTCCTGGATCTCATT R: TTGTCACTGTCTGAATCTG CTG
Primers: Atp1b2 (Probe#58)	Integrated DNA Technologies	F: AGCTCAACAAGTTCTTGGAACC R: CTGGACGGCAGACATCATT
Critical commercial assays
Papain dissociation kit	Worthington	Cat#LK003150
LIVE/DEAD fixable dead cell stain kit	Invitrogen	Cat# L34960
RNAqueous™-Micro Total RNA Isolation Kit	ThermoFisher	Cat#AM1931
iScript cDNA Synthesis Kit	BioRad	Cat#1708890
TaqMan fast advanced master mix	ThermoFisher	Cat#4444556
Tgfbr1 qrtPCR assay (Mm00436965_m1)	ThermoFisher	Cat#4351372
Tgfb1 qrtPCR assay (Mm03024053_m1)	ThermoFisher	Cat#4331182
Roche Universal Probe Library #79	Roche	Cat# UPL71THRU80
Roche Universal Probe Library #108	Roche	Cat# UPL101THRU110
Roche Universal Probe Library #3	Roche	Cat# UPL1THRU10
Software and Algorithms
ImageJ	https://imagej.nih.gov/ij/	https://doi.org/10.1038/nmeth.2089 RRID:SCR_003070
Nikon Element	Nikon	V3.22, RRID: SCR_014329
Stereo Investigator Image Software	MBF Bioscience	V2022.2.1, RRID:SCR_002526
FlowJo X software	SciCrunch Registry	vX10, RRID:SCR_008520
Trim Galore!	Babraham Bioinformatics	v0.4.2, RRID:SCR_011847
Cutadapt	Martin, 2011	v1.9.1, RRID:SCR_011841
STAR	Dobin et al, 2012	RRID:SCR_004463
Sambamba	Tarasov et al. 2015	v0.6.8, https://doi.org/10.1093/bioinformatics/btv098
Subread	Liao et al. 2019	v1.6.2, RRID:SCR_009803
DESeq2	Love et al. 2014	v1.26.0, RRID:SCR_015687
Ggplot2	Wickham 2016	RRID:SCR_014601
GSEA	Subramanian et al. 2015	v3.0, RRID:SCR_003199
Biorender.com	Biorender	RRID:SCR_018361
Other
Microscope	Leica	DM5000B
Confocal Microscope	Leica	Stellaris 8
FACS	BD Biosciences	BD/FACSAria II
Flow Cytometry	BD Biosciences	BD Canto II

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Animals:

The University of Cincinnati (UC) Animal Care and Use Program (ACUP) encompasses Laboratory Animal Medical Services (LAMS, animal facilities) and the Institutional Animal Care and Use Committee (IACUC) office. All animal protocols were approved by the IACUC. Mice were housed in the animal facility of University of Cincinnati on a 14-h light/10-h dark diurnal cycle. Food and water were provided ad libitum. The Cre-loxP recombination system was utilized to achieve cell-type specific constitutive or inducible knockout of Tgfb1 gene. Cx3cr ^CreER(Jung) (JAX: 020940²⁷), Cx3cr1^{CreER(Littman)} (JAX: 021160²⁴) P2ry12^CreER (JAX: 034727³⁷), Tmem119^CreER (JAX: 031820³⁶), Mgfap^Cre (JAX:024098³³), Aldh1l1^CreER (JAX:029655³²), and Camk2^CreER (JAX:012362³⁵) transgenic mouse lines in which the expression of Cre recombinase are under the control of the Cx3cr1 (myloid cell), P2ry12 (Microglia), Tmem119 (Microglia and peri-vesicular fibroblast), mouse Gfap (astrocytes and adult neural stem cells), Aldh1l1 (astrocytes), and Camk2 (forebrain excitatory neurons) promoters, respectively were purchased from the Jackson Laboratory. These animals were crossed with mice carrying the floxed Tgfb1 mouse line in which exon 3 of the Tgfb1 gene is flanked by two loxP sites (JAX: 065809). Among all the mouse cre driver lines used in this study, the Mgfap^Cre mouse line is the only non-inducible and has previously shown to induce loxP specific gene recombination at perinatal stages in mice which targets a large percentage of astrocytes (>90%) and small percentage of cortical neurons (<1.3%) and some oligodendrocytes (<6% of total reporter positive cells) ³⁴. All the other Cre driver lines have the CreERT2⁶⁰.

Tamoxifen administration:

Tamoxifen (TAM) injections were administered based on mouse body weight (BW). 180 mg/kg of BW was administered via oral gavage for 5 consecutive days for full dose induction. Mice were treated at 6–8 weeks of age with TAM. TAM cocktails were formulated from 100 μl EtOH and 900 μl of sunflower seed oil diluted for 30 mg of TAM powder. For sparse recombination, mice received 3 days of TAM at the dosage of 1:10 (18 mg/kg BW, we noticed that 1:7 dilution also give sparse labeled individual cells and similar results to 1:10. Each lab should test the titration of dilution in their own lab). Sparse TGF-B1 KOs were generated using a 1:7 –1:10 dilution of TAM in the vehicle (EtOH and sunflower seed oil) to achieve the desired dosage. Note that mice that receive the vehicle, diluted dosage (1:7–1:10) or full dosage of TAM should be housed separately to prevent TAM cross contamination between different groups.

Microglia ablation via PLX5622 Administration:

Mice were treated with either PLX5622 diet (AIN-76A Rodent Diet With 1,200 PPM PLX5622, formulated by Research Diets with PLX5622 provided by Plexxikon) or the control diet (AIN-76A Rodent Diet, Research Diets, NJ). Animals had ad libitum access to the diet and water for the entirety of the study. For measuring Tgfb1 mRNA levels after microglia ablation, C57bl6/J wildtype mice were treated with control or PLX5622 diet for 7 days. Brain tissue was harvested and processed for qRT-PCR as described below.

qRT- PCR:

RNA was isolated from cortex using the RNAqueous-Micro Total RNA isolation kit (AM1931, ThermoFisher Scientific). CDNA was then generated using superscript III reverse transcriptase (18080044, ThermoFisher Scientific) or iScript cDNA Synthesis Kit (1708890, BioRad). The cDNA was then used for qRT-PCR using probes for Hmbs1 (hydroxymethylbilane synthase), Hprt1 (hypoxanthine phosphoribosyltransferase 1), Iba1, Tgfb1, Alk5, Tgfbr2, Sall1, Glast, Glt1, and Atp1b2. CDNA levels were quantified using a Roche Light Cycler II 480. Quantification of qRT-PCR values were normalized using the housekeeping gene Hmbs1 CT value, which did not change between groups after manipulation to account for potential variability in cDNA preparations.

ELISA:

For ELISA analysis, tissue was collected after perfusion with phosphate buffer solution and flash frozen in cold isopropyl alcohol. Mouse serum is collected by clotted blood without any anticoagulant for 30 min followed by centrifugation at 1500 g for 10 min at 4°C. Serum is collected from the supernatant and frozen at −80C. The tissue was sectioned with a cryostat to punch 2mm punches of tissue. Tissue was placed in RIPA buffer then homogenized using sonication at 30% amplitude, for 3 second pulses with 2 second pauses. BCA method was used to determine total protein concentration in the samples and Quantikine ELISA Human TGF-β1 kit (R&D Systems, Minneapolis, MN) was used to analyze TGF-β1 ligand levels following the instruction from the manufacturer.

Tissue collection for Flow Cytometry or FACS:

Mice were transcardially perfused with cold 1x HBSS for 2–3 minutes. The brains and spleens were extracted and mechanically dissociated with a scalpel before using the papain dissociation kit (9001-73-4, Worthington Biochemical Corporation). For spleens, following dissociation, red blood cells were lysed using ammonium chloride. For the brains, once dissociated, cells were suspended in a 37% percoll solution and spun at 800g for 20 minutes to remove excess myelin and debris. The cells were collected, washed, resuspended in FACS buffer containing PBS with 1% (v/v) fetal bovine serum and 0.1% (w/v) NaN3 (Sigma), and counted. The number of cell subpopulations in the CNS were determined by multiplying the percentage of lineage marker–positive cells by the total number of mononuclear cells isolated from the brain. Transcriptional and translational inhibitors actinomycin, anisomycin, and typtolide were used to prevent activation of microglia during the preparation of tissues as was previously described by Marsh et al.⁶¹. Inhibitors were added to the dissection solution and the papain enzyme cocktail from the Worthington kit.

Flow Cytometry Analysis of TGF-β1 Expression:

To carry out flow cytometry analysis, the Fc receptors were initially blocked using anti-mouse CD16/32 (0.25 μg; ThermoFisher) for 15 min at 4°C. Cells were then washed with FACS buffer and stained for surface marker for 30 min at 4°C using the specified antibodies. These antibodies included: CD45 (clone 30-F11), CD11b (clone M1/70) and TGF-β1 (clone TW7-16B4) (all from Biolegend). Cells were then washed with PBS and viability staining was performed using the LIVE/DEAD fixable dead cell stain kit (Invitrogen). Following viability staining, cells were washed with PBS and resuspended in FACS buffer for Flow cytometry analysis. Cells were acquired on a BD Canto II and analyzed using FlowJo X software (vX10). As controls, fluorescence minus one (FMOs) were used to place the gates for analysis. For flow cytometry analysis, cells were first gated according to FSC-SSC, then restricted to singles cells and live cells. Myeloid cells were identified as CD45+ CD11b+.

FACS of microglia and astrocytes for qRT-PCR and RNA-seq:

Gating was determined using the yellow fluorescent protein expressed by Cx3cr1^CreER-R26-YFP for microglia collection, and ASCA-2 APC conjugated antibody (130-117-535, Miltenyi Biotec) for astrocytes. Any double positive cells were excluded from the gating to improve the purity of samples.

Bulk RNA-Sequencing:

Non-directional RNA-seq was performed by the Genomics, Epigenomics and Sequencing Core at the University of Cincinnati. To summarize, the quality of total RNA was QC analyzed by Bioanalyzer (Agilent, Santa Clara, CA). About 100 pg total RNA was used as input for cDNA amplification using NEBNext Single Cell/Low Input RNA Library Prep Kit (NEB) under PCR cycle number of 15. After Bioanalyzer QC, 20 ng cDNA was used for library construction under PCR cycle number of 6. After library QC and quantification via Qubit quantification (ThermoFisher, Waltham, MA), individually indexed libraries were proportionally pooled and sequenced using NextSeq 2000 Sequencer (Illumina, San Diego, CA) under the sequencing setting of PE 2×61 bp to generate about 60M reads. Once the sequencing was completed, fastq files were generated via Illumina BaseSpace Sequence Hub.

RNA-sequencing Analysis

RNA-seq reads with adapter sequences or bad quality segments were trimmed using Trim Galore! v0.4.2⁶² and cutadapt v1.9.1⁶³.The trimmed reads were aligned to the reference mouse genome version mm10 with STAR v2.6.1e⁶⁴. Duplicated aligned reads were removed using sambamba v0.6.8⁶⁵.Gene-level expression was assessed by counting features for each gene, as defined in the NCBI’s RefSeq database⁶⁶. Read counting was done using featureCounts v1.6.2 from the Rsubread package⁶⁷. Raw counts were normalized as transcripts per million (TPM).Differential gene expressions between groups of samples were assessed with R package DESeq2 v1.26.0⁶⁸. Gene list and log2 fold changes are used for GSEA^69,70 analysis using GO pathway dataset.Plots were generated using the ggplot2⁷¹ package and base graphics in R. The PCA analysis comparing astrocytes from control samples and astrocytes from MG-Tgfb1 iKO mice show one astrocyte sample from iKO mice diverge from other iKO samples and this sample had a lower RNA integrity number (below 8 while all other samples have RIN of >8), suggesting partial RNA degradation. We included this sample in the PCA plot, general DEG heatmap, and volcano plot, however this sample was excluded for characterizing astrocytic activation profile.

Immunohistochemistry:

Mice were perfused with 4% PFA and drop fixed overnight before being transferred to 20% sucrose, followed by 30% sucrose once the tissue had sunk. Then tissue was sectioned on a cryostat in 30 μm thickness prior to implementing IHC. Antibodies for GFP (1:1000, Invitrogen or 1:500, Aves), IBA1 (1:500, Abcam), IBA1 (1:1000, Wako), P2RY12 (1:500, Biolegend), TMEM119 (1:2000, GeneTex), GFAP (1:1000, Sigma), NEUN (1:1000, Biolegend), CD68 (1:4000, BioRad), and pSMAD3 (1:150, Abcam) were used. Tissue was blocked for 1 hour at room temperature (RT) in 4%BSA/0.3% Triton-X100, then incubated overnight at 4C in primary antibody. Tissue was then incubated for 2–3 hours in appropriate secondary antibodies conjugated with Alexa fluorescence 488, 555, 647, or 790.

RNA-Scope:

To fluorescently label RNA, RNA-scope was employed using the ACD RNA-scope Multiplex v.2 kit. Samples for RNA-seq were perfused with cold PB and the brain were dissected out and drop fixed in 4% PFA for 7 hours before transferring to 20% and 30% sucrose. Brains were sectioned on a Leica Cryostat at the thickness of 16um and directly mounted onto Superfrost Plus glass slides. RNAscope hybridization steps were carried out following the instruction from the manufacture. A Tgfb1 probe was used (443571, ACD Biosciencse) to label ligand RNA and an ALK5 probe was used (406201, ACD Biosciences) to label the TGF-β1 type I receptor. Immunohistochemistry was carried out after the RNAscope hybridization as described above to identify different cell types or expressions of different homeostatic microglia markers.

Confocal images were obtained for IHC and RNAscope/IHC samples at the University of Cincinnati Imaging Core utilizing the Leica Stellaris 8 Confocal microscope. 3D reconstruction of the Z-stacks was performed in LAS X software. Imaging was also analyzed using Neurolucida image analysis program (MBF Bioscience) for detailed morphological analysis.

Image analysis:

NIS-Elements was used for microglial morphology quantification. A trace function was utilized for measuring the microglia process length (μm) and a counting function was utilized to quantify the number of terminal ends for each microglial process. Reactive astrocytes were quantified by measuring the area of GFAP immunoreactive astrocytes in the field via thresholding against the background. CD68 quantification was accomplished through the image processing package of ImageJ, Fiji. Z-stacks from confocal imaging were merged into a max projection on the Leica Application Suite X (LASX), and then exported to Fiji. The threshold function was utilized on the fluorescent staining of CD68 against the background, and averages were taken of the mean area. On average 4–6 images from 3–4 brain sections at similar brain regions were analyzed per mouse and the value from multiple images were averaged for each mouse which is used as a single data point in statistical analysis. Neurolucida (MBF Bioscience) was utilized for 3D microglial reconstructions. Microglia cell bodies were constructed by tracing the outer perimeter with the cell body trace function each time a primary microglia process branched out. Then each process was traced with the process tracer function. For pSMAD3 quantification, ImageJ was used to identify IBA1+ and IBA1− nuclei, the nuclei were then traced, and the median fluorescent intensity was measured. Multiple microglia (7–10 microglia) were analyzed from randomly sampled multiple images in individual mice and the average from multiple cells is used as a single data point in statistical analysis.

Behavioral Assays:

Locomotion.

To measure general locomotion function, automated 42 × 42 × 31 cm Plexiglas open box for 23 hours with ad libitum food and water (on the lid) and fresh bedding on the chamber of the floor (Omnitech electronics INC, Columbus, OH) with laser sensors were used to monitor animal behavior. Animals were housed in a dual chamber, allowing for scent exchange but not physical interaction. Lighting was set to mimic that of the animals normal housing rooms, on a 14/10hr light/dark cycle. Data was automatically scored using Fusion (Accuscan, Columbus, OH, USA).

Rotarod.

Using the Roto-rod Series 8 apparatus (IITC Life Science Inc., Woodland Hills, CA) mice were given an acceleration paradigm. The rods rotation started at 1RPM and reached 30RPM by the end of the 5-minute session. The test concluded when the animal fell from the rod but were not returned to the home cage until all animals finished the test. Animals performed 3 trials and were allotted at least 15 minutes in their home cage before starting their next trial. 70% ethanol was used to clean the apparatus in between animals.

Barnes Maze.

Barnes Maze apparatus (Stoelting company, Wood Dale, IL) was designed as a gray circular platform with 91 cm in diameter, 90 cm in height with 20 5cm diameter holes equally distributed around the edge of the platform. Of the 20 holes, 19 had 2cm deep gray trays beneath, with one of the holes having a 5cm deep escape box. A short challenging Barnes maze learning paradigm was used to assess spatial learning and memory. Animals were given 2 training sessions, 4 hours apart, with each training session ending when the animal located and fully entered the escape box. LED lights, a heat lamp and fan were used to motivate escape behavior. The following day (24 hours later) a test session occurred, with the test ending when the animal fully entered the escape box. In-between animals the maze was sanitized using 70% ethanol. Data was automatically scored using AnyMaze (Stoelting company, Wood Dale, IL).

STATISTICAL ANALYSIS

All studies were analyzed using SigmaPlot. Results are expressed by mean±SEM of the indicated number of experiments. Statistical analysis was performed using the Student’s t-test, and one- or two-way analysis of variance (ANOVA), as appropriate, with Tukey post hoc tests. A p-value equal to or less than 0.05 was considered significant.). Graphs were made in GraphPad Prism and some portions of figures were generated with Biorender.com.

Supplementary Material

Supplement 1

Video S1. 3D rendered confocal image stack of coimmunostaining of IBA1 (red) and TMEM119 (white) in sparse MG-Tgfb1 iKO brain showing a single morphologically altered and IBA1+/TMEM119− KO microglia surrounded by normal neighboring microglia (IBA1+/TMEM119+).