Abstract
The world-famous markets of Marrakech, also known in Arabic as souks, harbor a vast diversity of reptiles that are sold for medicinal/magic/pet purposes or used for snake charming. This unique epidemiological context has never been studied considering the interactions of humans, reptiles, and zoonotic pathogens. Thus, the aim of this study was to identify the parasites and pathogens present in blood and feces associated with handled reptiles in the markets of Marrakech to assess the risk of zoonotic transmission within the reptile-human interface. Privately owned reptiles (n = 118), coming from vendors or snake charmers, were examined and blood and feces sampled. DNA was extracted and molecular screening (cPCR, nPCR, qPCR, dqPCR) was performed aiming to identify potentially zoonotic pathogens (i.e., Anaplasma/Ehrlichia spp., Rickettsia spp., Borrelia burgdorferi sensu lato, Coxiella burnetii, Babesia/Theileria spp., Cryptosporidium spp., Giardia spp., Leishmania spp., Cestoda). Overall, 28.9% (34/118) of reptiles were positive for at least one pathogen. In blood, Anaplasma spp. were detected in four snakes, with two Montpellier snakes positive for Anaplasma phagocytophilum, while Rickettsia spp. were detected in one Mediterranean chameleon and four puff adders. Leishmania tarentolae was molecularly detected in a Mediterranean chameleon and a Montpellier snake. In feces, the cox1 gene generated a myriad of sequences for nematodes, cestodes, fungi and bacteria. Importantly, Proteus vulgaris was identified from a Mediterranean chameleon. Cryptosporidium spp. nPCR yielded a positive sample (i.e., Cryptosporidium sp. apodemus genotype I) from a Moroccan worm lizard, as well as for bacteria such as Pseudomonas aeruginosa in an Egyptian cobra, and Morganella morganii from a puff adder. Results from this study demonstrated the risk of zoonotic transmission of microorganisms and parasites present in blood and feces from reptiles that are brought to the souks in Marrakech, Morocco, to be sold for medicinal purposes or used for snake charming, being in direct and straight contact with humans.
Author summary
The world-famous Marrakech souks (markets) are a unique and scarcely studied context where reptiles are in constant contact with humans and used for traditional medicine or for the ancient craft of snake charming. Hence, we aimed to identify the pathogens present in blood and feces of reptiles kept in the markets of Marrakech to assess the zoonotic risk. Animals from vendors or snake charmers were sampled. DNA was extracted and molecularly screened to identify potentially zoonotic pathogens. Overall, 28.9% of reptiles were positive for at least one pathogen. Importantly, we detected Anaplasma spp. from four snakes, Rickettsia spp. from Mediterranean chameleons and puff adders, and Leishmania tarentolae from snakes and chameleons. On the other hand, zoonotic bacteria such Proteus vulgaris were identified from a Mediterranean chameleon, Pseudomonas aeruginosa from Egyptian cobra, and Morganella morganii from puff adder. Thus, reptiles that are kept in the souks of Marrakech may play a role in the zoonotic transmission of pathogens and parasites, given the constant contact with humans.
Introduction
Souk is an Arabic term which means “the market”, and in North Africa and the Middle East it is an important center, not only of commerce but of tradition, and culture of Arab-Islamic societies [1]. The origin of these important markets is believed to be strictly associated with the evolution and diffusion of the Islamic societies. Nonetheless, archeological documentation of ancient souks is scarce, yet records of souks date back from 3000 B.C. from Anatolian Persia [2]. In Morocco, the souks of Marrakech represent the largest and most famous markets, becoming in recent years not only the heart of Marrakech’s commerce, trade, and art, but also an important touristic hotspot [3]. Marrakech’s old city or medina concentrates the largest number of souks, which are near the enigmatic Jemaa-El-Fna square (also known as Jamâ-El-Fna or Djemaa-El-Fna square; literally: crossroads of the arts). This enigmatic square was founded in the 11th century, and since then, it is a space of great complexity, involving Moroccan traditions, displayed through art, religion, music and gastronomy. Given its souks and its cultural heritage which has given the city the designation of World Heritage Site by UNESCO twice, Marrakech has become one of the most known tourist destinations in Morocco and North Africa [4]. Within Jemaa-El-Fna square, presence of monkeys and snakes is common [3]. Certainly, despite the charm and touristic attractiveness of the Souks, there is the risk of exploitation of wild animals [5,6]. Specifically, regarding reptiles’ presence in the souks of Marrakech, their use is associated to medicinal purposes or snake charming [6,7]. Indeed, the souks within the medina of Marrakech are full of live reptiles, mainly spur-thighed tortoises (Testudo graeca), Mediterranean chameleons (Chamaeleo chamaeleon), and occasionally Bell’s Dabb monitor lizards (Uromastyx acanthinura) and desert lizards (Varanus griseus), that are used with etnoherpetological purposes such as traditional medicine and magic [7]. Likewise, animal anatomical pieces are also commercialized with the same purposes being the desert lizard, Nile crocodile (Crocodylus niloticus), and the African rock python (Python sebae), both species being exotic to Morocco, as well as heads of the Egyptian cobra (Naja haje), present throughout the souks of Marrakech [6]. On the other hand, snake charming is still a prevalent craft in large cities of Morocco, being Marrakech the main center of this activity in the country, with descriptions of its existence since the late 1700s [8]. Snake charming is mainly practiced by a religious brotherhood called Aissawa, which claim to be immune to the snakes’ venom. Commonly used species for snake charming in the Jemaa-El-Fna square are the Egyptian cobra and the puff adder (Bitis arietans), followed by the horned viper (Cerastes cerates) and Moorish viper (Daboia mauritanica). Mildly to non-venomous species are also used such as the Montpellier snake (Malpolon monspessulanus), and to a lesser extent the horseshoe whip snake (Hemorrhois hippocrepis) [8]. Snakes used by charmers are generally captured (from April to October) and brought to the souks of Marrakech from the Atlantic belt of South-Western Morocco, where species of snakes (more than 27 species) thrive [8]. The overall welfare, husbandry and living conditions of animals within the souks are scarce. Animals are kept in crowded cages, with no water and generally surrounded by their own feces [5].
These unhygienic conditions, coupled with the constant handling and proximity to people, are driving factors for zoonotic pathogens’ transmission. Indeed, in this context, humans may be exposed to reptile-borne pathogens and reptile vector-borne diseases (RBVDs), given their proximity, and constant interaction [9,10]. Within the various transmission pathways, environmental contamination or oral-fecal transmitted pathogens have greater possibilities to infect people via reptile handling. Besides Salmonella, many other bacteria and parasites can be transmitted [9,11]. However, there are no studies assessing the prevalence of these pathogens associated with the human-reptile interface. Moreover, other zoonotic pathogens associated to reptiles (e.g., Anaplasma, Borrelia, Rickettsia) are transmitted by vectors (i.e., mosquitoes, ticks, and sand flies) [10]. Previous studies in Moroccan herpetofauna have addressed Salmonella [12], and ticks [13] from tortoises, as well as herpetophilic sand flies’ species and their potential role in the transmission of leishmaniases [14]. In addition, ecological studies have been performed on the prevalence and distribution of hemoparasites, such as Hepatozoon spp. associated to Moroccan reptiles [15,16], or on the prevalence of parasitic fauna of endemic species of reptiles [17]. Conversely, there are no studies addressing the human-reptile-parasite interface in the souks of Marrakech context, or neither on the zoonotic pathogens associated to highly handled animals such as snakes used by charmers.
Thus, the aim of this study was to identify the microorganisms and parasites present in blood and feces from reptiles (i.e., lizards, tortoises, and snakes) kept in the Jemaa-El-Fna square to assess the prevalence of pathogens of zoonotic concern.
Methods
Ethics statement
The study was conducted in accordance with all applicable international, national, and/or institutional guidelines for the care and use of animals. Protocols of reptile sampling were authorized by the Office National de Sècurité Sanitaire des Produits Alimentaires from the Kingdom of Morocco (Approval number 23355ONSSA/DIL/DPIV/2022).
Animal examination and sampling
In October 2022, reptiles kept within the proximities of Jeema-El-Fna square of Marrakech (Fig 1) were examined, morphologically identified to species level using reference keys or checklists [18–20], and sampled after authorization of their owners (i.e., vendors or snake charmers; Fig 1). A blood sample (Fig 2) was obtained from each animal. Blood (~100 μl to 1ml) was drawn from snakes and lizards using the ventral coccygeal vein, whereas tortoises’ blood was drawn from the subcarapacial sinus. Blood was divided in Whatman FTA Cards and 1.5 ml Eppendorf tubes which were later stored at -20 °C. Cloacal swabs were performed from all animals and stored at -20 °C. Blood smears were performed from all animals and then assessed for the presence of hemoparasites [21] using Diff-Quik stain [22]. Smears were rinsed in tap water to remove excess stain and later evaluated using an optical microscope (LEICA DM LB2, Germany).
Fig 1. Map of the Jemaa-El-Fna square, Marrakech, Morocco.
Blue circle represents Marrakech municipality; Yellow circle represents site where snakes used by charmers are displayed, and site where reptiles are sold by vendors is represented by a red circle. Map prepared using QGIS software—Buenos Aires version (link of the XYZ tile: https://tile.openstreetmap.org).
Fig 2. Blood draw from the ventral coccygeal vein of (a) Egyptian cobra (Naja haje) and (b) puff adder (Bitis arietans).
Molecular screening of pathogens
DNA was extracted from individual blood samples (n = 112) and cloacal swabs (n = 102) using a commercial kit (QIAamp DNA Mini Kit, Qiagen, Hilden, Germany), according to the manufacturer’s instructions and analyzed for the detection of different microrganisms and parasites (see below). Details regarding cPCR and qPCR protocols are reported in Table 1. All cPCR products were examined on 2% agarose gel stained with GelRed (VWR International PBI, Milan, Italy) and visualized on a GelLogic 100 gel documentation system (Kodak, New York, USA). Amplicons were then purified and sequenced in both directions using the same primers as for PCRs, by the Big Dye Terminator version 3.1 chemistry in a 3130 Genetic Analyzer (Applied Bio-systems, Foster City, CA, USA). Sequences were edited and analyzed using Geneious software version 9.0 (Biomatters Ltd., Auckland, New Zealand) [23] and compared with those available in the GenBank database by the Basic Local Alignment Search Tool (BLAST; http://blast.ncbi.nlm.nih.gov/Blast.cgi) for species identification. Nested PCRs were performed for Giardia spp. and Cryptosporidium spp. as follows. For Giardia, a nested PCR amplifying partial triosephosphate isomerase (tpi) gene (532 bp) was used, to also detect all known assemblages [24,25]. Another nPCR was used to detect Cryptosporidium spp., targeting a fragment of the 18S rRNA gene [26].
Table 1. Pathogens screened in this study by conventional (c) and quantitative (q) PCR, with target genes, primers, probes nucleotide sequences and fragment length.
Pathogens | Target gene | Primers | Sequence (5′−3′) | Fragment length (bp) | References | |
---|---|---|---|---|---|---|
cPCR | Anaplasma/Ehrlichia spp. | 16S rRNA | EHR-16SD | GGTACCYACAGAAGAAGTCC | 345 | [27] |
EHR-16SR | TAGCACTCATCGTTTACAGC | |||||
Borrelia burgdorferi sensu lato | Flagellin | FLA1 | AGAGCAACTTACAGACGAAATTAAT | 482 | [28] | |
FLA2 | CAAGTCTATTTTGGAAAGCACCTAA | |||||
Rickettsia spp. | gltA | CS-78F | GCAAGTATCGGTGAGGATGTAAT | 401 | [29] | |
CS-323R | GCTTCCTTAAAATTCAATAAATCAGGAT | |||||
Spotted Fever Group Rickettsiae | ompA | Rr190.70F | ATGGCGAATATTTCTCCAAAA | 632 | [30] | |
Rr190.701R | GTTCCGTTAATGGCAGCATCT | |||||
Babesia/Theileria spp. | 18S rRNA | RLB-F | GAGGTAGTGACAAGAAATAACAATA | 460–520 | [31] | |
RLB-R | TCTTCGATCCCCTAACTTTC | |||||
Coxiella burnetii | IS1111a | Trans-1 | TATGTATCCACCGTAGCCAGT | 687 | [32] | |
Trans- | CCCAACAACACCTCCTTATTC | |||||
Cestodes/Nematodes | cox1 | JB3 | TTTTTTGGGCATCCTGAGGTTTAT | 400 | [33] | |
JB4.5 | TAAAGAAAGAACATAATGAAAATG | |||||
qPCR | Leishmania spp. | kinetoplast | LEISH-1 | AACTTTTCTGGTCCTCCGGGTAG | 120 | [34] |
LEISH-2 | ACCCCCAGTTTCCCGCC | |||||
Probe | 6-FAM-AAAAATGGGTGCAGAAAT-MGB | |||||
Duplex Leishmania | ITS1 | L.i.t. -ITS1-F | GCAGTAAAAAAAAGGCCG | 150 | [35] | |
L.i.t. -ITS1-R | CGGCTCACATAACGTGTCGCG | |||||
Probe L.t. | 6-FAM-CACGCCGCGTATACAAAAACAC-MGB | |||||
Probe L.i. | VIC-TAACGCACCGCCTATACAAAAGCA-MGB | |||||
Giardia duodenalis | SSU | Giardia-80F | GACGGCTCAGGACAACGGTT | 62 | [36] | |
Giardia-127R | TTGCCAGCGGTGTCCG | |||||
Giardia-105 | Fam-5′- CCCGCGGCGGTCCCTGCTAG-3′-Tamra |
Phylogenetic analyses
Rickettsial gltA as well as 16S rRNA sequences from Anaplasma spp. were separately aligned against those closely related species available from GenBank database using the ClustalW application within MEGA7 software [37]. The Akaike Information Criterion (AIC) option in MEGA7 was used to establish the best nucleotide substitution model adapted to each sequence alignment. Tamura-Nei model with a invariant sites (I) [38] was used to generate the gltA and the 16S rRNA trees. A maximum likelihood (ML) phylogenetic inference was used with 2000 bootstrap replicates to generate the phylogenetic tree in MEGA7. Homologous sequences of Rickettsia were used as outgroup to root the trees, including the gltA sequences from Rickettsia belli and Rickettsia canadensis (AB297809), and the 16S sequence of Rickettsia parkeri (NR118776).
Results
Reptile examination and sampling
Overall, 118 reptile specimens were examined and screened represented by two orders [Squamata (Amphisbaenia with one species, Sauria with two species in two families, Ophidia with five species in three families), and Testudines (one species); Table 2. Species of reptiles commercialized in the markets were from Amphisbaenia, Sauria and Testudines (Fig 3). In addition, 68 snake specimens used by charmers were screened represented mainly by Montpellier snakes, followed by puff adders, Egyptian cobras, eastern Montpellier snake, and one individual of horseshoe whip snake (Table 2). Two of the before mentioned species are considered highly venomous (i.e., puff adder, Egyptian cobra), whereas both species of Malpolon are considered mildly venomous rear-fanged (i.e., opisthoglyphous) snakes. Instead, the horseshoe whip snake is a non-venomous aglyphous snake (Fig 4).
Table 2. Species of reptiles (scientific and common names) sampled along with numbers and type of owners.
Owned by | Order (Suborder) | Family | Species (n) | Common name |
---|---|---|---|---|
Vendors n = 50 | Squamata (Sauria) | Chamaeleonidae | Chamaeleo chamaeleon (30) | Mediterranean chameleon |
Scincidae | Eumeces algeriensis (1) | Algerian skink | ||
Squamata (Amphisbaenia) | Blanidae | Blanus mettetali (5) | Moroccan worm lizard | |
Testudines (Cryptodira) | Testudinidae | Testudo graeca (14) | Spur-thighed tortoises | |
Charmers n = 68 | Squamata (Serpentes) | Viperidae | Bitis arietans (20) *** | Puff adder |
Colubridae | Hemorrhois hippocrepis (1) * | Horseshoe whip snake | ||
Psammophiidae | Malpolon insignitus (9) ** | Eastern Montpellier snake | ||
Malpolon monspessulanus (28) ** | Montpellier snake | |||
Elapidae | Naja haje (10) *** | Egyptian cobra | ||
Total | 118 |
* Non-venomous
** Mildly venomous
*** Highly venomous
Fig 3. Reptiles commercialized in the souks of Marrakech, a) adult Mediterranean chameleon (Chamaeleo chamaeleo), b) newborn Mediterranean chameleon, c) spur-thighed tortoises (Testudo graeca), d) Egyptian cobra (Naja haje) dried heads.
Fig 4. Snakes used by charmers in the Jemaa-El-Fna square.
a) puff adders, b) charmer handling a puff adder, c) charmer with a Montpellier snake (Malpolon monspessulanus), d) charmer with an Egyptian cobra.
Pathogen detection
Positive blood smear observation yielded the presence of hemogregarines’ gametocytes in 22% of examined individuals (26/118; Fig 5). Gamonts were only observed in the five species of snakes (Table 3). Overall, 28.9% (34/118) of examined reptiles were positive to at least one molecularly identified pathogen, being 9.3% (11/118) animals owned by vendors and 19.5% (23/118) snakes used by charmers. Molecular screening of pathogens in blood rendered positive results for Anaplasma/Ehrlichia spp., Rickettsia spp. (gltA), Babesia/Theileria spp., and Leishmania spp. (ITS) (Table 3), whereas all samples were negative for Borrelia burgdorferi sensu lato, Spotted Fever Group Rickettsiae or Coxiella burnetii. Specifically, four snakes (3.4%) were positive for Anaplasma spp., with two Montpellier snakes positive to Anaplasma phagocytophilum (i.e., 99.7% nucleotide identity with MT126499) of horses from Turkey. All generated sequences of Anaplasma sp. clustered within the species of Anaplasma (A. phagocytophilum, Anaplasma platys, Anaplasma odocoilei) with high bootstraps values (i.e., 87%) (Fig 6A). On the other hand, 16S rRNA target gene also amplified in a puff adder for the endosymbiont Candidatus Midichloria mitochondrii (100.00% nucleotide identity with EU780455 of Cimex lectularius). In addition, 4.2% of reptiles (5/118; four puff adders and one Mediterranean chameleon) were positive for Rickettsia spp. The four puff adders were positive to Rickettsia asiatica (97.7% homology with AP019563), and the Mediterranean chameleon to Candidatus Rickettsia asembonensis (100% nucleotide identity with MK923743 of Ctenocephalides canis). Phylogenetic inference clustered four sequences of Rickettsia sp. from puff adders with Rickettsia helvetica, whereas Rickettsia sp. sequence from a Mediterranean chameleon clustered with R. asembonensis, Rickettsia felis and Candidatus Rickettsia senegalensis (Fig 6B). Furthermore, despite the high prevalence in blood smears, only three sequences were obtained for Hepatozoon spp. in a Mediterranean chameleon, a Montpellier snake, and a puff adder (99.9% nucleotide identity with KC696565), previously detected in Psammophis schokari snake form North Africa (Table 3). Additionally, the dqPCR detected two animals (1.7%) positive to Leishmania tarentolae i.e., a Mediterranean chameleon (ct 35.31) and a Montpellier snake (ct 34.56).
Fig 5. Gametocytes of hemogregarines in erythrocytes of snakes.
a) gamonts in erythrocytes of puff adder, b) gamonts in erythrocytes of horseshoe whip snake (Hemorrhois hippocrepis), c) gamonts in erythrocytes of Montpellier snake, d) gamonts in erythrocytes of Egyptian cobra. Scale bars 50μm.
Table 3. Vector-Borne pathogens and oral-fecal pathogens detected in reptiles by blood smear or molecular identification.
Species of reptile (infected/total) | Vector-Borne pathogen | Oral-fecal pathogen | |||||
---|---|---|---|---|---|---|---|
Gametocytes present in blood smears | cPCR (16S rRNA) | cPCR (18S rRNA) | cPCR (gltA) | dqPCR (ITS1) | cPCR (cox1) | nPCR (18S rRNA) | |
Chamaeleo chamaeleon (4/30) | (1) KC696565 Hepatozoon sp. (99.8%) | (1) MK923743 Rickettsia asembonensis (100%) | (1) Leishmania tarentolae (ct 35.31) | (1) CP054157 Proteus vulgaris (92%) | |||
Eumeces algeriensis (0/1) | |||||||
Blanus mettetali (1/5) | (1) MH912997 Cryptosporidium sp. apodemus genotype I (92%) | ||||||
Testudo graeca (6/14) | (1) HQ317434 Enterobius vermicularis (89%) (1) MH427272 Syphacia obvelata (86%) (2) KJ939328 Trypanoxyuris atelis (83%) (2) KU285486 Trypanoxyuris multilabiatus (83%) |
||||||
Bitis arietans (18/20) | (10/20) | (1) EU780455 Candidatus Midichloria mitochondrii (100%) | (1) KC696565 Hepatozoon sp. (99.8%) | (4) AP019563 Rickettsia asiatica (97.7%) | (1) KY498478 Neurospora crassa (91.1%) | (1) CP032295 Morganella morganii (98.5%) | |
Hemorrhois hippocrepis (1/1) | (1/1) | (1) MK041546 Anaplasma sp. 98.79% | |||||
Malpolon insignitus (3/9) | (1/9) | (1) KR780799 Penetrocephalus ganapattii (83%) (1) KY498478 Neurospora crassa (92%) |
|||||
Malpolon monspessulanus (23/28) | (13/28) | (1) MW790941 Anaplasma sp. (99.69%) (2) MT126499 Anaplasma phagocytophilum (99.7%) |
(1) KC696565 Hepatozoon sp. (99.8%) | (1) Leishmania tarentolae (ct 34.56) | (1) MH463505 Mesocestoides sp. (83%) (1) MH427272 Syphacia obvelata (84%) (2) KJ939328 Trypanoxyuris atelis (83%) |
(1) CP064828 Morganella morganii (98.5%) | |
Naja haje (3/10) | (1/10) | (1) MK394156 Diutina catenulate (99.8%) (1) CP050335; Pseudomonas aeruginosa (99.5%) |
|||||
Total (59/118) | (26/118) | (5/118) | (3/118) | (5/118) | (2/118) | (14/118) | (5/118) |
Fig 6. Maximum-likelihood phylogenetic trees of (a) 16S rRNA sequences of Anaplasmataceae and of gltA (b) genes of Rickettsia spp. Bootstrap values (>40%) are shown near the nodes.
Rickettsia parkeri (a) Rickettsia belli, Rickettsia canadensis (b) were used as outgroups. Scale bar indicates nucleotide substitution per site. Sequences of this study are in bold.
Conversely, molecular screening of pathogens in feces revealed positive results for a great variety of agents. Particularly, a myriad of sequences were obtained with the cox1 gene, from nematodes and cestodes, to fungi and bacteria. Nematodes were detected in eight (6.7%) spur-thighed tortoises and two (1.7%) Montpellier snakes. Sequences generated were similar (83 to 89%) to Enterobius (HQ317434), Syphacia (MH427272) and Trypanoxyuris (KJ939328) genera. Moreover, cestodes sequences were retrieved from two snakes (eastern Montpellier snake and Montpellier snake) represented by Mesocestoides (MH463505) and Penetrocephalus (KR780799) genera (83% of nucleotide identity). Conversely, Neurospora crassa fungi (KY498478; 92% of nucleotide identity) was detected in two snakes (puff adder and eastern Montpellier snake) and Proteus vulgaris bacteria (CP054157; 92% nucleotide identity) in Mediterranean chameleon.
Lastly, Cryptosporidium spp. 18S rRNA gene nPCR revealed positive samples for Cryptosporidium sp. apodemus genotype I (MH912997; 92% of nucleotide identity) in one Moroccan worm lizard. Also, the nPCR yielded positive results for bacteria such as Pseudomonas aeruginosa (CP050335; 99.5% of nucleotide identity) in one Egyptian cobra, and Morganella morganii (CP032295; CP064828; 98.5% of nucleotide identity) in one puff adder and one Montpellier snake. Additionally, fungi (Diutina catenulate—MK394156; 99.8% of nucleotide identity) were detected in an Egyptian cobra. Representative sequences herein generated were deposited in GenBank (accession numbers OQ633057 to OQ633061 for gltA; OQ630499 to OQ630503 for 16S rRNA; OQ632771 to OQ632773 for 18S rRNA; OQ672452, OQ695490 and OQ695491 for cox1 and 18S rRNA).
Discussion
A wide diversity of microorganisms and parasites were detected from reptiles that are brought to the souks of Jemaa-El-Fna square in Marrakech. Importantly, while some of the identified parasites are specific of reptiles and are non-pathogenic (i.e., Hepatozoon), many of the bacteria, fungi and parasites detected have a zoonotic potential. Data demonstrated the presence of vector-borne (e.g., Anaplasma, Rickettsia, Leishmania), as well as orally transmitted zoonotic pathogens (i.e., Cryptosporidium, Pseudomonas, Morganella and Diutina) associated to reptiles thus representing a risk of infection to vendors and charmers of the souks of Marrakech.
Overall, the 118 reptile specimens examined fairly represent the typical Moroccan herpetofauna associated to the practices of traditional medicine, magic, and snake charming [5]. As observed in previous studies, Mediterranean chameleons and spur-thighed tortoises are heavily commercialized in the markets, being captured in large numbers from the wild [39,40], whereas Moroccan worm lizards are rarely seen in this context [6]. Indeed, previous studies showed that one of the major threats for wild populations of chameleons and tortoises is the non-commercial collection, which seems a common activity in Morocco [40]. In this sense, many day-buyers of the souks purchase chameleons and specially tortoises (i.e., 55% of the Moroccan population has tortoises in their households), to keep as pets [40,41]. Similarly, species of snakes used by charmers were also represented by the common and more attractive species, particularly Egyptian cobras, which are considered the most profitable species given its unique display of warning behavior [7,8]. Moreover, puff adders and species of Malpolon are also widely used, being the Montpellier snake (although mildly venomous) handed to tourists for taking pictures [7]. Considering vendors and snake charmers, the latter represent an understudied work category at risk given the possibility of snakebites, which represents a neglected tropical disease that affects more than 2.7 million people annually, killing up to 138,000 people, as well as leaving more than 400,000 people with disabilities [42]. In Morocco, snakebites are an important public health issue, mainly in the central regions. However, studies show that up to 86% of the snakebites were reported from males in rural areas caused by vipers or colubrid snakes [43–45]. Despite the constant contact with venomous animals, snakebite envenomation in charmers seems to be underreported, most likely given the possibility of charmers losing their livelihood if they report snakebites [8,46]. Moreover, this study represents the first screening for microorganisms and parasites in reptiles that are in constant contact with humans, on many occasions under unsanitary conditions, favoring transmission of zoonotic pathogens [5]. Indeed, molecular screening allowed to identify not only pathogens that can be transmitted by environmental/oral contamination [9], but also those transmitted by vectors [10], and fungi and bacteria that may also be of zoonotic concern, highlighting the importance of performing molecular screening of wild animals in anthropized environments.
Cytological and molecular identification of hemogregarines, most likely Hepatozoon, is in accordance with former studies in the same geographical area of the Mediterranean Basin [47]. Indeed, Hepatozoon infection in North African snakes is common, with results of this study showing higher infection rates (22%) compared to global prevalence of 8% previously reported [47]. However, even if Hepatozoon spp. are considered non-pathogenic, with no zoonotic relevance, further ecological studies are encouraged to better understand the circulation of species of hemogregarines and their transmission routes in reptiles. Conversely, molecular detection of Anaplasma, chiefly A. phagocytophilum, underlines the potential role reptiles, in particular snakes, may have as amplifying reservoirs of the causative agent of granulocytic anaplasmosis [10]. Indeed, in other ecological scenarios (i.e., Northern California, US), snakes were found PCR positive to human-derived A. phagocytophilum [48]. In Morocco, A. phagocytophilum is prevalent in canine, small ruminant, and human populations mainly in the northern regions [49–51], though molecular positivity of Anaplasma in Moroccan colubrid snakes is an unprecedented finding. The fact that these animals were captured from the wild, coupled by the finding of Candidatus Midichloria mitochondrii endosymbiont in a puff adder indicates the exposure to ticks that may vector Anaplasma. In fact, Candidatus Midichloria mitochondrii may be used in vertebrate hosts to assess the exposure to ticks [52]. Furthermore, this is the first molecular identification of Candidatus Midichloria mitochondrii in reptiles. In addition, evidence of tick exposure of wild reptiles is demonstrated by the molecular detection of Rickettsia spp., as previously detected in the Mediterranean basin [53], as well in the Neotropics [54], Africa and Asia [55]. Molecular identification of Rickettsia spp. in blood of vertebrate hosts is an uncommon finding, yet the prevalence of Rickettsia spp. herein reported was higher (4.1%) than in previous studies (i.e., 3.1%), in the northern Mediterranean basin [53]. Thus, further studies are needed to assess the prevalence of pathogenic Rickettsia spp. in ticks associated with reptiles, considering that in Morocco four pathogenic Rickettsia were detected from ticks from domestic animals and the environment [43]. Also, considering that Rickettsia monacensis was detected in Ixodes ricinus from Morocco [56] as well as in Italy from the same species of ticks associated to lizards [53], tick surveys of wild captured reptiles are advocated to assess the risk of vector-borne transmission of pathogenic rickettsiales.
The vector-borne protozoan L. tarentolae was herein identified for the first time in the Mediterranean chameleon and in the Montpellier snake, further suggesting the wide distribution of this reptile-associated Leishmania sp. throughout the Mediterranean Basin. Indeed, previous studies identified L. tarentolae from lizards and geckos [57], and data herein presented suggest that snakes may also be competent hosts. Furthermore, the vector of this Leishmania species, Sergentomyia minuta, has a widespread geographical distribution in Morocco, mainly in the northern and central regions where visceral and cutaneous leishmaniases are endemic [14]. In addition, evidence of anthropophilic feeding behavior of S. minuta [58], as well as the mammal (humans and canines) exposure to L. tarentolae [59,60], coupled with the sympatric occurrence of different species of Leishmania in Morocco (L. infantum, L. major, L. tarentolae, L. tropica) [61], further complicates the epidemiological picture of cutaneous and visceral leishmaniasis in the country. Hence, epidemiological surveys assessing the prevalence of Leishmania in sand flies, mammalian and reptilian hosts are necessary to elucidate the real status and interaction of Leishmania spp. and the possible infections, in previously considered non-permissive hosts and vectors.
On the other hand, molecular screening of fecal swabs performed herein enabled to detect not only targeted parasites (i.e., cestodes, nematodes, protozoa), but also allowed to identify pathogenic bacteria and fungi. Nonetheless, coprological surveys of reptiles are further advocated for a complete morpho-molecular identification of parasites. Indeed, nematode sequences herein generated had low nucleotide identity, which only allowed to identify these parasites to family level (i.e., Oxyuridae) most of them non-pathogenic specific of reptiles, except for Enterobius spp. Importantly, although the sequence of Enterobius vermicularis from a spur-thighed tortoise generated herein had a 92% nucleotide identity with human-derived E. vermicularis from Greece, previous studies identified this human oxyiurid species in the same tortoise species from Algeria [62]. Hence, tortoises, in the souk context, could act as potential source of oxyurid infections for humans, which therefore should be monitored [63]. Moreover, apart from reptile-specific to low-pathogenic cestodes and innocuous fungi, P. vulgaris was identified from a Mediterranean chameleon in the souk. As this species is used for medicinal/magic purposes, or as pets, the presence of potentially pathogenic foodborne P. vulgaris highlights the risk of zoonotic infection [64,65]. The identification of Gram-negative bacteria such as P. vulgaris in reptiles is a common finding in the cloaca, as reptiles are healthy carriers and spreaders of this potentially zoonotic pathogen [65].
Finally, the Cryptosporidium spp. 18S rRNA sequence analysis revealed not only a species of Cryptosporidium from a Moroccan worm lizards kept on a small market stand, but also pathogenic bacteria and fungi. Zoonotic Cryptosporidium species (i.e., C. muris, C. parvum, C. tyzzeri) can be found in snakes that have ingested infected rodents [66]. Ophidians are not infected but they might excrete the ingested oocysts, contaminating the environment. Conversely, the detection of a rodent genotype of Cryptosporidium in an insectivorous reptile such as the Moroccan worm lizard, could indicate true infection or natural exposure in the wild or in the market setting [67]. Another option, would be contamination via insect ingestion, as suggested in pet leopard geckos infected with C. parvum, which has been verified to be mechanically transmitted by flies carrying infectious oocysts [67,68]. However, pathogenicity of Cryptosporidium sp. apodemus genotype I is still unknown [69]. Bacteria and fungi identified with the Cryptosporidium nPCR were all potentially zoonotic, thus posing a particular risk for snake charmers and tourists. For instance, aerobic and facultative species of bacteria such as P. aeruginosa are potentially pathogenic to snakes as well as to humans [70]. Likewise, Morganella morganii is commonly present in snakes cloacal and oral cavity [71]. Thus, snakebites from venomous or non-venomous snakes not only represents a potential life-threatening risk per se, but it also a pathway for secondary bacterial infections. On the other hand, pathogenic yeasts as D. catenulate from a mildly venomous Montpellier snake, is a potential risk to snake charmers and tourists handling this species of snake. This species of fungi, formerly known as Candida catenulata, has been associated to superficial and invasive infections in both humans and animals [72].
Conclusions
Data herein presented highlighted the potential risk of zoonotic infection with parasites, bacteria and fungi associated to reptiles kept, handled, and used in the souks of the Jemaa-El-Fna square in Marrakech, Morocco. Indeed, reptiles sold for medicinal purposes or used for snake charming, thus in direct and constant contact with humans, harbor zoonotic and pathogenic agents such as those belonging to the genera Anaplasma, Rickettsia, Cryptosporidium, Pseudomonas, Morganella and Diutina that may be transmitted through vectors, orally, or even snakebites. Thus, snake charmers that handle these snakes are at risk of contamination. Hence, studies under the One-Health approach are advocated to better understand the prevalence, occurrence, and epidemiological cycle of potentially shared pathogens in this unique context, that is the fascinating souk of Marrakech.
Acknowledgments
Authors would like to thank vendors snake charmers, as well as the local community for supporting and rendering possible this study.
Data Availability
Molecular data generated in this study was deposited in the Genbank database: https://www.ncbi.nlm.nih.gov/genbank/, under the following accession numbers: OQ633057 to OQ633061 for gltA; OQ630499 to OQ630503 for 16S rRNA; OQ632771 to OQ632773 for 18S rRNA; OQ672452, OQ695490 and OQ695491 for cox1 and 18S rRNA.
Funding Statement
D.O. and J.A.M.R. conducted this study under the frame of the program: NextGenerationEU-MUR PNRR Extended Partnership initiative on Emerging Infectious Diseases (Project no. PE00000007, INF-ACT). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Campbell LAD. Fostering of a wild, injured, juvenile by a neighboring group: implications for rehabilitation and release of Barbary macaques confiscated from illegal trade. Primates. 2019;60: 339–345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Lev E. Ethno-diversity within current ethno-pharmacology as part of Israeli traditional medicine—a review. J Ethnobiol Ethnomed. 2006;2: 4. doi: 10.1186/1746-4269-2-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ali T, Marc B, Omar B, Soulaimane K, Larbi S. Exploring destination’s negative e-reputation using aspect-based sentiment analysis approach: case of Marrakech destination on TripAdvisor. Tour Manag Perspect. 2021;40: 100892. [Google Scholar]
- 4.Safaaa L, Housni KE, Bédard F. Authenticity and tourism: what Tripadvisor reviews reveal about authentic travel to Marrakech. Information and communication technologies in tourism. 2017; 595–606. Springer, Cham. [Google Scholar]
- 5.Bergin D, Nijman V. An Assessment of Welfare Conditions in Wildlife Markets across Morocco. J Appl Anim Welf Sci. 2019;22: 279–288. doi: 10.1080/10888705.2018.1492408 [DOI] [PubMed] [Google Scholar]
- 6.Nijman V, Bergin D. Reptiles traded in markets for medicinal purposes in contemporary Morocco. Contrib to Zool. 2017;86: 39–50. [Google Scholar]
- 7.Pleguezuelos JM, Feriche M, Brito JC, Fahd S. Snake charming and the exploitation of snakes in Morocco. Oryx. 2018;52, 374–381. [Google Scholar]
- 8.Tingle JL, Slimani T. Snake charming in Morocco. J. North Afr. Stud. 2017;22: 560–577. [Google Scholar]
- 9.Mendoza-Roldan JA, Modry D, Otranto D. Zoonotic Parasites of Reptiles: A Crawling Threat. Trends Parasitol. 2020;36: 677–687. doi: 10.1016/j.pt.2020.04.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Mendoza-Roldan JA, Mendoza-Roldan MA, Otranto D. Reptile vector-borne diseases of zoonotic concern. Int J Parasitol Parasites Wildl. 2021a;15: 132–142. doi: 10.1016/j.ijppaw.2021.04.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Mitchell MA. Zoonotic diseases associated with reptiles and amphibians: an update. Vet Clin North Am Exot Anim Pract. 2011;14: 439–56. doi: 10.1016/j.cvex.2011.05.005 [DOI] [PubMed] [Google Scholar]
- 12.Hidalgo-Vila J, Díaz-Paniagua C, Ruiz X, Portheault A, El Mouden H, Slimani T, et al. Salmonella species in free-living spur-thighed tortoises (Testudo graeca) in central western Morocco. Vet Rec. 2008;162: 218–9. [DOI] [PubMed] [Google Scholar]
- 13.Laghzaoui EM, Bouazza A, Abbad A, El Mouden EH. Cross-sectional study of ticks in the vulnerable free-living spur-thighed tortoise Testudo graeca (Testudines: Testudinidae) from Morocco. Int. J. Acarol. 2022;48: 76–83. [Google Scholar]
- 14.Daoudi MM, Boussaa S, Boumezzough A. Modeling Spatial Distribution of Sergentomyia minuta (Diptera: Psychodidae) and Its Potential Implication in Leishmaniasis Transmission in Morocco. J Arthropod Borne Dis. 2020;14: 17–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Tomé B, Maia JP, Salvi D, Brito JC, Carretero MA, Perera A, et al. Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Syst Parasitol. 2014;87: 249–58. [DOI] [PubMed] [Google Scholar]
- 16.Tomé B, Rato C, Harris DJ, Perera A. High Diversity of Hepatozoon spp. in Geckos of the Genus Tarentola. J Parasitol. 2016;102: 476–80. [DOI] [PubMed] [Google Scholar]
- 17.Er-Rguibi O, Laghzaoui EM, Aglagane A, Kimdil L, Abbad A, El Mouden EH. Determinants of prevalence and co-infestation by ecto- and endoparasites in the Atlas day gecko, Quedenfeldtia trachyblepharus, an endemic species of Morocco. Parasitol Res. 2021;120: 2543–2556. [DOI] [PubMed] [Google Scholar]
- 18.Mediani M, Brito JC, Fahd S. "Atlas of the amphibians and reptiles of northern Morocco: updated distribution and patterns of habitat selection". Basic Appl. Herpetol. 2015;29: 81–107. [Google Scholar]
- 19.Bouazza A, Rihane A. Checklist of amphibians and reptiles of Morocco: A taxonomic update and standard Arabic names. Herpetol. Notes. 2021;14: 1–14. [Google Scholar]
- 20.Uetz P. The Reptile Database: Curating the biodiversity literature without funding. Biodivers. Inf. Sci. Stand. 2021; 246. [Google Scholar]
- 21.Telford SR. Hemoparasites of the Reptilia. CRC Press. 2009. [Google Scholar]
- 22.Skipper R, De Stephano DB. A rapid stain for Campylobacter pylori in gastrointestinal tissue sections using Diff-Quik. J. Histotechnol. 1989;12: 303–304. [Google Scholar]
- 23.Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28: 1647–9. doi: 10.1093/bioinformatics/bts199 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hopkins RM, Meloni BP, Groth DM, Wetherall JD, Reynoldson JA, Thompson RC. Ribosomal RNA sequencing reveals differences between the genotypes of Giardia isolates recovered from humans and dogs living in the same locality. J Parasitol. 1997;83: 44–51. [PubMed] [Google Scholar]
- 25.Sulaiman IM, Fayer R, Bern C, Gilman RH, Trout JM, Schantz PM, et al. Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis. Emerg Infect Dis. 2003;9: 1444–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ryan U, Xiao L, Read C, Zhou L, Lal AA, Pavlasek I. Identification of novel Cryptosporidium genotypes from the Czech Republic. Appl Environ Microbiol. 2003;69: 4302–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Martin AR, Brown GK, Dunstan RH, Roberts TK. Anaplasma platys: an improved PCR for its detection in dogs. Exp Parasitol. 2005;109: 176–80. [DOI] [PubMed] [Google Scholar]
- 28.Wójcik-Fatla A, Szymańska J, Wdowiak L, Buczek A, Dutkiewicz J. Coincidence of three pathogens (Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti) in Ixodes ricinus ticks in the Lublin macroregion. Ann Agric Environ Med. 2009;16: 151–8. [PubMed] [Google Scholar]
- 29.Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, et al. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J Clin Microbiol. 2004;42: 90–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991;173: 1576–89. doi: 10.1128/jb.173.5.1576-1589.1991 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Gubbels JM, de Vos AP, van der Weide M, Viseras J, Schouls LM, de Vries E, et al. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. J Clin Microbiol. 1999;37: 1782–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Berri M, Laroucau K, Rodolakis A. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol. 2000;72: 285–93. [DOI] [PubMed] [Google Scholar]
- 33.Bowles J, Blair D, McManus DP. Genetic variants within the genus Echinococcus identified by mitochondrial DNA sequencing. Mol Biochem Parasitol. 1992;54: 165–73. [DOI] [PubMed] [Google Scholar]
- 34.Francino O, Altet L, Sánchez-Robert E, Rodriguez A, Solano-Gallego L, Alberola J, et al. Advantages of real-time PCR assay for diagnosis and monitoring of canine leishmaniosis. Vet Parasitol. 2006;137: 214–21. doi: 10.1016/j.vetpar.2006.01.011 [DOI] [PubMed] [Google Scholar]
- 35.Latrofa M. Mendoza-Roldan JA, Dantas-Torres F, Otranto D. A duplex real-time PCR assay for the detection and differentiation of Leishmania infantum and Leishmania tarentolae in vectors and potential reservoir hosts. Entomologia generalis. 2021;41: 543–551. [Google Scholar]
- 36.Nazeer JT, El Sayed Khalifa K, von Thien H, El-Sibaei MM, Abdel-Hamid MY, Tawfik RA, et al. Use of multiplex real-time PCR for detection of common diarrhea causing protozoan parasites in Egypt. Parasitol Res. 2013;112: 595–601. doi: 10.1007/s00436-012-3171-8 [DOI] [PubMed] [Google Scholar]
- 37.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 2013;30: 2725–9. doi: 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 1993;10: 512–26. doi: 10.1093/oxfordjournals.molbev.a040023 [DOI] [PubMed] [Google Scholar]
- 39.Morton O, Scheffers BR, Haugaasen T, Edwards DP. Impacts of wildlife trade on terrestrial biodiversity. Nat Ecol Evol. 2021. Apr;5:540–548. doi: 10.1038/s41559-021-01399-y [DOI] [PubMed] [Google Scholar]
- 40.Segura A, Delibes-Mateos M, Acevedo P. Implications for Conservation of Collection of Mediterranean Spur-Thighed Tortoise as Pets in Morocco: Residents’ Perceptions, Habits, and Knowledge. Animals (Basel). 2020;10: 265. doi: 10.3390/ani10020265 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Nijman V, Bergin D. Trade in spur-thighed tortoises Testudo graeca in Morocco: volumes, value and variation between markets. Amphibia-reptilia. 2017b;38: 275–287. [Google Scholar]
- 42.Williams DJ, Faiz MA, Abela-Ridder B, Ainsworth S, Bulfone TC, Nickerson AD, et al. Strategy for a globally coordinated response to a priority neglected tropical disease: Snakebite envenoming. PLoS Negl Trop Dis. 2019;13: e0007059. doi: 10.1371/journal.pntd.0007059 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Arfaoui A, Hmimou R, Ouammi L, Soulaymani A, Mokhtari A, Chafiq F, et al. Epidemiological profile of snakebites in Morocco. J. Venom. Anim. 2009;15: 653–666. [Google Scholar]
- 44.Chafiq F, El Hattimy F, Rhalem N, Chippaux JP, Soulaymani A, Mokhtari A, et al. Snakebites notified to the poison control center of Morocco between 2009 and 2013. J Venom Anim Toxins Incl Trop Dis. 2016;22: 8. doi: 10.1186/s40409-016-0065-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.El Hattimy F, Chafiq F, Hami H, Mokhtari A, Soulaymani A, Rachida SB. Geographical distribution of health indicators related to snake bites and envenomation in Morocco between 1999 and 2013. Epidemiol Health. 2018;40: e2018024. doi: 10.4178/epih.e2018024 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.de Capell Brooke A. Sketches in Spain and Morocco. H. Colburn and R. Bentley; 1831. [Google Scholar]
- 47.Tomé B, Maia JP, Harris DJ. Hepatozoon infection prevalence in four snake genera: influence of diet, prey parasitemia levels, or parasite type? J Parasitol. 2012;98: 913–7. [DOI] [PubMed] [Google Scholar]
- 48.Nieto NC, Foley JE, Bettaso J, Lane RS. Reptile infection with Anaplasma phagocytophilum, the causative agent of granulocytic anaplasmosis. J Parasitol. 2009;95: 1165–70. [DOI] [PubMed] [Google Scholar]
- 49.Elhamiani Khatat S, Sahibi H, Hing M, Alaoui Moustain I, El Amri H, Benajiba M, et al. Human Exposure to Anaplasma phagocytophilum in Two Cities of Northwestern Morocco. PLoS One. 2016;11: e0160880. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Elhamiani Khatat S, Daminet S, Kachani M, Leutenegger CM, Duchateau L, El Amri H, et al. Anaplasma spp. in dogs and owners in north-western Morocco. Parasit Vectors. 2017;10: 202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Ait Lbacha H, Alali S, Zouagui Z, El Mamoun L, Rhalem A, Petit E, et al. High Prevalence of Anaplasma spp. in Small Ruminants in Morocco. Transbound Emerg Dis. 2017;64: 250–263. [DOI] [PubMed] [Google Scholar]
- 52.Sgroi G, Iatta R, Lovreglio P, Stufano A, Laidoudi Y, Mendoza-Roldan JA, et al. Detection of Endosymbiont Candidatus Midichloria mitochondrii and Tickborne Pathogens in Humans Exposed to Tick Bites, Italy. Emerg Infect Dis. 2022;28: 1824–1832. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Mendoza-Roldan JA, Ravindran Santhakumari Manoj R, Latrofa MS, Iatta R, Annoscia G, Lovreglio P, et al. Role of reptiles and associated arthropods in the epidemiology of rickettsioses: A one health paradigm. PLoS Negl Trop Dis. 2021b;15: e0009090. doi: 10.1371/journal.pntd.0009090 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Mendoza-Roldan JA, Ribeiro SR, Castilho-Onofrio V, Marcili A, Simonato BB, Latrofa MS, et al. Molecular detection of vector-borne agents in ectoparasites and reptiles from Brazil. Ticks Tick Borne Dis. 2021c;12: 101585. doi: 10.1016/j.ttbdis.2020.101585 [DOI] [PubMed] [Google Scholar]
- 55.Sánchez-Montes S, Isaak-Delgado AB, Guzmán-Cornejo C, Rendón-Franco E, Muñoz-García CI, Bermúdez S, et al. Rickettsia species in ticks that parasitize amphibians and reptiles: Novel report from Mexico and review of the worldwide record. Ticks Tick Borne Dis. 2019;10: 987–994. [DOI] [PubMed] [Google Scholar]
- 56.Sarih M, Socolovschi C, Boudebouch N, Hassar M, Raoult D, Parola P. Spotted fever group rickettsiae in ticks, Morocco. Emerg Infect Dis. 2008;14: 1067–73. doi: 10.3201/eid1407.070096 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Mendoza-Roldan JA, Latrofa MS, Tarallo VD, Manoj RR, Bezerra-Santos MA, Annoscia G, et al. Leishmania spp. in Squamata reptiles from the Mediterranean basin. Transbound Emerg Dis. 2022;69: 2856–2866. [DOI] [PubMed] [Google Scholar]
- 58.Abbate JM, Maia C, Pereira A, Arfuso F, Gaglio G, Rizzo M, et al. Identification of trypanosomatids and blood feeding preferences of phlebotomine sand fly species common in Sicily, Southern Italy. PLoS One. 2020;15: e0229536. doi: 10.1371/journal.pone.0229536 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Iatta R, Mendoza-Roldan JA, Latrofa MS, Cascio A, Brianti E, Pombi M, et al. Leishmania tarentolae and Leishmania infantum in humans, dogs and cats in the Pelagie archipelago, southern Italy. PLoS Negl Trop Dis. 2021;15: e0009817. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Mendoza-Roldan JA, Latrofa MS, Iatta R, R S Manoj R, Panarese R, Annoscia G, et al. Detection of Leishmania tarentolae in lizards, sand flies and dogs in southern Italy, where Leishmania infantum is endemic: hindrances and opportunities. Parasit Vectors. 2021d;14: 461. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Rhajaoui M, Nasereddin A, Fellah H, Azmi K, Amarir F, Al-Jawabreh A, et al. New clinico-epidemiologic profile of cutaneous leishmaniasis, Morocco. Emerg Infect Dis. 2007;13: 1358–60. doi: 10.3201/eid1309.060946 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Lakehal K, Saidi R, Mimoune N, Benaceur F, Baazizi R, Chaibi R, et al. The study of ectoparasites and mesoparasites in turtles (Testudo graeca graeca) in the region of Laghouat (south of Algeria). Bull Univ Agric Sci Vet Med Cluj Napoca. 2020;77:1. [Google Scholar]
- 63.Shafiei R, Jafarzadeh F, Bozorgomid A, Ichikawa-Seki M, Mirahmadi H, Raeghi S. Molecular and phylogenetic analysis of E. vermicularis in appendectomy specimens from Iran. Infect Genet Evol. 2023;107: 105391. [DOI] [PubMed] [Google Scholar]
- 64.Riedel J, Halm U, Prause C, Vollrath F, Friedrich N, Weidel A, et al. Multilocular hepatic masses due to Enterobius vermicularis. Inn Med (Heidelb). 2023;64: 490–493. [DOI] [PubMed] [Google Scholar]
- 65.Schmidt V, Mock R, Burgkhardt E, Junghanns A, Ortlieb F, Szabo I, et al. Cloacal aerobic bacterial flora and absence of viruses in free-living slow worms (Anguis fragilis), grass snakes (Natrix natrix) and European Adders (Vipera berus) from Germany. Ecohealth. 2014;11: 571–80. [DOI] [PubMed] [Google Scholar]
- 66.Díaz P, Rota S, Marchesi B, López C, Panadero R, Fernández G, et al. Cryptosporidium in pet snakes from Italy: molecular characterization and zoonotic implications. Vet Parasitol. 2013;197: 68–73. [DOI] [PubMed] [Google Scholar]
- 67.Pedraza-Díaz S, Ortega-Mora LM, Carrión BA, Navarro V, Gómez-Bautista M. Molecular characterisation of Cryptosporidium isolates from pet reptiles. Vet Parasitol. 2009. Mar 23;160: 204–10. [DOI] [PubMed] [Google Scholar]
- 68.Conn DB, Weaver J, Tamang L, Graczyk TK. Synanthropic flies as vectors of Cryptosporidium and Giardia among livestock and wildlife in a multispecies agricultural complex. Vector Borne Zoonotic Dis. 2007;7: 643–51. [DOI] [PubMed] [Google Scholar]
- 69.Čondlová Š, Horčičková M, Havrdová N, Sak B, Hlásková L, Perec-Matysiak A, et al. Diversity of Cryptosporidium spp. in Apodemus spp. in Europe. Eur J Protistol. 2019;69: 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Goldstein EJ, Agyare EO, Vagvolgyi AE, Halpern M. Aerobic bacterial oral flora of garter snakes: development of normal flora and pathogenic potential for snakes and humans. J Clin Microbiol. 1981;13: 954–6. doi: 10.1128/jcm.13.5.954-956.1981 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Jorge MT, Ribeiro LA. Infections in the bite site after envenoming by snakes of the Bothrops genus. J. Venom. Anim. 1997;3: 264–272. [Google Scholar]
- 72.O’Brien CE, McCarthy CGP, Walshe AE, Shaw DR, Sumski DA, Krassowski T, et al. Genome analysis of the yeast Diutina catenulata, a member of the Debaryomycetaceae/Metschnikowiaceae (CTG-Ser) clade. PLoS One. 2018;13: e0198957. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Molecular data generated in this study was deposited in the Genbank database: https://www.ncbi.nlm.nih.gov/genbank/, under the following accession numbers: OQ633057 to OQ633061 for gltA; OQ630499 to OQ630503 for 16S rRNA; OQ632771 to OQ632773 for 18S rRNA; OQ672452, OQ695490 and OQ695491 for cox1 and 18S rRNA.