Intervertebral disk regeneration in a rat model by allopurinol-loaded chitosan/alginate hydrogel

Linhui Ye; Zengxin Gao; Saeed Rohani

doi:10.17305/bb.2022.8550

. 2023 Aug 1;23(4):661–670. doi: 10.17305/bb.2022.8550

Intervertebral disk regeneration in a rat model by allopurinol-loaded chitosan/alginate hydrogel

Linhui Ye ^1,^#, Zengxin Gao ^1,^2,^#, Saeed Rohani ^3,^*

PMCID: PMC10351085 PMID: 36786280

Abstract

Intervertebral disk degeneration remains one of the most challenging health problems. In the current study, allopurinol was loaded into the chitosan nanoparticles and then incorporated into chitosan/alginate hydrogels and then further studied for its disk regeneration potential in a rat model. In vitro studies were performed to characterize the hydrogel system, including scanning electron microscopy, cell viability assay, cytoprotection assay, cell migration assay, swelling assay, and drug release assay. In vivo study was performed in a rat model of the intervertebral disk injury. Animal studies showed that allopurinol-loaded hydrogels had significantly higher disk regeneration potential compared with other experimental groups. The gene expression studies showed that the animals treated with allopurinol-loaded hydrogel had significantly higher tissue expression levels of type I and type II collagen genes than other groups. Furthermore, the tissue expression levels of nuclear factor κB (NF-κB) and glutathione peroxidase (GPx) genes were significantly lower in this group. The relative expression levels of type I collagen, type II collagen, NF-κB, and GPx genes in the allopurinol-loaded hydrogel group were 2.77 ± 0.2%, 2.86 ± 0.25%, 0.58 ± 0.03%, and 0.45 ± 0.02%, respectively. We showed for the first time that allopurinol-loaded hydrogel promoted intervertebral disk repair, which could be due to its potential to modulate oxidative stress, reduce inflammation, and improve matrix synthesis.

Keywords: Allopurinol, intervertebral disk regeneration, composite hydrogel

Introduction

The lower back pain significantly reduces the patient’s life quality and is considered to be one of the main causes of disability worldwide. Although various factors may be involved, it seems that intervertebral disk injury and its degeneration are strongly associated with the disease [1]. Current treatment modalities focus on alleviating the disease symptoms or slowing down the degeneration process. Despite being beneficial in short term, these treatments fail to restore the disk’s structure. Recently, intervertebral disk tissue engineering has shed a new light on impenetrable intervertebral disks [2, 3]. This technology tries to build tissue-engineered intervertebral disks in vitro by combinations of cells, biomaterials, and signaling cues. In this endeavor, scaffold fabrication methods play a crucial role by building biomimetic scaffolds for biological activities of the cell [4]. Indeed, the replacement of damaged nucleus pulposus by injectable hydrogel systems is gaining momentum in the intervertebral disk regeneration strategies. These scaffolds are highly similar to the nucleus pulposus extracellular matrix (ECM) and can be engineered to exhibit its similar biological features as well [5, 6]. In this context, material selection has a profound effect on the healing function of the developed hydrogel. Cells–material interactions may affect their signaling systems and ultimately result in different therapeutic outcomes.

Among various scaffolding biomaterials, hydrogels produced from chitosan and alginate have shown a promising therapeutic activity in various disease models [7]. Due to their opposite charge, these two polymers form a stable hydrogel in a process known as polyelectrolyte complexation. Furthermore, hydrogels produced from these two polymers have a high water content, an excellent biocompatibility, tailorable mechanical properties, and drug delivery potential [8]. However, the complex pathophysiology of intervertebral disk degeneration requires a versatile approach for slowing down the tissue degeneration and promoting the regeneration process [9]. Recently, the incorporation of drug delivery systems in the matrix of tissue-engineered constructs has been proposed to improve their bioactivity. In this framework, antioxidant reagents have been widely explored to modulate oxidative stress at the tissue injury site [10].

Allopurinol is an antioxidative drug that is primarily used to decrease uric acid levels. In addition, its anti-oxidative potential has been shown in previous studies [11]. In this regard, Durán Fernández-Feijóo et al. showed that allopurinol’s administration reduced oxidative stress and mitigated tissue injury in a rat model of hypoxic-ischemic encephalopathy [12]. Varrica et al. loaded allopurinol into lipid nanoparticles and used them to treat skin wounds. They showed that allopurinol-loaded nanocarriers were not toxic against HaCaT cells and significantly promoted wound closure compared with the control animals [13]. In addition, Gois et al. [14] showed that allopurinol prevented rhabdomyolysis-associated acute kidney injury through the modulation of oxidative stress. This drug can be incorporated into the matrix of chitosan/alginate hydrogel by blending with the polymeric solution. However, this method of drug loading may lead to a burst drug release and reduced bioavailability [15]. Conversely, composite hydrogel systems produced from drug-loaded nanoparticles and a hydrogel matrix provide a better control over drug release. In this regard, chitosan nanoparticles (CHNPs) have gained significant attention in pharmacology and tissue engineering applications [16]. These drug carriers are biocompatible, biodegradable and have a high encapsulation efficacy [17].

Based on these principles, the authors dispersed allopurinol-incorporated CHNPs (ALCHNPs) into the matrix of chitosan/alginate hydrogel to treat a rat model of intervertebral disk injury. This is the first study investigating the healing function of allopurinol-incorporated hydrogels in the intervertebral disk injury.

Materials and methods

Preparation of ALCHNPs and encapsulation efficacy measurement

Chitosan (80%–85% deacetylation degree, Sigma Aldrich, USA) was dissolved in 0.3 % acetic acid (Glacial, Sigma Aldrich, USA) at 0.6 wt. % concentration at room temperature for 18 h. Then, allopurinol powder (≥ 99% HPLC, Selleckchem, USA) was added to the chitosan’s solution at 10 % w/w and further stirred for 6 h. Tripolyphosphate (Sigma Aldrich, USA) was dissolved in distilled water at 0.3 wt. % for 4 h. Then, tripolyphosphate’s solution was added to chitosan’s solution at 1:3 volume ratios under a strong agitation. The resulting solution was then centrifuged at 15,000 rpm for 45 min. The pellet was harvested and the allopurinol concentration in the supernatant was measured using a spectrophotometer at λ max 338 nm. Encapsulation efficacy was measured using the following equation.

Encapsulation efficacy (%) ═ (1 Inline graphic ) × 100

The pellet was harvested and lyophilized for 48 h. The produced powder was kept at 4 ^∘C until use.

Preparation of chitosan/alginate hydrogel, chitosan/alginate/ALCHNPs, and chitosan/alginate/CHNPs

Chitosan was dissolved in a 1% v/v acetic acid solution in distilled water containing 40 w/w % glycerol (Sigma Aldrich, USA) in a final concentration of 2 wt. % for 24 h. Then, the pH of the solution was adjusted to 7.0 by the drop-wise addition of 1 wt.% NaOH solution (Sigma Aldrich, USA). Sodium alginate (medium viscosity, Sigma Aldrich, USA) was dissolved in distilled water containing 40 w/w % glycerol at 1.5 wt. % for 12 h. Then, chitosan and sodium alginate solutions were mixed at 1:1 volume ratio and mixed for 6 h at room temperature. Finally, CHNPs or ALCHNPs were dispersed in the hydrogels at 15% w/w. The resulting composite hydrogel was lyophilized for 48 h for in vitro characterization.

Scanning electron microscopy imaging

The microstructure of CHNPs, ALCHNPs, chitosan/alginate hydrogel, chitosan/alginate/ALCHNPs, and chitosan/alginate/CHNPs was evaluated after coating them with gold for 250 s. Scanning electron microscopy (SEM) imaging was performed under accelerating voltage of 26 kV.

Release test

Release of allopurinol from chitosan/alginate/ALCHNPs was measured. Briefly, 100 mg of lyophilized chitosan/alginate/ALCHNPs hydrogels was immersed in 15 mL phosphate buffer saline (PBS) and kept at 37 ^∘C for 144 h. At predetermined time points, release medium (0.5 mL) was taken, and its allopurinol content was measured by fitting the optical density values of the taken sample at λ max 338 nm into the standard curve of allopurinol in PBS. The same volume of fresh PBS was replenished after taking the test medium.

Swelling assay

The swelling behavior of chitosan/alginate hydrogel, chitosan/alginate/ALCHNPs, and chitosan/alginate/CHNPs was studied as described before [18]. Briefly, 100 mg (M0) of each lyophilized hydrogel was immersed in 15 mL of normal saline solution. At different time points, the hydrogels were removed and immediately weighted (M1). The swelling behavior of scaffolds was calculated using the following equation:

Swelling (%) ═ ( Inline graphic ) × 100

Cell viability assay

Human dermal fibroblast cells were seeded onto the lyophilized chitosan/alginate, chitosan/alginate/ALCHNPs, and chitosan/alginate/CHNPs hydrogels at the density of 7000 cells per scaffold in a 96 well-plate and cultured with high glucose Dulbecco's Modified Eagle Medium (DMEM; Invitrogen, USA), 10% v/v fetal bovine serum (FBS; Invitrogen, USA), and 1% v/v antibiotics (Sigma Aldrich, USA) for 5 days. Cell viability assay was performed on days 1, 3, and 5 using an MTT assay kit (Abcam, USA). Cells in the empty plates served as the control group.

Cell viability assay under oxidative stress

Human dermal fibroblast cells were seeded onto the lyophilized chitosan/alginate, chitosan/alginate/ALCHNPs, and chitosan/alginate/CHNPs hydrogels at the density of 7000 cells per scaffold in a 96 well-plate and cultured for 48 h. Then, 1% v/v H₂O₂ was added onto each well and incubated for 1 h. Finally, the cell viability assay was performed using an MTT assay kit (Abcam, USA). Cells without H₂O₂ and hydrogels served as the negative and positive control groups, respectively.

Cell migration assay

Lyophilized chitosan/alginate, chitosan/alginate/ALCHNPs, and chitosan/alginate/CHNPs hydrogels were immersed in a high glucose DMEM for 5 days at 37 ^∘C under gentle shaking. Then, the culture media was filtered. Human dermal fibroblast cells were seeded in a 24-well plate and cultured to reach 80% confluence. Then, a linear wound was made at the middle of the cellular monolayer using a 200 µL pipette tip. The cellular debris was removed by washing them with PBS. Then, cells were cultured with the hydrogels’ extract for 48 h. The wound size area was investigated for reduction using a light microscope and image analysis software.

In vitro anti-inflammatory assay

The anti-inflammatory activity of the developed hydrogels was evaluated by their effects on interleukin 6 (IL-6) release from macrophage cells. Briefly, J774A1 cells (murine macrophage cell line) were seeded onto the lyophilized chitosan/alginate, chitosan/alginate/ALCHNPs, and chitosan/alginate/CHNPs hydrogels and cultured for 24 h. Then, each well was supplemented with 1 µg/mL lipopolysaccharide (Sigma Aldrich, USA) and incubated for another 12 h. Finally, IL-6, IL-1β, and tumor necrosis factor alpha (TNF-α) concentrations in each well were measured using an ELISA KIT (Sigma Aldrich, USA).

Animal studies

Male Wistar rats (200–220 g, 10–12 weeks old) were used to induce intervertebral disk injury model. Animals were anesthetized by the intraperitoneal injection of ketamine and xylazine. A linear incision was made at the ventral plane of the animals’ tail using a surgical blade and C5-C6 caudal disk was exposed. Then, the intervertebral disk at this level was punctured to a depth of 3–5 mm using a 27 G needle and a slight negative pressure was applied to damage nucleus pulposus. The skin incision was then closed and animals were left to recover for two weeks. Animals were then re-anesthetized and divided into four groups (three animals in each group): 1) negative control group in which animals were treated with an injection of 2 µL PBS; 2) chitosan/alginate hydrogel group in which animals were treated with injection of 2 µL chitosan/alginate hydrogel; 3) chitosan/alginate hydrogel/CHNPs in which animals were treated with injection of 2 µL chitosan/alginate/CHNPs hydrogel; 4) chitosan/alginate hydrogel/ALCHNPs in which animals were treated with injection of 2 µL chitosan/alginate/ALCHNPs hydrogel. Eight weeks after the hydrogels injection, animals were sacrificed and the target intervertebral disks were harvested for histopathological examinations.

Real-time PCR assay

Eight weeks after surgery, the animals were sacrificed and their intervertebral disks were harvested for the analysis of their tissue expression levels of type I collagen, type II collagen, nuclear factor kappa-B (NF-κB), and glutathione peroxidase (GPx) genes. After harvesting the intervertebral disk tissues, the RNA of the tissue samples was isolated using an RNA isolation kit (Thermofisher, USA). Then, cDNA strands were produced by a reverse transcription kit (Thermofisher, USA). Gene amplification of target genes was done by loading 3 µL of the cDNA samples into 17 µL of reaction master mix containing power cyber green (Thermofisher, USA). Finally, relative gene expression was calculated using 2 ^{— ΔΔct} method. Table 1 shows the primer sets for this experiment.

Table 1.

Primer sets for the real time PCR assay

Gene	Forward sequence (5′-3′)	Reverse sequence (5′-3′)
Type I collagen	CCTCAGGGTATTGCTGGACAAC	CAGAAGGACCTTGTTTGCCAGG
Type II collagen	TGGTCTGCAAGGAATGCCTGGA	TCTTTCCCTGGGACACCATCAG
NF-κB	TACCATGCTGTTTGGTTCA	TCAAGCTACCAATGACTTTC
GPx	AGTTCGGACATCAGGAGAATGGCA	TCACCATTCACCTCGCACTTCTCA
GAPDH	GGGAAACTGTGGCGTGAT	AAAGGTGGAGGAGTGGGT

Open in a new tab

NF-κB: Nuclear factor κB; GPx: Glutathione peroxidase.

2.12a Ethical statement

The animal studies were performed in accordance with the U.K. Animals (Scientific Procedures) Act, 1986 and associated guidelines, EU Directive 2010/63/EU for animal experiments.

Statistical analysis

Data were analyzed by GraphPad prism statistical analysis software using Student’s t-test and one-way analysis of variance (ANOVA).

Results

Microstructure studies

The SEM images (Figure 1) showed that ALCHNPs and CHNPs were round with a wide size distribution. Some of the particles were round and some of them were agglomerated. Particle size measurement using the ImageJ software showed that CHNPs and ALCHNPs had mean particle size of round 391.78 ± 104.59 nm and 437.10 ± 104.69 nm, respectively. Lyophilized chitosan/alginate, chitosan/alginate/ALCHNPs, and chitosan/alginate/CHNPs hydrogels (Figure 2) had a porous structure with the irregular shape of the pores. Furthermore, the size of the pores was not consistent among groups. The pore size measured in this research may not allow for cellular ingrowth. However, the hydrogels’ pore size and morphology are different from their lyophilized form.

Figure 2. — **Representative SEM images of lyophilized (A) chitosan/alginate, (B) chitosan/alginate/ALCHNPs, and (C) chitosan/alginate/CHNPs hydrogels.** SEM: Scanning electron microscopy; CHNPs: Chitosan nanoparticles; ALCHNPS: Allopurinol-incorporated CHNPs.

Release profile and encapsulation efficacy

Encapsulation efficacy measurement showed that encapsulation efficacy of allopurinol into ALCHNPs was about 46.99 ± 6.66%. Release test (Figure 3) showed that allopurinol was released from chitosan/alginate/ALCHNPs hydrogels in a sustained manner. At the initial hours, there was a fast release phase which was followed by a gradual increase in the rate of drug release.