Thrombospondin-2 Couples Pressure-Promoted Chondrogenesis through NF-κB Signaling

Abstract

BACKGROUND:

Our previous studies found that the mechanical stimulation promote chondrogenic differentiation of bone marrow mesenchymal stem cells (BMSCs), along with up-regulation of thrombospondin-2 (TSP-2). The aim of this study was to explore the effect of thrombospondin-2 (TSP-2) on the mechanical pressure-stimulated chondrogenic differentiation of BMSCs and the possible role of NF-κB signaling in the mechano-chemical coupling regulation toward chondrogenesis.

METHODS:

Rat BMSCs were isolated, cultured and identified. The time-dependent expressions of TSP-2 and Sox9 in BMSCs under a dynamic mechanical pressure of 0–120 kPa at 0.1 Hz for 1 h were tested by qPCR and Western blotting. The role of TSP-2 in chondrogenic differentiation of BMSCs under mechanical pressure was validated by using small interfering RNA. The impact of TSP-2 and mechanical pressure on chondrogenesis were detected and the downstream signaling molecules were explored using Western blotting.

RESULTS:

Mechanical pressure stimulation of 0–120 kPa for 1 h significantly upregulated the expression of TSP-2 in BMSCs. The expression of the chondrogenesis markers Sox9, Aggrecan, and Col-II were all upregulated under dynamic mechanical pressure or TSP-2 stimulation. Additional exogenous TSP-2 may potentiate the chondrogenic effect of mechanical stimulation. After knock down TSP-2, the upregulation of Sox9, Aggrecan and Col-II under mechanical pressure was inhibited. The NF-κB signaling pathway responded to both dynamic pressure and TSP-2 stimulation, and the cartilage-promoting effect was blocked by an NF-κB signaling inhibitor.

CONCLUSION:

TSP-2 plays an essential role in the chondrogenic differentiation of BMSCs under mechanical pressure. NF-κB signaling is involved in the mechano-chemical coupling of TSP-2 and mechanical pressure for the chondrogenic differentiation of BMSCs.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13770-023-00548-7.

Introduction

Articular cartilage plays a crucial role in reducing friction, resisting contact wear, and buffering stress [1]. Defects or degenerative diseases of articular cartilage are common clinically and are caused by various factors, such as inflammation, tumors, trauma, and dysplasia. In addition, due to the lack of blood supply and slow cell metabolism of articular cartilage, the spontaneous healing of articular cartilage injury is not always sufficient. Therefore, developing effective methods for repairing articular cartilage defects has always been a clinical challenge [2]. Tissue-engineered cartilage based on stem cells and biomaterials can accelerate the repair of cartilage defects and enables cartilage regeneration [3]. However, it was shown that the matrix of tissue-engineered cartilage generated in a static culture environment has insufficient mechanical properties [3], and when tissue-engineered cartilage is used for articular cartilage regeneration in vivo, the regenerated cartilage often lacks mechanical integrity [3, 4]. Therefore, there must be key external stimulatory signals that play important roles in determining the differentiation fate of stem cells in engineered cartilage tissue. Because the joint itself bears and buffers the mechanical load during functional movement, the regenerated and repaired articular cartilage must inevitably assume the function of this load-bearing structure. In this way, the regenerated cartilage tissue must be in a specific mechanical microenvironment. Therefore, the addition of mechanical stimulation serves as an essential factor in the construction of tissue-engineered articular cartilage [5]. Our previous studies have confirmed that the chondrogenic effect of bone marrow mesenchymal stem cells (BMSCs) is enhanced under mechanical pressure [6], but how mechanical pressure acts on cells and the exact mechanisms of how mechanical signals is converted into biochemical signals remain obscure. Previously, we addressed these research topics using stable isotope labeling with amino acids (SILAC) to detect differentially expressed signaling molecules in BMSCs after mechanical stimulation, and found that thrombospondin-2 (TSP-2) was highly expressed in BMSCs stimulated by dynamic pressure, indicating that TSP-2 may serve as a potential mechanosensitive molecule.

TSP-2 is an extracellular matrix glycoprotein widely distributed in tissues of epithelial origin and is a trimeric structure sensitive to Ca²⁺ and held by disulfide bonds [7, 8]. TSP-2 can regulate cell proliferation, adhesion, and apoptosis by binding to cell surface receptors (such as integrins), extracellular matrix (such as decorin and proteoglycan), enzymes (such as matrix metalloproteinases (MMPs)), and calcium ions [9]. We noticed that TSP-2 is revealed being highly expressed in the articular chondrogenic area of fetal and adult mice [10]. The chondrogenic differentiation potential of BMSCs is affected by TSP-2 [11, 12], and TSP-2 and BMSCs have a significant combined effect on cartilage defect repair [13]. More importantly, TSP-2 can participate in the regulation of chondrogenesis through the Wnt/β-catenin, Notch, p38/MAPK, and other mechanical signaling pathways [13]. To better understand the mechanical and biological responses and the signal transduction mechanisms of BMSCs in response to mechnical stumili towards chondrogenic differentiation, stable isotope labeling by amino acids in cell culture (SILAC) was used to screen differentially expressed proteins. It showed that TSP-2 is one of the most significantly upregulated proteins, which indicated that TSP-2 was probably involved in the mechanical stimulation promoted chondrogenesis (see Supplementary Materials, Fig. S1 and S2). All the research evidences suggest that TSP-2 may function in mechanical stimulation in the regulation of chondrogenesis, but it is still unknown whether there is a mechanical coupling effect between TSP-2 and mechanical stimulation through a certain signaling pathway, indicating a need for further research on this topic.

The nuclear factor kappa-B (NF-κB) signaling pathway is an important regulator of cartilage development [12, 14] and plays a vital role in early chondrogenesis by regulating Sox9 [15]. Studies have shown that TSP-2 can regulate tumor metastasis by activating NF-κB signaling [16] and can exerts an antiangiogenic effect through the NF-κB signaling pathway [17]. The above research evidence imply that there is a close relationship between TSP-2 and the NF-κB signaling pathway [18]. In addition, studies have also found that mechanical stimulation can activate the NF-κB signaling pathway in chondrocytes [19, 20]. As such, the present study focused on clarifying the link between mechanical pressure and TSP-2 in the chondrogenesis of BMSCs and whether the NF-κB signalling pathway is the target of mechanical stimulation and TSP-2 coupling to regulate cartilage regeneration. The results are expected to provide new insights into the regulation of articular cartilage regeneration.

Materials and methods

Isolation, culture, and identification of BMSCs

Isolation and culture of BMSCs

SD rats were sacrificed by cervical dislocation. The medium with Dulbecco’s modified Eagle’s medium (DMEM) containing 1% penicillin–streptomycin and 10% fetal bovine serum (FBS) was aspirated using a 1-mL syringe, and the marrow cavity of all tubular bone fragments was repeatedly flushed several times until all the marrow was flushed out. A dropper was used to repeatedly pipette the collected bone marrow rinsing fluid and then transfer it into a 15 mL sterile centrifuge tube; the fluid was repeatedly pipetted until the bone marrow tissue was basically uniformly dispersed. The fluid was put into two culture flasks and placed in a constant temperature incubator with CO₂. For the first medium change, half was replaced, and subsequently, the medium was changed every 2 days. The morphology and growth of the cells were observed under an inverted phase-contrast microscope every day.

Cell growth curve

The growth curve for BMSCs was determined using the Cell Counting Kit-8 (CCK-8) method. BMSCs (P2) were trypsinized, and the cells were resuspended in DMEM and seeded in sterile 96-well plates at 2 × 10³ cells/well. The cells were cultured normally in DMEM, and all medium was replaced at 2-day intervals. A group of cells was taken at the same time every day for the experiment: 20 μL of CCK-8 solution was added to each well, and the 96-well plate was removed after culturing for 3–4 h. Optical density (OD) values at 450 nm were measured and recorded. The experiment took 7 continuous days, and a cell growth curve was generated with the OD value as the ordinate and time as the abscissa.

Identification of stem cell surface markers

The BMSCs (P2) from SD rats were trypsinized. Five milliliters of PBS solution was added to the cells, which were then centrifuged at 300g for 5 min, washed 3 times, resuspended in MEM, and aliquoted into Eppendorf tubes at 1 × 10⁶/mL (100 μL per tube). Phycoerythrin (PE)-labeled CD34 antibody (1:100, 202523, Biolegend, USA), CD45 antibody (1:100, 128609, Biolegend, USA), CD90 antibody (1:100, 202207, Biolegend, USA), and CD105 antibody (1:100, 120407, Biolegend, USA) were added separately. Each sample was mixed evenly, allowed to stand for 1 h at room temperature in the dark, and washed 3 times with PBS. Then, the cells were resuspended in 500 μL of PBS containing 3% FBS. The resuspended cells were transferred to flow cytometry tubes, and the expression of cell surface markers was detected by flow cytometry (Beckman Coulter FC500, USA).

Induction of the Osteogenic and adipogenic differentiation of BMSCs

The rat BMSCs to be induced for osteogenic differentiation were seeded (2 × 10⁴ cells/cm²) in 6-well plates containing 0.1% gelatin, and 2 mL of normal complete medium was added to each well. The cells were cultured in an incubator at 37 °C in 5% CO₂ and saturated humidity. When the cells reached a confluence of 70%, 2 mL of OriCell osteogenic differentiation medium (Cyagen, RAXMX-90021, USA) was added to each well to induce the osteogenic differentiation of rat BMSCs. Every 3 days, the medium was replaced with fresh OriCell osteogenic differentiation medium (Cyagen, RAXMX-90021, USA). After 3 weeks of induction, the cells were stained with alizarin red.

The rat BMSCs to be induced for adipogenic differentiation were seeded (2 × 10⁴ cells/cm²) in 6-well plates containing 0.1% gelatin, and 2 mL of normal complete medium was added to each well. The cells were cultured in an incubator at 37 °C in 5% CO₂ and saturated humidity. When the cells reached a confluence of 100%, 2 mL of adipogenic differentiation medium A (1 μM dexamethasone, 10 mM insulin, 0.5 mM 1-methyl-3- isobutylxanthine (IBMX), and 200 μM indomethacin in basal medium)(PUHEBIO, CTCC-Y003, China) was added to each well to induce the adipogenic differentiation of rat BMSCs. After 2 days of induction, adipogenic differentiation medium A was removed from each well, and 2 mL of adipogenic differentiation medium B (adipogenic maintenance culture containing 10 mM insulin)(, PUHEBIO, CTCC-Y003, China) was added to each well. Medium B was replaced with medium A after 1 day. The rat BMSCs were induced continuously for 3 weeks by the alternating use of medium A and medium B and then stained with oil red O (Servicebio, China).

Mechanical pressure loading

Generally, the articular cartilage suffers pressure from frequent joint movement. When cartilage is loaded by compression, the low permeability of the collagen network impedes the flow of interstitial fluids through the collagen network. Therefore, during articular movement, the pressure applied to the articular cartilage was similar to hydrolic pressure on deep tissue. To simulate compressive stress on cultured seed cells or tissue-engineering cartilage construct, a multifunctional hydrolic cellular pressure unit was previously established and reported by us [21]. The unit consists of 3 parts: a cell culture system (pressurized chamber), a loading control system, and a data processing system (see Supplementary Materials, Fig. S3). Based on the previous results, the pressure loading condition of 120 kPa for 1 h was selected as feasible pressure [21]. Furthermore, as the normal joints are in motion rather than at rest, in order to better simulate the normal physiological environment, here we chose dynamic pressure to perform the experiments. After being cultured and identified, BMSCs from SD rats were placed in the multifunctional hydrolic cellular pressure unit for mechanical pressure loading.The parameters were set as follows: mechanical pressure range, 0 to 120 kPa; dynamic pressure accuracy, within ± 5%; temperature, 36 ± 2 °C; and loading frequency, 0.1 Hz. timing, 1 h. The cells were then removed from the pressurized chamber for immediate follow-up testing or transferred to a conventional incubator for continued culture.

siRNA transfection

BMSCs were transfected with 3 target-specific small interfering RNAs (siRNAs) to downregulate the expression of TSP-2. Each siRNA contained a sequence that interfered with the expression of TSP-2. The TSP-2-si-1 sequence is AGUUUGAGAUUGUGUCCAAUUGGACACAAUCUCAAACU, the TSP-2-si-2 sequence is GAGAGAGUGUCUAGCGAUAUAUCGCUAGACACUCUC UC, and the TSP-2-si-3 sequence is GGAAGAAUGUGACUGCAUGCACAGUCACAUU CUUCC (Biomics, USA). Then, following the manufacturer's recommended procedure, cells were seeded into 12-well plates at 1 × 10⁵ cells per well and cultured at 37 °C in 5% CO₂. On the day before transfection, the cells were placed in serum-containing antibiotic-free medium to achieve 30–50% confluency at the time of transfection. The siRNAs were transfected into cells using Lipofectamine 2000 (Invitrogen, Waltham, MA, USA). After 6 h, the transfection medium was replaced with DMEM containing 10% FBS, and the cells were then cultured for 48 h for subsequent experiments.

RNA isolation and real-time polymerase chain reaction

Total cellular RNA was isolated from the culture medium using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The transfection efficiency of si-TSP-2 and the expression of the chondrogenic markers aggrecan, Col II and Sox9 in BMSCs without siRNA transfection and after siRNA transfection by applying a mechanical pressure of 0–120 kPa,0.1 Hz for 1 h, were tested by real-time PCR (TaKaRa Bio, Tokyo, Japan), gene expression analysis was performed by ABI Power SYBR Green Gene expression System (Applied Biosystems, Inc, USA) on the QuantStudio5 sequence detection system. mRNA relative expression levels were normalized to GAPDH, and fold changes were calculated using the 2^{−(∆∆Ct)} method (Table 1).

Table 1.

Sequences of primers used in this study

Primer name	Primer sequences
TSP-2	Forward 5′-CGTCACCAAGGCAAAGAG-3′ Reverse 5′-CACCAGAGTAGCCGTAAGC-3′
GAPDH	Forward 5′-GAAGGTGAAGGTCGGAGTC-3′ Reverse 5′-CACCAGAGTAGCCGTAAGC-3′
Sox9	Forward 5′-GGAGGAAGTCGGTGAAGAATGG-3′ Reverse 5′-GGGAGTGGTGGGTGGGGT-3′
Col-II	Forward 5′-GCTCCCAGAACATCACCTACCAC-3′ Reverse 5′-CAGTCTTGCCCCACTTACCG-3′
Aggrecan	Forward 5′-GACAGAACTTTGGTAGAATCCGTAAC-3′ Reverse 5′-ACTTGGGTCCAGAAATCCAGAAT-3′

Western blotting

After washing BMSCs twice with PBS, total protein was extracted using RIPA lysis buffer (Beyotime) supplemented with phenylmethylsulfonyl fluoride (PMSF), a protease and phosphatase inhibitor, and quantified using a BCA protein assay kit (Beyotime, Shanghai, China). Thirty micrograms of protein was added to each well of a Tris–glycine sodium dodecyl sulfate (SDS)-polyacrylamide gel and then transferred to a polyvinylidene difluoride membrane (Millipore, Burlington, MA, USA). The membrane was blocked with 5% nonfat dry milk for 1.5 h and incubated overnight at 4 °C with specific antibodies against GAPDH (1: 1000, #5174, CST, USA), IKKβ (1:1000, #8943, CST, USA), p-IKKα/β (1:1000, Ser176/180, #2697, CST, USA), IκBα (1:1000, #4814, CST, USA), p-IκBα (1:1000, Ser32, #2859, CST, USA), NF-κB (p65) (1:1000, #8242, CST, USA), Sox9 (1:1000, GMPR9, Invitrogen, USA), Col-II (1:1000, Abcam, UK), Aggrecan (1:200, Genetex, China), TSP-2 (1:1000, Abcam, UK), and Histone (1:1000, #9715, CST, USA).

Blots were washed with tris‐buffered saline with Tween 20 (TBST), incubated with the corresponding secondary antibodies (anti-rabbit IgG and anti-mouse IgG; 1:10000, CST, USA) for 2 h at room temperature, and washed 3 times with TBST. The membrane was exposed to a chemiluminescent horseradish peroxidase (HRP) substrate (Zhuangzhi, China) to generate a signal on the membrane, which was detected using a chemiluminescent imaging system (Tanon, China).

Immunofluorescence experiments

Rat BMSCs (P2) were seeded (2 × 10⁴ cells/mL) in a 35-mm glass bottom petri dish and incubated for 1 day in a 37 °C 5% CO₂ incubator. After the BMSCs were washed 3 times with PBS, the BMSCs were fixed with 4% paraformaldehyde (PFA) at room temperature for 20 min and washed 3 times with PBS. The following operations were performed in the dark: the cells were permeabilized with a permeabilization solution for 20 min, washed 3 times with PBS, and blocked with 5% bovine serum albumin (BSA) at room temperature for 1 h; then, 200 μL of 5% BSA-diluted primary antibodies (p65) was added to the petri dish; the petri dish was wrapped in tin foil, and the cells were incubated overnight in a 4 °C freezer. The cells were washed 3 times with PBS; 200 μL of 5% BSA-diluted secondary antibodies was added to the cells, which were then incubated in the dark at 37 °C for 1–2 h. The cells were washed 3 times with PBS; 400 μL of DAPI (5 μg/mL) was added to the cells, which were then incubated at 37 °C for 10 min, washed 3 times with PBS, and examined and photographed under a fluorescence microscope.

Chondrogenic induction

A total of 4 × 10⁵ SD rat BMSCs (P2) were placed in a 15-mL centrifuge tube, centrifuged at 250g at 20 °C for 4 min, and then cultured in chondrogenic induction medium (RAXMX-90041, Cyagen, USA). The cells in the mechanical pressure group were pressurized (0–120 kPa, 0.1 Hz) for 1 h each day. The cells in the TSP-2 group were treated with 200 ng/mL TSP-2. The cells in the mechanical pressure + TSP-2 group were treated with 200 ng/mL TSP-2 and pressurized for 1 h each day, and the medium was changed every 3 days. After 28 days of chondrogenic induction, the induced chondrocyte aggregates were washed once with PBS and then fixed in 4% PFA for 48 h for subsequent Immunohistochemical/histochemical staining.

Immunohistochemical/histochemical staining

The induced chondrocyte aggregates were washed with PBS and soaked in 4% PFA solution for more than 48 h, and the fixed chondrocyte aggregates were decalcified in 10% ethylenediaminetetraacetic acid. After dehydration through an ethanol series, the chondrocyte aggregates were placed in a mold, immersed in paraffin, and allowed to cool, and the embedded paraffin blocks were cut into continuous 5-μm-thick sections on a microtome. Finally, the sections of chondrocyte aggregates were adhered to a glass slide with adhesive and dried in an oven at 35 °C. Immunohistochemical staining (Type II collagen), histochemical staining (Alcian blue and Toluidine blue) were then performed. 

Statistical analysis

The results are presented as the mean ± standard deviation of at least 3 independent experiments. Data were analyzed by one-way analysis of variance (ANOVA) in SPSS 19.0 (SPSS, USA). P values < 0.05 were considered statistically significant.

Results

Isolation and identification of rat BMSCs

BMSCs in the bone marrow cavity of SD rats began to adhere to the dish after 3 days of culture of isolated primary cells and grew radially (Fig. 1A), and the cell confluence exceeded 90% at 10–12 d. The passaged cells were plump and had a higher proliferation rate, and the third passage cells were spindle-shaped and neatly arranged (Fig. 1B). The cell growth showed S-shaped curve from the first day to the seventh day, coming into exponential phase on the third day and platfrom stage on the seventh day (Fig. 1C). The third-passage cells were selected for clonality identification. After 2 weeks of cell culture, the formation of clonal aggregates was visible in crystal violet-stained cells (Fig. 1D). We also used third-passage cells for osteogenic and adipogenic induction and stained them with alizarin red and oil red O after induction. Red mineralized nodules were observed in alizarin red-stained cells (Fig. 1E). Orange lipid droplets were observed in oil red O-stained cells (Fig. 1F). These results suggest that BMSCs have pluripotent differentiation potential. The surface markers of BMSCs were identified by flow cytometry. The CD34, CD45, CD90, and CD105 positivity rates were 0.5%, 0.6%, 99.9%, and 99.9%, respectively, indicating that the cells were BMSCs (Fig. 1G).

Fig. 1.

Isolation culture and identification of BMSCs. A Small colonies gradually fused and grew radially at 3 days in primary culture (bar = 100 μm). B Third-generation cells adhered rapidly and had good expandability (bar = 100 μm). C The growth curve for the third-generation cells. D Clonal clusters of third-generation BMSCs cells stained purple by crystalline violet staining solution (bar = 200 μm). E Red mineralized nodules appear after osteogenic induction of BMSCs (Alizarin red staining) (bar = 200 μm). F BMSCs appear as orange lipid droplets after the induction of lipogenesis (Oil red O staining) (bar = 200 μm). G Flow cytometry of BMSC surface markers; CD105, CD90, CD45 and CD34

The role of TSP-2 in the mechanical pressure-induced chondrogenic differentiation of BMSCs

Generally, articular cartilage is under mechanical pressure during frequent joint movement. To simulate the compressive stress on in vitro cultured BMSCs, a multifunctional hydrostatic cellular mechanical pressure unit previously established and reported by us was employed. On the basis of preliminary results, the following dynamicpressure loading conditions were selected for subsequent experiments: 0–120 kPa, 0.1 Hz for 1 h. Then, the expression of TSP-2 and Sox9 at 0 h, 6 h, 12 h, 24 h, 36 h, and 48 h after pressurization was analyzed. The results showed that the expression of TSP-2 increased with time after 1 h of dynamic pressure loading (Fig. 2A). In addition, the expression of TSP-2 was correlated with the expression of the cartilage differentiation marker Sox9, and the expression of TSP-2 and Sox9 both peaked at 12 h after pressurization (Fig. 2B and C). This result suggests that mechanical pressure and TSP-2 may have a certain relationship in the chondrogenic differentiation of BMSCs; therefore, we also investigated the role of TSP-2 in the mechanical pressure-induced chondrogenic differentiation of BMSCs. After 1 h of pressurization of BMSCs transfected with TSP-2 siRNA, the expression of the chondrogenic markers Sox9, Col-II, and Aggrecan was assessed 36 h later. Western blotting and qPCR results indicated that after the treatment with 3 individual TSP-2 siRNA sequences, the expression of TSP-2 decreased (Fig. 2D–F). The siRNA sequence with the best gene-silencing effect was chosen for subsequent TSP-2 blocking experiments. After transfecting the BMSCs with si-TSP-2, the mechanical pressure no longer caused up-regulation of the chondrogenic differentiation markers Sox9, Col-II, and Aggrecan (Fig. 2G–I). These results indicated that the changes in chondrogenic differentiation indexes under mechanical pressure were closely related to TSP-2.

Fig. 2.

TSP-2 plays a role in the mechanical pressure-induced chondrogenic differentiation of BMSCs. A Western blotting was used to analyze the expression of TSP-2 and Sox9 in BMSCs treated with 0.1 Hz, 0–120 kPa mechanical pressure for 1 h after 0, 6, 12, 24, 36, 48 hs of observation. In cells under mechanical pressure, the expression of TSP-2 and Sox9 increased followed by a decrease, peaking at 12 h. B–C Western blotting bands were quantified using ImageJ software (V1.48). D–F The transfection efficiency examination of TSP-2 siRNA based on RT‐qPCR and western blot analysis assays. G–H Western blotting and RT‐qPCR analysis of the expression of chondrogenic differentiation markers Sox9, Col-II, and Aggrecan in cells under treatment of 0.1 Hz, 0–120 kPa mechanical pressure for 1 h, with and without TSP-2 knockdown. I ImageJ software (V1.48) was used for the quantitative analysis of Western blotting bands. Results are shown as means ± SD from three independent experiments. (*p < 0.05, **p < 0.01 vs control group; #p < 0.05 vs indicated group)

Mechanochemical coupling of mechanical pressure and TSP-2 in the chondrogenic differentiation of BMSCs

Given that previous studies have confirmed that mechanical pressure and TSP-2 promote the chondrogenic differentiation of mesenchymal stem cells to a certain extent and that mechanical pressure can promote the secretion of TSP-2, we think that mechanical pressure and TSP-2 may have a synergistic effect on the chondrogenic differentiation of BMSCs. Therefore, we subjected BMSCs to chondrogenic induction via mechanical pressure alone (mechanical pressure group), TSP-2 alone (TSP-2 group), or mechanical pressure and TSP-2 (mechanical pressure + TSP-2 group) for 28 days and then detected the chondrogenic differentiation of the 3 groups by Western blotting. The results showed that both mechanical pressure and TSP-2 increased the expression of markers of the chondrogenic differentiation of BMSCs, and the expression of markers of the chondrogenic differentiation of BMSCs was most significantly increased under the combined effect of TSP-2 and mechanical pressure (Fig. 3A–D). The results confirm that mechanical stimulation and TSP-2 indeed have a synergistic effect on the regulation of cartilage regeneration.

Fig. 3.

Synergistic effects of TSP-2 and mechanical pressure in the chondrogenic differentiation of BMSCs. A Western blotting results showing the expression of Sox9, Col-II and Aggrecan.protiens B–D ImageJ software (V1.48) was used for the quantitative analysis of Western blotting bands. E Images at different magnifications of type II collagen immunohistochemical staining; alcian blue staining and toluidine blue staining of particles after 28 days of 3-dimensional chondrogenic induction under different treatments (× 10, bar = 100 μm, × 20, bar = 50 μm). F The size of chondrocyte spheres of the different groups were analyzed using ImageJ software (V1.48). G–I The OD values of chondrocyte spheres in the 3 groups under the type II collagen immunohistochemical staining, alizarin blue and toluidine blue staining were quantified using ImageJ software in combination with statistical analysis software. (*p < 0.05, **p < 0.01 vs control group; #p < 0.05 vs indicated group)

BMSCs were induced into chondrocytes for 28 days in vitro. The cartilage clusters in the mechanical pressure and mechanical pressure + TSP-2 groups were significantly different from that of the control. Immunohistochemical staining of type II collagen showed that the optical densityof both mechanical pressure group and TSP-2 group were slightly higher than that of control, but without statistical significance. Whereas, under the synergistic effect of mechanical pressure and TSP-2, the content of type II collagen increased significantly compared with that of the control (P < 0.05). After Alcian blue staining, the cytoplasm of cells in the mechanical pressure group was lighter than that of cells in the TSP-2 group and the mechanical pressure + TSP-2 group, and the cytoplasm of cells in the mechanical pressure + TSP-2 group was stained dark blue. After Toluidine blue staining, the nuclei of each group were clearly stained blue, the cytoplasm was almost unstained, the matrix was light bluish–purple, and chondrocyte lacunae were not stained. The cytoplasm of cells in the mechanical pressure + TSP-2 group was stained dark blue by Toluidine blue (Fig. 3E–I). The result also demonstrated that the mechanical pressure and TSP-2 group contained more extracellular matrix of chondrocytes, indicating a greater capacity for chondrogenesis.

Activation of NF-κB signaling under mechanical pressure and TSP-2

To verify the role of NF-κB in mechanical pressure and TSP-2 promotion of chondrogenesis in BMSCs, Western blotting was used to analyze the expression of the NF-κB signaling cascade molecules IKKβ, p-IKKβ, IKBα, p-IKBα, and NF-κB in the extracted cytoplasmic protein and nuclear protein of BMSCs in the mechanical pressure group, TSP-2 group, and mechanical pressure + TSP-2 group. The mechanical pressure group exhibited evident activation of the NF-κB signaling pathway at 60 min, higher expression of p-IKKβ/IKKβ and p-IKBα/IKBα, and nuclear expression of p65 than the control group (P < 0.05), while the cytoplasmic expression of p65 in the mechanical pressure group was not lower than that in the control group. Therefore, mechanical pressure alone activated the NF-κB signaling pathway and upregulated total p65 expression. Similarly, At 60 min under the action of TSP-2 alone, the expression of p-IKKβ/IKKβ and p-IKBα/IKBα and the nuclear expression of p65 was significantly higher than that in the control group (P < 0.05), and the cytoplasmic expression of p65 was significantly lower than that in the control group (P < 0.05). However, At 30 min under the synergistic effect of mechanical pressure and TSP-2, NF-κB signaling pathway activation had initiated, and the nuclear expression of p65 began to increase(P < 0.05), but the cytoplasmic expression of p65 did not decrease. At 60 min under the synergistic effect of mechanical pressure and TSP-2, the NF-κB signaling pathway was significantly activated, the expression of p-IKBα/IKBα and the nuclear and cytoplasmic expression of p65 were significantly different from those of the mechanical pressure group and TSP-2 group (P < 0.05). In addition, p-IKKβ/IKKβ, p-IKBα/IKBα and nuclear expression of p65 remained significantly different (P < 0.05) from the control for 90 min under the synergistic effect of mechanical pressure and TSP-2 (Fig. 4A–E). These results suggest that both mechanical pressure and TSP-2 activate the NF-κB signaling pathway. To further verify the nuclear translocation of p65, the nuclear translocation of p65 was detected through immunofluorescence at 60 min under the action of mechanical pressure alone, TSP-2 alone, and mechanical pressure combined with TSP-2. The results showed that the nuclear translocation of p65 was significantly stronger in the mechanical pressure + TSP-2 group than the mechanical pressure or TSP-2 group (P < 0.05) (Fig. 4F–G).

Fig. 4.

The NF-κB signaling pathway plays a role in TSP-2 and the mechanical pressure-promoted chondrogenic differentiation of BMSCs. A Western blotting results showed the expression of NF-κB cascade signaling molecules IKKβ, p-IKKβ, IKBα, p-IKBα, and NF-κB (p65) in BMSCs under 0.1 Hz, 0–120 kPa mechanical pressure or/and 200 ng/ml TSP-2 treatment for 30, 60, 90 min. B–E Protein bands were analyzed by ImageJ software(V1.48), and activation of the NF-κB signaling including p-IKKβ/IKKβ, p-IKBα/IKBα, p65/GAPDH, and p65/Histone at 30, 60, c90 min under three different treatments were observed. F Immunofluorescence; the p65 nuclear mass ratio was quantified using ImageJ software in combination with statistical software. G Immunofluorescence staining of P65 nuclear translocations after three differents treatments for 1 h was observed by laser confocal microscopy (bar = 100 μm). H–I Expression of Sox9, Col-II and Aggrecan were detected by western blotting after the addition of the NF-κB signaling pathway inhibitor JSH-23, and the bands were quantified using ImageJ software (V1.48). (*p < 0.05, **p < 0.01 vs control group; #p < 0.05 vs indicated group)

The role of NF-κB signaling in mechanical pressure and TSP-2 coupling toward chondrogenesis

The above results suggest that both mechanical pressure and TSP-2 can activate the NF-κB signaling pathway and can promote the chondrogenic differentiation of BMSCs. Therefore, the NF-κB signaling pathway inhibitor JSH-23 was added to cells under the combined treatment of mechanical pressure and TSP-2 to achieve the transcriptional inhibition of NF-κB signaling by inhibiting the nuclear translocation of NF-κB p65, so as to determine whether the NF-κB signaling pathway is precisely the signaling target of the mechanochemical coupling of mechanical pressure and TSP-2 that promotes the chondrogenic differentiation of BMSCs. After adding the NF-κB signaling pathway inhibitor, the expression of the chondrogenic differentiation markers Sox9, Col-II and Aggrecan in cells in the mechanical pressure and TSP-2 stimulation groups alone or in combination was significantly downregulated (P < 0.05) (Fig. 4H and I). This result indicates that the NF-κB signaling pathway is involved in the chondrogenic differentiation of BMSCs under the action of mechanical pressure and TSP-2 and plays a role in the response to mechanical stimulation of BMSCs.

Discussion

Our study found that mechanical stimulation significantly upregulates the expression of TSP-2 and Sox9 in BMSCs. After adding si-TSP-2, the expression of TSP-2 protein and the chondrogenic markers Sox9, Aggrecan and Col-II decreased under mechanical pressure, indicating that TSP-2 plays a role in the mechanical pressure—induced chondrogenic differentiation of BMSCs. Therefore, we speculated that there may be a synergistic effect between mechanical pressure and TSP-2 and further explored the expression of the chondrogenic markers Sox9, Aggrecan and Col-II under the synergistic effect of mechanical pressure and TSP-2. The chondrogenic differentiation markers were upregulated in all 3 groups, and the chondrogenic markers were most significantly upregulated under the synergistic effect of mechanical pressure and TSP-2, indicating that the addition of exogenous TSP-2 further enhanced the chondrogenic differentiation of BMSCs under mechanical pressure. Finally, we investigated the role of the NF-κB signaling pathway in the chondrogenic differentiation of BMSCs promoted by TSP-2 and mechanical pressure. Mechanical pressure alone, TSP-2 alone, and mechanical pressure and TSP-2 activated the canonical NF-κB signaling pathway, and the synergistic effect of mechanical pressure and TSP-2 resulted in the most significant nuclear translocation of p65. The chondrogenesis-promoting effects in the 3 experimental groups were blocked by NF-κB signaling pathway inhibitors, confirming that the NF-κB signaling pathway is involved in the synergistic process of TSP-2 and mechanical pressure in promoting the chondrogenic differentiation of BMSCs.

Mechanical stimulation plays an important role in cartilage regeneration

Mechanical stimulation plays an indispensable role in tissue-engineered cartilage culture and is an important physical factor regulating chondrocyte growth and development [22, 23]. These signals regulate the growth dynamics of each cell. Under physiological conditions, cells can sense these mechanical signals through different types of molecules, such as structural proteins, ion channels, enzymes, and membrane receptors [24]. Most of the cell mechanics studies can be divided into three categories, depending on the nature of the forces applied: mechanical pressure, tension and shear. The type of force is chosen according to the different stress patterns of tissue cells experienced in vivo. The studies available so far suggested that the compressive loading of MSCs seems to favor the production of a non-fibrous cartilage-like matrix [25]. However, there were currently no uniform standards for in vitro biomechanical conditions due to different biomechanical devices, different target tissues, and different purposes of subsequent studies. Many studies have reported the role of various pressure in cartilage regeneration and repair. For example, 270 kPa hydrostatic pressure at 1 Hz can enhance the expression of Aggrecan [26]. When 0.2 MPa or 0.8 MPa pressure was applied, the expression of the chondrogenic marker genes Sox9, Col-II and Acan were significantly upregulated in BMSCs, and the expression levels of Col- I and Col- X were downregulated in BMSCs [27]. The results of another study showed that fluid shear force can regulate the chondrogenic differentiation of BMSCs [28]. These studies have demonstrated that appropriate pressure can promote the expression of chondrogenic differentiation markers genes and enhance the mechanical properties of cartilage, thereby realizing the functional regeneration of articular cartilage.

A series of our preliminary studies have devoted to the regeneration and repair of temporomandibular joint cartilage by BMSCs. We explored the biomechanical characteristics of temporomandibular jiont by finite element analysis, which showed that the stress in the condylar cartilage was approximately 300 kPa under normal occlusion, the different pressure conditions within this range were applied to the cells. It showed that the dynamic pressure stimulation generally enhanced cell activity. Among all of the subgroups, cell activity of the 0–120 kPa pressure group showed the best ( (see Supplementary Materials, Fig. S4).). Through a series of previous studies and mechanical pressure screening experiments, we selected 0-120 kPa, 0.1 Hz mechanical pressure for the experiment [29-32], and confirmed that a feasible dynamic pressure of 0–120 kPa at 0.1 Hz led to an increase in the expression of the cartilage markers. Therefore, the loading condition for the cells in the present study was set at 0–120 kPa, 0.1 Hz to observe the possible mechano-chemical coupling effect between hydrodynamic pressure and TSP-2.

Synergistic role of TSP-2 and mechanical stimulation-induced chondrogenesis

In an appropriate microenvironment, BMSCs secrete corresponding cytokines to promote the regeneration of articular cartilage [33–35]. As an extracellular matrix glycoprotein, TSP-2 can bind to various cytokines and participate in cell chondrogenic differentiation. The knockdown of TSP-2 can reduce the chondrogenic potential of BMSCs, and this effect can be reversed with the addition of exogenous TSP-2 [10], indicating that TSP-2 plays an important role in the differentiation and metabolism of cartilage structures. Our study confirmed that the expression of TSP-2 was highly correlated with the expression of Sox9 in BMSCs under pressure. After Thbs2 gene knockdown, mechanical pressure could no longer induce the upregulation of Sox9, Col-II or Aggrecan, a finding that is consistent with the conclusion previously drawn by Jeong et al. [11] that TSP-2 affects the chondrogenic differentiation potential of BMSCs. In addition, we also found that the combined effect of mechanical pressure and TSP-2 was more effective in promoting chondrogenesis than mechanical pressure stimulation alone, indicating that dynamic pressure and TSP-2 have a significant synergistic effect on the chondrogenic differentiation of BMSCs, probably because dynamic pressure itself upregulates the expression of TSP-2 and Sox9 in BMSCs, while exogenous TSP-2 further upregulates the expression of the chondrogenic differentiation marker Sox9. The latter, as an early response gene regulating the chondrogenic differentiation of stem cells [36, 37], can further induce the synthesis of type II collagen and proteoglycan. However, further research is needed to determine the signaling pathway through which the synergistic effect of mechanical pressure and TSP-2 exerts.

The role of the NF-κB signaling pathway in the promoting effect of mechanical pressure and TSP-2 on chondrogenic differentiation of BMSCs

The NF-κB transcription factor family regulates a variety of biological functions, such as innate and adaptive immune defenses, cell proliferation and apoptosis, cell migration and invasion [38-42], and inner perichondrium and limb growth under physiological conditions [43-45]. TSP-2 can activate the NF-κB signaling pathway [46]. However, excessive mechanical pressure stimulation can promote the progression of osteoarthritis through the NF-κB signaling pathway [47]. The results of this study confirmed that the synergistic effect of mechanical pressure and TSP-2 can activate IKKβ through IKKβ phosphorylation and that activated IKKβ recognizes and phosphorylates the downstream substrate IκBα. Phosphorylated IκBα releases NF-κB (p65) molecules, which have transcriptional functions, into the nuclei through ubiquitination modification and proteasome-dependent degradation pathways, leading to the increased nuclear expression location of p65; that is, the synergistic effect of mechanical pressure and TSP-2 can activate the canonical NF-κB signaling pathway in BMSCs [48-50]. In addition, in this study, the NF-κB signaling pathway plays an important role in the promoting effects of mechanical stimulation and TSP-2 on the chondrogenic differentiation of BMSCs (Fig. 5). This result is consistent with previous research findings that the activation of NF-κB/p65 is involved in the regulation of Sox9 expression in mesenchymal stem cells by directly binding to the motif in the promoter [51, 52].

Fig. 5.

Signaling pathway diagram for the role of NF-κB signaling in the mechano-chemical coupling of mechanical pressure and TSP-2 toward chondrogenesis of BMSCs

In conclusion, TSP-2 plays an essential role in the chondrogenic differentiation of BMSCs under mechanical pressure, and the addition of exogenous TSP-2 can further enhance the chondrogenic effect. The NF-κB signaling pathway responds to both hydrodynamic pressure and TSP-2 stimulation and is involved in the mechanochemical coupling of TSP-2 and mechanical pressure for the chondrogenic differentiation of BMSCs.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

MZ and YZ conceived and supervised this project. JN, FF, SZ and YZ performed the cell culture and biochemical assays. RS and JL conducted the biomechanical experiments. LZ and HW performed the protein analysis. All authors analyzed the data and wrote the paper.

Declarations

Conflict of interest

The authors declare no conflicts of interest.

Ethical statement

All animal procedures performed in this study were reviewed and approved by the Animal Experimental Ethical Inspection of Fourth Military Medical University (No. 2018023) and were performed in accordance with the guidelines of the International Association for the Study of Pain.