Optimization of infectious bronchitis virus-like particle expression in Nicotiana benthamiana as potential poultry vaccines

Kamogelo M Sepotokele; Martha M O’Kennedy; Daniel B R Wandrag; Celia Abolnik

doi:10.1371/journal.pone.0288970

. 2023 Jul 20;18(7):e0288970. doi: 10.1371/journal.pone.0288970

Optimization of infectious bronchitis virus-like particle expression in Nicotiana benthamiana as potential poultry vaccines

Kamogelo M Sepotokele ^1,^*, Martha M O’Kennedy ^1,², Daniel B R Wandrag ¹, Celia Abolnik ¹

Editor: Haitham Mohamed Amer³

PMCID: PMC10358894 PMID: 37471377

Abstract

Infectious bronchitis (IB) is a highly contagious, acute respiratory disease in chickens, with a severe economic impact on poultry production globally. The rapid emergence of regional variants of this Gammacoronavirus warrants new vaccine approaches that are more humane and rapid to produce than the current embryonated chicken egg-based method used for IB variant vaccine propagation (chemically-inactivated whole viruses). The production of virus-like particles (VLPs) expressing the Spike (S) glycoprotein, the major antigen which induces neutralizing antibodies, has not been achieved in planta up until now. In this study, using the Agrobacterium-mediated Nicotiana benthamiana (tobacco plant) transient expression system, the highest levels of VLPs displaying a modified S protein of a QX-like IB variant were obtained when the native transmembrane (TM) domain and cytoplasmic tail were substituted with that of the Newcastle disease virus (NDV) fusion glycoprotein, co-infiltrated with the NDV Matrix protein. In comparison, the native IB modified S co-infiltrated with IB virus membrane, envelope and nucleocapsid proteins, or substituted with the TM and CT of an H6-subtype influenza A virus hemagglutinin glycoprotein yielded lower VLP expression levels. Strong immunogenicity was confirmed in specific pathogen free chickens immunized intramuscularly with VLPs adjuvanted with Emulsigen^®-P, where birds that received doses of 5 μg or 20 μg (S protein content) seroconverted after two weeks with mean hemaggluttination inhibition titres of 9.1 and 10 log₂, respectively. Plant-produced IB VLP variant vaccines are safer, more rapid and cost effective to produce than VLPs produced in insect cell expression systems or the traditional egg-produced inactivated whole virus oil emulsion vaccines currently in use, with great potential for improved IB disease control in future.

Introduction

Infectious bronchitis (IB) is a highly contagious, acute respiratory disease in chickens that is listed by the World Organization for Animal Health (WOAH) due to its global economic impact, estimated to be only second to that of highly pathogenic avian influenza [1, 2]. The IB virus (IBV) is a member of the Coronaviridae family, and the spherical or pleiomorphic virions, that range in size from 80 to 120 nm in diameter, have club-shaped glycoprotein spikes (S) of 16 to 21 nm projecting from the envelope surface [3–5]. The S glycoprotein is composed of two domains, with S1 (the bulb) facilitating attachment of the virus to the host cell receptor and displaying most of the viral antigenic epitopes that induce neutralising antibodies in the host, and S2 (the stalk) assisting with host cell attachment [5, 6].

Vaccination is commonly used to control IB in poultry, but a high virus mutation rate driven by genetic drift and genomic recombination has given rise to at least 32 global IBV genotypes [3, 7]. Novel variants are constantly emerging with the ability to escape the protection from commercial live attenuated and live recombinant IB vaccines, particularly if these mutations occur in the S1 gene’s hypervariable (HVR) regions [8]. Inactivated whole virus oil emulsion vaccines derived from dominant circulating field strains remain one of the most effective control strategies for variant IBVs [9, 10] as they induce high titres of serum antibody that protects the kidneys, internal tissues and reproductive tract [4, 8]. Their production is however reliant on the isolation of field virus, a seed strain that is free of extraneous agents, adaptation to high growth properties in specific pathogen-free (SPF) chicken eggs by serial passage, and total chemical inactivation, all procedures requiring time (up to a year) and high containment conditions [10, 11].

Virus-like particles (VLPs) are multi-protein nanostructures that imitate native virus particles, but contain no genetic material, rendering them unable to replicate and cause infection, recombine with live viruses or revert to virulence [12, 13]. IBV VLPs can be produced more rapidly than other vaccine types and induce both cellular and humoral immunity [14–16]. Various IBV VLP permutations expressing native or chimeric S proteins were successfully expressed in insect cells using the baculovirus- mediated insect expression system, with immunogenicity or efficacy against live virus challenge demonstrated in the target animals [2, 17–19]. Plant-based platforms in turn offer numerous advantages over insect cells and other protein expression systems in terms of safety, speed, cost, and scalability, and VLPs for several viral families have been produced using the Agrobacterium-mediated Nicotiana benthamiana (tobacco plant) transient expression system [20–25]. No contaminating animal endotoxins or pathogens are produced, and the growth of infectious prions or viruses that infect humans is not supported [26]. The production of plant-produced VLPs can be achieved within two weeks of obtaining the antigenic gene sequence of interest, and scalability depends on the number of tobacco plants infiltrated. Mass agroinfiltration is achieved by vacuum infiltration, and larger volumes of plant material can be purified using methods such as ion exchange, size exclusion, or affinity chromatography, or tangential flow filtration [15, 25, 27].

Most recently, VLPs expressing the full-length S protein of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a Betacoronavirus, were expressed in tobacco plants. VLP formation was achieved by introducing two consecutive proline residues into the loop between the S protein HVR-1 region and the central helix to stabilise the S protein’s prefusion state [28], replacing the native signal sequence with a plant signal sequence, and the transmembrane (TM) domain and cytosolic tail (CT) with the equivalent sequences of an influenza A virus (IAV) H5-subtype hemagglutinin glycoprotein [29]. Although it was also reported that SARS-CoV-2 VLPs bearing the unmodified, native form of S alone or in combination with the envelope (E) and membrane (M) proteins express in N. benthamiana [30], this has not been the case with the Gammacoronavirus IB VLPs [31]. In the present study, we investigated incorporating stabilizing mutations in S and substituting the TM domain and CT from IAV or Newcastle disease virus (NDV), and successfully produced IB VLPs expressing the full-length S protein for the first time, that were shown to be highly immunogenic in the target species.

Methods

Recombinant plasmid design and construction

The S protein gene sequence for QX-like IBV strain ck/ZA/3665/11 (Genbank protein ID AKC34133; Uniprot ID A0A0E3XJ26) was modified by replacing the native signal peptide with a murine signal peptide to enhance expression [32], including a KOZAK sequence (GCCACC) upstream of the S1 domain, and removing the original endoplasmic reticulum (ER) retention signal (S1 Fig). Two consecutive proline residues were introduced at residues 843–844 into the loop between the first heptad repeat (HR1) and the central helix [28]. This construct, retaining the native IBV TM and CT domains, was designated mIBV-S2P (Fig 1(C)). Ultramer primers were designed to substitute the TM domain and CT with that of the IAV H6 subtype hemagglutinin (HA) or the NDV F glycoprotein (LaSota strain). The constructs designated mIBV-S2P-IAV-H6^TM/CT, and mIBV-S2P-NDV-F^TM/CT (Fig 1(C)) were created with the primer pairs in Table 1.

Fig 1 — SDS-PAGE (A) and Western blot (B) of partially-purified plant-produced IBV S protein (Primary antibody–IBV antisera, secondary antibody—Goat-α-Chicken IgY HRP). Lane 1: molecular weight marker; Lane 2: plant-expressed empty pEAQ-HT vector; Lane 3: purified live QX-like IBV strain ck/ZA/3665/11; Lanes 4–7: mIBV-S2P:M:E:N fractions 2 (lanes 4 and 6) and 3 (lanes 5 and 7) extracted in either PBS or bicine as indicated; Lanes 8–11: mIBV-S2P-IAV-H6^TM/CT:M2 fractions 2 (lanes 8 and 10) and 3 (lanes 9 and 11) extracted in either PBS or bicine as indicated; Lanes 12–15: mIBV-S2P-NDV-F^TM/CT:NDV Matrix fractions 2 (lanes 12 and 14) and 3 (lanes 13 and 15) extracted in either PBS or bicine as indicated. (C) Schematic diagrams of recombinant Spike protein constructs mIBV-S2P with native IBV TM and CT, mIBV-S2P-IAV-H6^TM/CT with TM and CT replaced with equivalent sequences of IAV H6 protein, and mIBV-S2P-NDV-F^TM/CT with TM and CT replaced with equivalent sequences of NDV F protein.

Table 1. Primers used for synthetic construct design.

Construct	Name	Sequence (5′– 3′)
mIBV-S2P-IAV-H6^TM/CT	rIBV-S-H6^TM/CT Forward	`TTTACCGGTATGGGCTGGAGCTGG`
mIBV-S2P-IAV-H6^TM/CT	rIBV-S-H6^TM/CT Reverse	`AAACTCGAGTCAGATGCACACTCTGCACTGCATGCTGCCGTTGCTGCACATCCACAGGCCCATAGCAATGATCAGTCCCACCAGCACCAGGCTGCTGCTCACTGTGCTGGTAGATAGCCAGCTTAATGTAGGTTTTCAG`
mIBV-S2P-NDV-F^TM/CT	rIBV-S-H6^TM/CT Forward	`TTTACCGGTATGGGCTGGAGCTGG`
mIBV-S2P-NDV-F^TM/CT	rIBV-S-F^TM/CT Reverse	`AAACTCGAGTCACATCTTTGTTGTGGCTCTCATCTGATCCAGGGTGTTATTGCCCAGCCACAGCAGTGTTTTCTGCTGTGCCTTCTGCTTGTACATCAGGTAGCAGGCCAGGATCAGGCTCAGGATTCCGAACACCAGGGAGATGATTGTCAGCACGATGTAGGTGATCAGCTTAATGTAGGTTTTCAG`

Open in a new tab

Gene sequences encoding the IBV M (Genbank protein ID AKC34136; Uniprot ID A0A0E3TI94), E (Genbank protein ID AKC34135; Uniprot ID A0A0E3TJA4) and N (Genbank protein ID AKC34140) proteins for strain ck/ZA/3665/11 were also chemically synthesised. A gene sequence encoding the Matrix protein of NDV isolate turkey/South Africa/N2057/2013, (Genbank protein ID KR815908) was already available. A plant codon-optimised gene sequence encoding the IAV M2 protein of strain A/New Caledonia/20/1999(H1N1) (Genbank protein ID HQ008884), was also already available for use. Based on our previous research [23, 33] we have found that chicken or human codon optimisation (GC-rich) enhances expression in plants, therefore all genes were chicken codon-optimised and GC-enriched unless otherwise stated and synthesised by BioBasic Inc., Canada, to incorporate AgeI and XhoI sites on the 5’ and 3’ ends of each gene. The modified genes for mIBV-S2P-IAV-H6^TM/CT and mIBV-S2P-NDV-F^TM/CT were amplified by PCR. A mix containing 0.3 μM of each forward and reverse primer, dNTPs, 5 X HIFI buffer and HIFI DNA polymerase enzyme (KAPA Biosystems) with template DNA was prepared. PCR amplification was performed in the GeneAmp 2720 Thermocycler (Applied Biosystems) for 1 cycle of 95°C initial denaturation for 3 min; 35 cycles of 98°C denaturation for 20 sec, 70°C annealing for 30 sec, 72°C extension for 3.5 min and a final single 72°C extension step for 5 minutes. The PCR products were separated on a 1% (m/v) agarose gel with a molecular weight marker. The target bands were excised and purified using the Zymoclean^TM Gel DNA Recovery Kit. The purified genes for all constructs were digested using the AgeI/XhoI restriction sites and ligated individually into pEAQ-HT plasmids (containing the silencing suppressor P19 [34]) with a Fast-link^TM DNA Ligation Kit (Epicentre) according to the manufacturer’s recommended procedure. Clones were verified by Sanger DNA sequencing at Inqaba Biotech (Pty), Ltd, Pretoria.

Agroinfiltration

Recombinant plasmids for mIBV-S2P, mIBV-S2P-IAV-H6^TM/CT, and mIBV-S2P-NDV-F^TM/CT were transformed into electrocompetent Agrobacterium tumefaciens strain AGL-1, ATCC^® BAA-101^TM and verified by colony PCR [23] and Sanger DNA sequencing. Glycerol stocks prepared from single colonies were propagated in Lysogeny Broth [35] (5 g/L yeast extract, 10 g/L tryptone, 10 g/L NaCl) with 50 μg/ml kanamycin, rifampicin (30 μg/ml) and carbenicillin (100 μg/ml) at 28°C overnight (15–20 hours) until the OD₆₀₀ was ≥ 2. The same procedures were followed for the IBV M, E, and N recombinant plasmids, as well as for the NDV Matrix, and IAV M2 recombinant plasmids. Overnight cultures were centrifuged at 7000 x g for 7 minutes at 10°C and the cell pellets were resuspended and diluted in 2-(N-morpholino)ethanesulfonic acid (MES) infiltration buffer (10 mM MES, 10 mM MgCl₂, pH 5.6, 200 μM 3,5-Dimethoxy-4-hydroxy-acetophenone) to an OD₆₀₀ of between 1 and 2 before being combined to ratios of 2:1:1:1 (pEAQ-HT-mIBV-S2P: M: E: N), 2:1 (pEAQ-HT-mIBV-S2P-IAV-H6^TM/CT: pEAQ-HT-IAV-M2) and 2:1 (pEAQ-HT-mIBV-S2P-NDV-F^TM/CT: pEAQ-HT-NDV-Matrix). A higher ratio (4:1) of construct in relation to chaperone proteins has also been shown to improve protein expression [36]. The solutions were left at room temperature (21°C) for 1–2 hours before infiltrating. Agrobacterium-transformed vector combinations were syringe-infiltrated into the leaves of 3–4-week-old N. benthamiana ΔXT/FT, a glycosylation mutant with a targeted downregulation of plant complex N-glycans β1,2-xylose and core α1,3-fucose that facilitate mammalian-like glycosylation [37]. The seeds had been germinated on Murashige and Skoog media and were hardened-off in pots containing sterilised compost/red soil/vermiculite (1:1:1) and fertilised with Chemicult hydroponic powder (Chemicult, South Africa) as per the manufacturer’s recommendation. Plantlets were grown in a growth room facility fitted with alternating high sodium pressure and halide lamps, maintained at 26–28°C, for 16 h light and 8 h dark conditions for 3–4 weeks. The infiltrated leaves were harvested at 6 days post-infiltration (6 dpi has been reported for the harvest of plant-produced VLPs [20, 34], and was also previously determined to be the optimal harvest time for IB VLPs [31]) and weighed.

Protein extraction and purification

The leaf tissue was extracted in 1 X PBS (140 mM NaCl, 1.5 mM KH₂PO₄, 10 mM Na₂HPO₄, 2.7 mM KCl, pH 7.4) or bicine buffers (50 mM Bicine, 20 mM NaCl pH 8.4) at 4°C supplemented with protease inhibitor cocktail (Sigma P2714) using a juicer as described by [23]. The mIBV-S2P, mIBV-S2P-IAV-H6^TM/CT, and mIBV-S2P-NDV-F^TM/CT VLPs were purified using sucrose density gradient centrifugation. Twenty and 70% (m/v) sucrose solutions were prepared by dissolving sterile sucrose in sterile 1X PBS, before overlaying 3 ml of 20% sucrose onto 2 ml of 70% sucrose in 38.5 ml ultra-clear^TM Beckman tubes. The clarified leaf supernatant (33.5 ml) was layered gently on top of the sucrose gradient and centrifuged at 32 000 x g at 10°C for 2 hours. 0.5 ml fractions (successively labelled from fraction 1 upwards) were collected from the bottom of the 70% sucrose gradient using a tube coupled to a peristaltic pump.

Analysis by SDS PAGE, Western blot and LC-MS/MS

Sucrose density gradient fractions 2 and 3 were analysed on 12% SDS-PAGE (sodium dodecyl sulfate–polyacrylamide gel electrophoresis) and Western blots were performed. For immunoblotting, the SDS-PAGE gel was transferred onto a Polyvinylidene difluoride (PVDF) membrane at 1.3 A, 25 V, for 7 minutes using the Trans-blot® Turbo™ Transfer system (BioRad) according to manufacturer’s directions. Following overnight blocking in a 3% [m/v] Bovine Serum Albumin (BSA) in 1 X PBS blocking solution containing 0.1% [m/v] TWEEN20, the membrane was incubated in antisera (at a dilution of 1:1000) in blocking solution. The antisera was collected from a commercial flock that had been vaccinated twice with a combination of live commercial Mass-type vaccines (University of Pretoria). The membrane was washed and incubated in the secondary antibody, Goat-α-Chicken IgY HRP (Abcam, Novex) (at a dilution of 1:2000) in 1 X PBS-TWEEN before protein detection with Clarity^TM Western ECL chemilluminescence substrate (BioRad) and visualisation with a ChemiDoc^TM MP Imaging System (Bio-Rad). Protein bands of the expected size were excised from stained SDS-PAGE gels and trypsin digested [38] for Liquid Chromatography Mass Spectrometry (LC-MS/MS) based peptide sequencing at CSIR Biosciences. The obtained MS/MS spectra were compared with the Uniprot Swissprot protein database through the Paragon search engine (AB Sciex) on Protein pilot v5. Only the proteins with a threshold of ≥ 99.9% confidence level were reported.

Transmission electron microscopy

Sucrose density gradient partially purified IB VLPs fraction 3 (which displayed the most prominent bands on both SDS-PAGE and Western blot) for each of the plasmid combinations were adsorbed onto carbon-coated holey copper grids and stained as described in [23]. The grids were air-dried and imaged for VLPs using a JEOL JEM-1400 Flash Transmission Electron Microscope (TEM) at the University of Pretoria. One millilitre of SPF chicken egg allantoic fluid containing live strain ck/ZA/3665/11 (see Serological Testing) was clarified by centrifugation and also submitted for TEM.

S protein quantitation

The fractions for the plasmid combination displaying the highest level of S protein expression in VLPs i.e., the mIBV-S2P-NDV-F^TM/CT: Matrix combination, as determined by the SDS-PAGE and immunoblotting results, were pooled and dialysed in PBS buffer using a 3500 mW CO Slide-A-Lyzer® Dialysis Cassette (ThermoFisher Scientific), after which 15% (m/v) trehalose dehydrate (Sigma-Aldrich) was added. The partially purified VLPs were quantified by densitometry of stained SDS-PAGE using Bovine Serum Albumin (BSA) protein standards of known concentrations and analysed using the quantification software on the ChemiDoc^TM MP Imaging System (Bio-Rad).

Immunization of chickens

Six-week-old SPF White Leghorn Chickens (Gallus gallus) (n = 20) purchased from Avi-Farms (Pty) Ltd, Pretoria were identified individually with numbered wing tags. The birds were housed in an isolation room in the Biosafety Level 3 facility at the University of Pretoria’s Veterinary Faculty. Water and feed (Nova Feeds, South Africa) were provided ad libitum.

Two vaccine doses, 5 μg and 20 μg (S protein content) in single dose volumes of 0.25 ml were prepared for comparison. Just prior to immunization, the partially purified mIBV-S2P-NDV-F^TM/CT+NDV Matrix VLPs were diluted with sterile 1X PBS and vigorously mixed by shaking with 10% (v/v) of Emulsigen®-P Adjuvant (MVP, Phibro Animal Health, USA). The chickens were randomly assigned into two treatment groups of ten birds each. One millilitre blood samples collected from the wing veins of each of the birds prior to vaccination were used for the baseline comparison. The first group was immunized intramuscularly with the 5 μg VLP vaccine while the second group was immunized intramuscularly with the 20 μg VLP vaccine. After 14 days, blood samples were taken from all the chickens before euthanasia by cervical dislocation. All study procedures were approved by the Research and Animal Ethics Committees of the University of Pretoria (REC106-20), the CSIR (251/2018) and the Department of Agriculture, Land Reform, and Rural Development (12/11/1/1/MG).

Serological testing

Sera were tested using two commercial IBV antibody detection kits, namely the BioChek Infectious Bronchitis Virus Antibody test kit (BioChek UK Ltd), and the IDEXX IBV Antibody test kit (IDEXX Laboratories Inc, United States) according to the manufacturers’ recommendations. To prepare antigen for hemagglutination inhibition (HI) tests, SPF chicken egg allantoic fluid containing 10^6.5 egg infectious dose EID₅₀/ 0.1 ml of live QX-like IBV strain chicken/ZA/3665/11 was centrifuged at 3000 rpm for 15 minutes at 4°C and the clarified fluid was transferred to a clean tube. Five millilitres of the clarified fluid were mixed with 1 ml of a 1 U/ml neuraminidase solution from Clostridium perfringens (Abnova, Taiwan). Aliquots (1 millilitre) were incubated for overnight at 37°C in a heating block, pooled and then chilled at 4°C [39]. The HA and HI tests were performed according to the standard method using 1% (v/v) chicken red blood cells (CRBCs) [10]. The last well in the 2-fold titration of test serum where CRBC streaming in the tilted plate was observed, relative to the controls, was recorded as the log₂ HI titre. Due to limited antigen availability, HI was performed only on the blood samples taken two weeks after immunisation, PBS and SPF negative serum was used as the negative controls. HI results for the two treatment groups were tested for normality using the D’Agostino & Pearson test, Anderson-Darling test, Shapiro-Wilk test, and Kolmogorov-Smirnov test, and statistically compared using the non-parametric Mann-Whitney U Test in the GraphPad Prism v 9.4.1 software for Windows (La Jolla, CA, USA). A P value < 0.05 was considered significant.

Results

Agroinfiltration and protein expression

SDS PAGE of fractions 2 and 3 of the partially purified plant extracts showed bands at approximately 127 kDa for mIBV-S2P, 122 kDa for mIBV-S2P-IAV-H6^TM/CT, and 124 kDa for mIBV-S2P-NDV-F^TM/CT correlating to the expected size of the IBV S protein, for all three constructs tested (Fig 1(A)) and LC-MS/MS based peptide sequencing confirmed the bands to be the S protein of IBV (S2 Fig). The S-protein specific bands detected by Western blot were the strongest for mIBV-S2P-NDV-F^TM/CT, followed by mIBV-S2P-IAV-H6^TM/CT, with the weakest expression of the S protein displayed by mIBV-S2P (Fig 1(B)). The large diffused bands >124 kDa are indicative of supramolecular structures associated with the VLPs as these are not present in negative controls, and similar results were reported by [40]. The chicken anti-IBV serum did not detect the S protein band in the QX-virus positive control, which was most likely because the quantity of S protein in the purified virus was low, but also because the source flock had been immunized with Mass-type IB vaccines, and there is little cross-protection between the highly variable S protein of different serotypes [41]. The IBV antisera however reacted strongly with the conserved 45 kDa IBV N protein in the purified positive control virus and the mIBV-S2P VLPs produced by co-infiltrating with the IBV M, E and N proteins, as N is a structural protein that is highly conserved between serotypes [42]. No difference was observed when bicine buffer was used compared to PBS to purify the VLPs. Under the TEM, VLPs were observed in the plant leaf extracts that resembled native IBV particles, ranging in diameter from 67 nm to 135 nm, with most being between 80 and 100 nm in size, and spikes ranging from 12 to 25 nm in length (Fig 2(A) and 2(B)). The crown-like S protein surface projections are clearly visible in both TEM images.

Fig 2 — The crown-like S protein surface projections are clearly visible in both TEM images.

Since Western blot analysis showed that the mIBV-S2P-NDV-F^TM/CT construct produced the highest levels of VLP formation and S protein expression, the VLPs formed from this construct were selected for the immunogenicity study. Fractions 2 and 3 were pooled, dialysed in PBS and stabilised with trehalose. SDS PAGE was performed, and densitometry analysis determined the concentration of the 124 kDa S protein band to be ~ 101 ng/ μl (S3 Fig). As with live strain ck/ZA/3665/11 on which the VLP designs were based and most strains of IBV, the tobacco plant-produced IB VLPs did not agglutinate CRBCs, therefore HA could not be used for the vaccine quantitation. Following treatment with a neuraminidase solution [39], haemagglutination ability of live ck/ZA/3665/11 virus could be activated, allowing for the haemagglutination inhibition study to be performed.

Immunogenicity in chickens

All 20 pre-vaccination serum samples tested negative for the presence of IBV-specific antibodies with a commercial ELISA kit, verifying that the SPF chickens had no prior exposure to IBV. Two weeks after vaccination, the ten chickens vaccinated with 5 μg seroconverted with HI titres that ranged from 8 log₂ to 10 log₂ with a geometric mean titre (GMT) of 9.1 log₂ whereas the ten that received 20 μg had significantly higher (P = 0.0001) HI titres that ranged from 10 log₂ to 12 log₂ with a GMT of 10.5 log₂ (Fig 3). All twenty samples collected at 14 days tested negative for the presence of IBV-specific antibodies on two commercial ELISA kits, and no adverse vaccination effects at the injection site were observed in any of the chickens during the course of the experiment.

Fig 3 — The bar depicts the geometric mean titre; statistical significance is indicated by the asterisks (P < 0.05). A titre of 4 log₂ (1:16) or higher is considered positive for the HI test.

Discussion

In this study, VLPs displaying the immunogenic S protein of IB virus were successfully produced in planta for the first time. Previously, the native IBV S protein with various combinations of modifications including replacement of the native retention peptide with a murine signal peptide, substitution of the TM and/or CT domains with those of IAV HA, as well as removal of the ER retention signal, did not successfully assemble VLPs in plants [31]. The stabilising proline residues in the S protein introduced in the present study therefore appears to be a critical requirement for plant-produced IB VLPs, and the highest levels of IB VLP expression (as confirmed by Western blot and LC-MS/MS) were obtained when the native TM domain and CT of the S glycoprotein were substituted with the equivalent sequence of NDV F glycoprotein, co-infiltrated with the NDV Matrix protein. Slightly lower levels of VLP expression were obtained when the chimeric modified S protein contained the TM and CT of an H6-subtype IAV hemagglutinin protein, as confirmed by Western blot and LC-MS/MS. The lowest levels of VLP expression were obtained when the modified S protein with its native TM and CT was co-infiltrated with the IBV M, E and N structural proteins, but in general co-infiltrating with virus-specific structural proteins enhanced VLP formation.

The yield of the optimally-expressed VLP (developed from the mIBV-S2P-NSV-F^TM/CT construct) in this study was calculated at 16.77 mg/kg of leaf material harvested. The NDV Matrix protein plays a key role in the assembly and budding of viruses at the cell membrane [43], suggesting that its presence may improve expression of the IBV S protein, perhaps even more so when co-expressing with the S protein at a higher ratio (4:1), as suggested by [36]. It was previously shown that the transient co-expression of IAV M2 has the potential to improve the accumulation and the stability of recombinant proteins in the secretory pathway of plant cells through pH regulation [36], but co-infiltrating with the IAV M1 protein, was not necessary for and may decrease the formation of IAV VLPs in plants [44].

The IB VLPs with the chimeric S-NDV protein + NDV Matrix protein, that displayed the most abundant VLP expression under TEM and the strongest antigenicity in vitro, was formulated as a vaccine with Emulsigen®-P adjuvant. Emulsigen®-P stimulates optimal immune responses in chickens vaccinated with plant-produced IAV VLPs and is used at a lower volume compared to other adjuvants [33]. The SPF chickens immunized with 5 μg (approximate S protein content) doses of the adjuvanted IB VLPs showed no adverse vaccine effects, whereas the traditional whole inactivated virus oil emulsion vaccines occasionally cause lesions at the injection site that lead to carcass downgrades [45]. A single 5 μg dose of per bird of the plant-produced IB VLP vaccine was sufficient to elicit a strong humoral response in SPF chickens of S-specific antibodies using the HI test, but there is scope to improve the quantitation methods of non-agglutinating VLPs such as this to further optimise the effective dose.

Since the vaccine did not contain the IBV structural proteins (M, N, E), no antibodies were detected by two commercial IBV ELISA kits, which are targeted at detecting the highly conserved structural IBV group-specific antibodies common to all IBV serotypes. This feature of the plant-produced IB VLPs can potentially be used for DIVA if only VLP vaccines are administered, but in practice, the vaccination program would likely include a combination of heterologous live-attenuated and homologous VLP vaccines, that affords the best protection. The HI test on the other hand, was able to detect the neutralizing S-protein specific antibodies elicited by the VLP vaccine. The efficacy of the IBV VLP vaccine produced here, for which the immunogenicity and lack of toxicity in the target species was demonstrated, will be assessed by live virus challenge in a follow-up study.

Supporting information

S1 Fig. Protein sequence of the synthetic gene mIBV-S2P.

The murine signal peptide is highlighted in blue, the linker in magenta, and the S2 domain in grey with heptad repeat 1 in yellow, the central helix in green, and the two stabilizing proline substitutions in boldface and underlined.

(DOCX)

Click here for additional data file.^{(12.4KB, docx)}

S2 Fig

Protein confirmation using LC-MS/MS-based peptide sequencing of the modified IBV spike protein constructs compared in this study (A) mIBV-S2P, (B) mIBV-S2P-IAV-H6^TM/CT, and (C) mIBV-S2P-NDV-F^TM/CT. The percentage sequence coverage is indicated above with several unique peptides identified with ˃ 90% confidence. Peptides with ˃ 95% confidence are highlighted in green, those with 50–95% confidence in yellow, and those with <50% confidence in red. No peptides were identified for the non-highlighted regions of the sequence (grey).

(DOCX)

Click here for additional data file.^{(13.3KB, docx)}

S3 Fig. Densitometric analysis by SDS-PAGE of partially-purified mIBV-S2P-NDV-F^TM/CT VLPs.

Lane 1: SeeBluePlus2 protein ladder; Lane 2: BSA Standard 100 ng/μl; Lane 3: BSA Standard 150 ng/μl; Lane 4: BSA Standard 200 ng/μl; Lane 5: BSA Standard 250 ng/μl; Lane 6: BSA Standard 300 ng/μl; Lane 7: Dialysed VLP sample (25 μl); Lane 8: Dialysed VLP sample (10 μl); Lane 9: PageRuler Prestained protein ladder; Lane 10: Positive control (Live QX-like IBV); Lane 11: Negative control (pEAQ-HT-empty).

(DOCX)

Click here for additional data file.^{(794.1KB, docx)}

S4 Fig. Original uncropped, unedited SDS-PAGE of partially-purified plant-produced IBV S protein Lane 1: molecular weight marker; Lane 2: plant-expressed empty pEAQ-HT vector; Lane 3: purified live QX-like IBV strain ck/ZA/3665/11; Lanes 4–7: mIBV-S2P:M:E:N fractions 2 (lanes 4 and 6) and 3 (lanes 5 and 7) extracted in either PBS or bicine as indicated; Lanes 8–11: mIBV-S2P-IAV-H6^TM/CT:M2 fractions 2 (lanes 8 and 10) and 3 (lanes 9 and 11) extracted in either PBS or bicine as indicated; Lanes 12–15: mIBV-S2P-NDV-F^TM/CT:NDV Matrix fractions 2 (lanes 12 and 14) and 3 (lanes 13 and 15) extracted in either PBS or bicine as indicated.

(PNG)

Click here for additional data file.^{(8.5MB, png)}

S5 Fig. Original uncropped, unedited Western blot (B) of partially-purified plant-produced IBV S protein (Primary antibody–IBV antisera, secondary antibody—Goat-α-Chicken IgY HRP).

Lane 1: molecular weight marker; Lane 2: plant-expressed empty pEAQ-HT vector; Lane 3: purified live QX-like IBV strain ck/ZA/3665/11; Lanes 4–7: mIBV-S2P:M:E:N fractions 2 (lanes 4 and 6) and 3 (lanes 5 and 7) extracted in either PBS or bicine as indicated; Lanes 8–11: mIBV-S2P-IAV-H6^TM/CT:M2 fractions 2 (lanes 8 and 10) and 3 (lanes 9 and 11) extracted in either PBS or bicine as indicated; Lanes 12–15: mIBV-S2P-NDV-F^TM/CT:NDV Matrix fractions 2 (lanes 12 and 14) and 3 (lanes 13 and 15) extracted in either PBS or bicine as indicated.

(TIF)

Click here for additional data file.^{(12.9MB, tif)}

S1 Raw images

(PDF)

Click here for additional data file.^{(970.1KB, pdf)}

Acknowledgments

The authors thank Antoinette Lensink, Karen Ebersohn, Danielle Henn, Albert Mabetha, Sharon Kgasago, Thandeka Phiri, Thlasila Aphane, Alma Truyts, and Sipho Mamphutha for technical assistance. Tanja Smith provided the pEAQ-HT-NDV-Matrix and pEAQ-HT-H1N1-M2 constructs. The pEAQ-HT vector was used under a research license from Plant Biosciences Ltd, UK. The MVP Emulsigen-P adjuvant was donated by Phibro Animal Health (USA).

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported by the Department of Science and Innovation/ National Research Foundation (DSI/NRF) [SARChI grant numbers 114612, 129242]; and KMS received bursaries from the University of Pretoria, the DSI/NRF and the HWSETA. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.World Bank & TAFS-Forum. (2011). World livestock disease atlas: A quantitative analysis of global animal health data (H. S. N. The World Bank, Washington, DC 20433, USA Ed.). (available online—accessed July 2022).
2.Liu G., Lv L., Yin L., Li X., Luo D., Liu K., et al. (2013). Assembly and immunogenicity of coronavirus-like particles carrying infectious bronchitis virus M and S proteins. Vaccine 31. 5524–5530. doi: 10.1016/j.vaccine.2013.09.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Cavanagh D., and Gelb J. Jr (2008). Infectious Bronchitis. In Saif Y. M., Fadly A. M., Glisson J. R., McDougald L. R., Nolan L. K., Swayne D. E. (Eds). Diseases of Poultry. Wiley-Blackwell, Ames, IA, USA, 117–135. [Google Scholar]
4.Jackwood M. W., and de Wit S. (2013). Infectious Bronchitis. Diseases of Poultry. Chapter b. 139–153. [Google Scholar]
5.Ujike M., and Taguchi F. (2015). Incorporation of Spike and Membrane glycoproteins into coronavirus virions. Viruses 7. 1700–1725. doi: 10.3390/v7041700 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Kant A., Koch G., van Roozelaar D. J., Kusters J. G., Poelwijk F. A., and van der Zeijst B. A. (1992). Location of antigenic sites defined by neutralizing monoclonal antibodies on the S1 avian infectious bronchitis virus glycopolypeptide. Journal of General Virology 73 (Pt 3). 591–596. doi: 10.1099/0022-1317-73-3-591 [DOI] [PubMed] [Google Scholar]
7.Jara M., Crespo R., Roberts D. L., Chapman A., Banda A., and Machado G. (2021). Development of a Dissemination Platform for Spatiotemporal and Phylogenetic Analysis of Avian Infectious Bronchitis Virus. Frontiers in Veterinary Science 8. Article 624233. 1–12. doi: 10.3389/fvets.2021.624233 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.de Wit J. J. S., Cook J. K. A., and van der Heijden H. M. (2011). Infectious bronchitis virus variants: a review of the history, current situation and control measures. Avian Pathology 40. 223–235. doi: 10.1080/03079457.2011.566260 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Erfanmanesh A., Ghalyanchilangeroudi A., Nikaein D., Hosseini H., and Mohajerfar T. (2020). Evaluation of inactivated vaccine of the variant 2 (IS-1494 /GI-23) genotype of avian infectious bronchitis. Comp Immunol Microbiol Infect Dis. 71. 101497. doi: 10.1016/j.cimid.2020.101497 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.WOAH, 2019. Avian infectious bronchitis. WOAH Terrestrial Manual, Chapter 3.3.2. 796–809. https://www.woah.org/en/disease/avian-infectious-bronchitis/
11.Jordan B. (2017). Vaccination against infectious bronchitis virus: a continuous challenge. Veterinary Microbiology. 1–7. doi: 10.1016/j.vetmic.2017.01.002 [DOI] [PubMed] [Google Scholar]
12.McGinnes L. W., and Morrison T. G. (2014). Newcastle disease virus-like particles: Preparation, Purification, Quantification, and Incorporation of Foreign Glycoproteins. Curr Protoc Microbiol 30. 1–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Ong H. K., Tan W. S., and Ho K. L. (2017). Virus like particles as a platform for cancer vaccine development. Peer J. 1–31. doi: 10.7717/peerj.4053 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Blokhina E. A., Kupriyanov V. V., Ravin N. V., and Skryabin K. G. (2013). The Method of Noncovalent in vitro Binding of Target Proteins to Virus-Like Nanoparticles Formed by Core Antigen of Hepatitis B. Virus. Dokl Akad Nauk 448. 719–721. [DOI] [PubMed] [Google Scholar]
15.Ukrami A., Sakurai A., Ishikawa M., Yap M. L., Flores-Garcia Y., Haseda Y., et al. (2017). Development of a novel virus-like particle vaccine platform that mimics the immature form of alphavirus. Clinical and Vaccine Immunology 24. Issue 7. 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Zdanowicz M., and Chroboczek J. (2016). Virus-like particles as drug vectors. Acta biochimica Polonica 63. No 3. 469–473. [DOI] [PubMed] [Google Scholar]
17.Lv L., Li X., Liu G., Li R., Liu Q., Shen H., et al. (2014). Production and immunogenicity of chimeric virus-like particles containing the spike glycoprotein of infectious bronchitis virus. J. Vet. Sci 15 (2). 209–216. doi: 10.4142/jvs.2014.15.2.209 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Wu X., Zhai X., Lai Y., Zuo L., Zhang Y., Mei X., et al. (2019). Construction and immunogenicity of novel chimeric virus-like particles bearing antigens of infectious bronchitis virus and Newcastle disease virus. Viruses 11 (254). 1–13. doi: 10.3390/v11030254 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Xu P., Wu X., Wang H., Ma B., Ding M., and Yang X. (2016). Assembly and immunogenicity of baculovirus-derived infectious bronchitis virus-like particles carrying membrane, envelope and the recombinant spike proteins. Biotechnol Lett 38. 299–304. doi: 10.1007/s10529-015-1973-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.D’Aoust M., Lavoie P., Couture M. M., Trépanier S., Guay J., Dargis M., et al. (2008). Influenza virus-like particles produced by transient expression in Nicotiana benthamiana induce a protective immune response against a lethal viral challenge in mice. Plant Biotechnology Journal 6. 930–940. [DOI] [PubMed] [Google Scholar]
21.Peyret H., Steele J. F. C., Jung J. W., Thuenemann E. C., Meshcheriakova Y., and Lomonossoff G. P. (2021). Producing Vaccines against Enveloped Viruses in Plants: Making the Impossible, Difficult. Vaccines 9 (7). 780. doi: 10.3390/vaccines9070780 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Rybicki E. P. (2009). Plant-produced vaccines: promise and reality. Drug Discov. Today 14. 16–24. doi: 10.1016/j.drudis.2008.10.002 [DOI] [PubMed] [Google Scholar]
23.Smith T., O’Kennedy M. M., Wandrag D. B. R., Adeyemi M., and Abolnik C. (2019). Efficacy of a plant-produced virus-like particle vaccine in chickens challenged with Influenza A H6N2 virus. Plant Biotechnology Journal. 1–11. doi: 10.1111/pbi.13219 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Stoger E., Fischer R., Moloney M., and Ma J. K. (2014). Plant molecular pharming for the treatment of chronic and infectious diseases. Annu. Rev. Plant Biol. 65. 743–768. doi: 10.1146/annurev-arplant-050213-035850 [DOI] [PubMed] [Google Scholar]
25.Thuenemann E. C., Meyers A. E., Verwey J., Rybicki E. P., and Lomonossoff G. P. (2013). A method for rapid production of heteromultimeric protein complexes in plants: assembly of protective bluetongue virus-like particles. Plant Biotechnology Journal. 1–8. doi: 10.1111/pbi.12076 [DOI] [PubMed] [Google Scholar]
26.Moustafa K., Makhzoum A., and Tremouillaux-Guiller J. (2016). Molecular farming on rescue of pharma industry for next generations. Crit. Rev. Biotechnol 36. 840–850. doi: 10.3109/07388551.2015.1049934 [DOI] [PubMed] [Google Scholar]
27.D’Aoust M., Couture M. M. J., Charland N., Trépanier S., Landry N., Ors F., et al. (2010). The production of hemagglutinin-based virus-like particles in plants: a rapid, efficient and safe response to pandemic influenza. Plant Biotechnology Journal 8. 607–619. doi: 10.1111/j.1467-7652.2009.00496.x [DOI] [PubMed] [Google Scholar]
28.Pallesen J., Wang N., Corbett K. S., Wrapp D., Kirchdoerfer R. N., Turner H. L., et al. (2017). Immunogenicity and structures of a rationally designed prefusion MERS-CoV spike antigen. Proceedings of the National Academy of Sciences of the United States of America 114, E7348–e7357. doi: 10.1073/pnas.1707304114 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Ward B. J., Gobeil P., Séguin A., Atkins J., Boulay I., Charbonneau P. Y., et al. (2021). Phase 1 randomized trial of a plant-derived virus-like particle vaccine for COVID-19. Nat Med. 27 (6). 1071–1078. doi: 10.1038/s41591-021-01370-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Jung J., Zahmanova G., Minkov I., and Lomonossoff G. P. (2022). Plant-based expression and characterization of SARS-CoV-2 virus-like particles presenting a native spike protein. Plant Biotechnology Journal 20. 1363–1372. doi: 10.1111/pbi.13813 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Sepotokele, K. M. (2020). Towards producing infectious bronchitis virus-like particles in plants as potential vaccine candidates. MSc Dissertation, University of Pretoria. Accessible at: https://repository.up.ac.za/handle/2263/86941.
32.O’Hara J. M., Whaley K., Pauly M., Zeitlin L., and Mantis N. J, (2012). Plant-based expression of a partially humanized neutralizing monoclonal IgG directed against an immunodom-inant epitope on the ricin toxin A subunit. Vaccine 30 (7). 1239–1243. doi: 10.1016/j.vaccine.2011.12.058 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Abolnik C., O’Kennedy M. M., Murphy M-A., and Wandrag D. B. R. W. (2022). Efficacy of a plant-produced clade 2.3.4.4 H5 influenza virus-like particle vaccine in layer hens. Veterinary Vaccines. In press. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Sainsbury F., Thuenemann E. C., and Lomonossoff G. P. (2009). pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotechnology Journal 7. 682–693. doi: 10.1111/j.1467-7652.2009.00434.x [DOI] [PubMed] [Google Scholar]
35.Miller J. H, (1972). Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. [Google Scholar]
36.Jutras P. V., D’Aoust M., Couture M. M., Vézina L., Goulet M., Michaud D., et al. (2015). Modulating secretory pathway pH by proton channel co-expression can increase recombinant protein stability in plants. Biotechnology Journal 10. 1–9. doi: 10.1002/biot.201500056 [DOI] [PubMed] [Google Scholar]
37.Strasser R., Stadlmann J., Schähs M., Stiegler G., Quendler H., Mach L., et al. (2008). Generation of glycol-engineered Nicotiana benthamiana for the production of monoclonal antibodies with a homogeneous human-like N-glycan structure. Plant Biotechnology Journal 6. 392–402. [DOI] [PubMed] [Google Scholar]
38.Shevchenko A., Tomas H., Havlis J., Olsen J. V., and Mann M. (2007). In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nature Protocols 1 (6). 2856–2860. [DOI] [PubMed] [Google Scholar]
39.Ruano M., El-Attrache J., and Villegas P. (2000) A rapid-plate hemagglutination assay for the detection of infectious bronchitis virus. Avian Dis. 44. 99–104. [PubMed] [Google Scholar]
40.Castells-Graells R., and Lomonossoff G. P. (2021). Plant-based production can result in covalent cross-linking of proteins. Plant Biotechnology Journal 19. 1095–1097. doi: 10.1111/pbi.13598 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Cavanagh D. (2003). Severe acute respiratory syndrome vaccine development: experiences of vaccination against avian infectious bronchitis coronavirus. Avian Pathology 32. 567–582. doi: 10.1080/03079450310001621198 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Williams A. K., Wang L., Sneed L. W., and Collisson E. W. (1992). Comparative analysis of the nucleocapsid genes of several strains of infectious bronchitis virus and other coronaviruses. Virus Res. 25. 213–222. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Battisti A. J., Meng G., Winkler D. C., McGinnes L. W., Plevka P., Steven A. C., et al. (2012). Structure and assembly of a paramyxovirus matrix protein. Proc Natl Acad Sci 109. 13996–14000. doi: 10.1073/pnas.1210275109 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Chen B. J., Leser G. P., Morita E., and Lamb R. A. (2007). Influenza virus hemagglutinin and neuraminidase, but not the matrix protein, are required for assembly and budding of plasmid-derived virus-like particles. J. Virol. 81. 7111–7123. doi: 10.1128/JVI.00361-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Temiz S. A., Abdelmaksoud A., Dursun R., and Vestita M. (2021). Acral chilblain-like lesions following inactivated SARS-CoV-2 vaccination. Int J Dermatol. 60 (9). 1152–1153. doi: 10.1111/ijd.15619 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0288970.r001

Decision Letter 0

Haitham Mohamed Amer

24 Mar 2023

PONE-D-23-05238Optimization of Infectious Bronchitis virus-like particle expression in Nicotiana benthamiana as potential poultry vaccinesPLOS ONE

Dear Dr. Sepotokele

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by May 1, 2023. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Haitham Mohamed Amer, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions

3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This paper describes the production of VLPs of IBV in plants using transient expression. Various different gene constructs are tested and the highest yielding one is used for an immunogenicity study in target animals. On the whole, this manuscript requires some modifications to improve clarity (especially with regards to the different constructs used and what Figure 1 shows). Finally the immunogenicity experiment described in figure 3 is lacking in any controls. More detailed points are raised below:

- The authors should add a figure that includes labelled diagrams for the constructs expressed in this paper.

- Figures S1 and S2 seems to have been swapped.

- Both supplementary figures appear to be TIFF image files, but they show sequence information. These files should therefore be in Word or PDF format so that readers can perform the “copy” function for BLAST searches, sequence analysis, etc.

- Figure 1: What is “fractions 2 and 3” referred to multiple times in the text and figure legend? Is this fractions from the sucrose cushion? If so what part of the gradient? The authors need to explain this clearly or show a diagram. Also the figure legend is unnecessarily confusing. If lanes 4-7 are from the same construct, then write something along the lines of “Lanes 4-7: mIBV-S2P:M:E:N fractions 2 (lanes 4 and 6) and 3 (lanes 5 and 7) extracted in either PBS or Bicine, as indicated”. Or add a line of labels in the figure itself above the wells for “fraction”, and another line for “construct”. In fact I would strongly recommend adding a “construct” line of labels to the images in Figure 1 regardless of changes to the figure legend. Same thing for lanes 8-11 and 12-15.

- Line 288-289: Gel densitometry is a rather poor method of protein quantification, a superior alternative would have been a modified Lowry assay or BCA assay. Because the authors chose to use gel densitometry, they need to show an image of the SDS-PAGE gel that was used for quantitation.

- Line 290: Is this expected? Does live IBV cause agglutination of CRBCs (I assume the answer is yes given how the subsequent immunogenicity assay was performed)? Do currently used IBV vaccines cause agglutination of CRBCs? The authors should indicate this for context and discuss.

- Line 299: All twenty samples tested negative for what?

- Figure 3 and generally vaccination experiment: there are no controls in this experiment. This experiment should have a positive control (chickens vaccinated with a currently licensed vaccine) and a negative control (PBS + adjuvant, or, even better, chickens vaccinated with plant extract prepared and purified in the same way as the vaccine but without expression of the antigen + adjuvant). The authors should acknowledge this methodological weakness in the discussion and indicate that it makes any conclusion about immunogenicity preliminary rather than solid. I certainly hope that the live virus challenge that the authors mention will be performed with appropriate controls.

Reviewer #2: In this manuscript, the authors describe a method by using Nicotiana benthamiana expression system to express IBV S protein and other viral proteins to produce virus like particles (VLPs). By co-expressing IBV S, N, M, E, or IBV S-NDV F (TMCM), NDV M, or IBV S-AIV H6(TMCM), AIV M2, the authors found the co-expressing group of IBV S-NDV F (TMCM), NDV M obtains the highest level of VLPs. This is a good attempt by using plant to produce IB VLPs as vaccine candidate, with lower cost and safer than the baculovirus insect cell expression system. The idea is novel; however, there is some issues need to be addressed in this study.

1. The results and figures legend interpret are not clear. Please check each figure’s interpret and give more detailed and clear information. For example, which antibody was applied for Fig. 1B? How was the HI result obtained in Fig. 3?

2. It seems the antibody for IBV is not sensitive for S protein detection. In Fig. 1B, there is no clear band for S protein in lane 3 (positive control). Also, it seems the membrane transfer has problem, the middle part (lane 8, 9, 10, 11, 12) membrane transfer is not successful, result in the white signal. Fig 1A, the arrow indicate S protein band also appears in the negative control (lane 2). Thus, it is not convincing to claim that the band is S protein. Usually, the glycol-S protein size is much bigger than 124 kDa. Please re-do the Western blot by using more specific S protein antibody. Current data is not convincing to show the successful expression of S protein. Moreover, please quantify the S protein containing VLPs.

3. The is no S antibody measurement in the chicken serum after immunization. Please use ELISA kit to measure the kinetic induction of S protein antibody in the serum.

4. Please do the QX strain attacking experiment to show the VLP protection efficiency, by using the H120 vaccination as control.

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Plos one manuscript review comment.docx

Click here for additional data file.^{(13.9KB, docx)}

PLoS One. 2023 Jul 20;18(7):e0288970. doi: 10.1371/journal.pone.0288970.r002

Author response to Decision Letter 0

6 Apr 2023

Response to Reviewers

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

RESPONSE: The formatting has been revised as required.

RESPONSE: The original images have been uploaded as a supporting file (S1_raw_images).

RESPONSE: All the relevant data is actually presented, so the phrase has been replaced with an appropriate citation (lines 150-153), (lines 337-341), or was removed where we referred to our previous unpublished laboratory findings (lines 345-346).

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Partly

________________________________________

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: I Don't Know

________________________________________

3. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: No

Reviewer #2: Yes

________________________________________

4. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

5. Review Comments to the Author

- The authors should add a figure that includes labelled diagrams for the constructs expressed in this paper.

RESPONSE: The requested diagrams depicting constructs has been added as supplementary file (S3_Fig).

- Figures S1 and S2 seems to have been swapped.

RESPONSE: Thank you for picking this up, the figure titles have been amended accordingly.

RESPONSE: Editable docx versions of these figures have been uploaded with the revised manuscript.

RESPONSE: To clarify the concept of fractions, lines 176-178 were amended as follows: “0.5 ml fractions (successively labelled from fraction 1 upwards) were collected from the bottom of the 70 % sucrose gradient using a tube coupled to a peristaltic pump”. Figure legends were amended as suggested for clarity, and additional “construct” line was added above the wells in Fig1 as suggested.

RESPONSE: Yes, we agree that Lowry and BCA are superior methods for protein quantitation, but these can only be used to determine the total protein content. The protein extract here was intentionally partially purified because highly-purified VLP would drive up the production cost of such a veterinary vaccine, and it was important to test a preparation that would ultimately be commercially viable. The S-protein is the protective antigen, so we specifically needed an approximation of its concentration to calculate the vaccine dose, and we were therefore restricted to using densitometry of a PAGE gel. The densitometry gel has been added as a supplementary figure (S4_Fig).

RESPONSE: Some live IBVs can agglutinate CRBCs in their native form but many (possibly the majority) cannot. Yes, this was expected because the native live IBV strain ck/ZA/3665/11 used in the design was unable to agglutinate CRBCs without neuraminidase pre-treatment, therefore we did not expect that the VLP would agglutinate CRBCs either but we tested it anyway. Live IBV strain ck/ZA/3665/11 could be treated with neuraminidase to enable it to be used as an antigen in the HI tests, and yes, we did try the neuraminidase treatment on the VLP without success, but the neuraminidase may not work on plant-produced proteins as with avian-produced antigens, and the heat inactivation step of the neuraminidase may also have a detrimental effect on the VLP.

Lines 296-302 were amended to better reflect the abovementioned, and with the reference of Ruano et al., 2000 included.

- Line 299: All twenty samples tested negative for what?

RESPONSE: Line 310 was amended to reflect that all twenty samples tested negative for the presence of IBV-specific antibodies.

RESPONSE: Thank you for the comment, but please bear in mind that there is no methodological weakness here because the clinical part of this study is not a vaccination experiment (which by definition entails a challenge with live virus), it is instead an immunogenicity experiment to verify that the VLPs do induce IBV-specific antibodies in the target species. Our Animal Ethics Committee was also insistent that this pilot be performed prior to the official vaccination study, not only to establish immunogenicity, but also toxicity. The pre-vaccination titres of the chickens served as the negative control here; there would be little point in including and ultimately sacrificing a group of non-immunized birds. We are compelled to reduce animal use. Yes, indeed we included appropriate control groups in the official vaccine study that followed this one. Lines 370-371 were modified to reiterate that this was an immunogenicity study that precedes the vaccine efficacy study.

RESPONSE: Figure 1’s legend has been amended for clarity. Primary and secondary antibody now included in the figure legend, details of which can be found in the methodology, lines 182-192). Lines 242-247 describe the haemagglutination inhibition test (with reference to WOAH, 2019 for the standard method) used to obtain the HI results.

RESPONSE: Yes, the S protein was not detected in the positive control. The most likely reason for this was that the quantity of S protein in the purified virus used for the positive control was low. The flock that the protein was purified from was also immunized with Mass-type IBV vaccines, and the level of cross-protection is low between the spike protein from different serotypes (Cavanagh, 2003). This is already mentioned in lines 265-268.

While a similar sized- band appears in the negative control, this is most likely a plant protein of a similar size. Most importantly, the corresponding bands in the relevant lanes, were excised from the gel (in lanes 5, 9, and 13, correlating to each construct) were analysed by LC-MS/MS (peptide sequencing), which confirmed the presence of the IBV spike protein in high enough quantities to confidently confirm that the S protein is present in those bands. The SDS-PAGE, Western blot, and LC-MS/MS results taken together allow us to confidently make the conclusion that the S-protein was well-expressed in the plants, and this was also subsequently verified by the inducement of IBV S-specific antibodies in the immunogenicity study in chickens. The gel used for densitometry quantification of the VLP S-protein concentration has been included as a supplementary figure (S4_Fig).

3. The is no S antibody measurement in the chicken serum after immunization. Please use ELISA kit to measure the kinetic induction of S protein antibody in the serum.

RESPONSE: There is no validated commercial ELISA available that measures IBV S-antibodies, presumably because of the vast number of IBV serotypes present globally and the propensity of IBV for antigenic drift. Developing and validating an S-specific ELISA for the QX-like virus on which the VLP designs were based was far beyond the scope of this study. Therefore, only HI could be used to measure specific S-antibody responses.

4. Please do the QX strain attacking experiment to show the VLP protection efficiency, by using the H120 vaccination as control.

RESPONSE: We are uncertain about what the reviewer means by an “attacking” experiment, but thought that he/she is referring to virus neutralization tests (with the H120 vaccine). Please bear in mind that the clinical part of this study was designed and intended only as an immunogenicity experiment, to demonstrate that the VLPs were immunogenic and non-toxic in the target species. We verified both, and in the vaccine study that follows this one, we officially evaluated the efficacy of the VLPs and the ability of the vaccine to reduce virus shedding and protect against disease; no further changes made.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(25.6KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0288970.r003

Decision Letter 1

Haitham Mohamed Amer

23 May 2023

PONE-D-23-05238R1Optimization of Infectious Bronchitis virus-like particle expression in Nicotiana benthamiana as potential poultry vaccinesPLOS ONE

Dear Dr. Sepotokele,

Please submit your revised manuscript by Jul 07 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Haitham Mohamed Amer, PhD

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: No

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: (No Response)

1. The author should re-perform the Western blot in Fig 1b and get better quality figure. The current Western blot figure quality is not acceptable, as there is no clear S protein band, even in the positive control (lane 3).

2. S antibody measurement in the chicken serum after immunization is necessary.

3. The QX strain infection experiment after immunization is necessary to show the VLP protection efficiency, by using the H120 vaccination as control. As the title of this manuscript is “Optimization of Infectious Bronchitis virus-like particle expression in Nicotiana benthamiana as potential poultry vaccines”. The study should include experiments to show the VLP as potential vaccines. The successful expression of S protein and HI experiment are not enough to demonstrate it is potential vaccines.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Liao Ying

**********

PLoS One. 2023 Jul 20;18(7):e0288970. doi: 10.1371/journal.pone.0288970.r004

Author response to Decision Letter 1

27 May 2023

The Academic Editor

PLOS ONE

27 May 2023

Dear Dr Haitham Mohamed Amer

Re. Requested further revisions to PONE-D-23-05238R1 -Optimization of Infectious

Bronchitis virus-like particle expression in Nicotiana benthamiana as potential poultry vaccines

by KS Sepotokele et al

Your letter to Ms. Sepotokele dated 23 May refers, in which you requested further changes to our

manuscript. Since the last revision, Reviewer 1 was satisfied with the revisions, but Reviewer 2

(Dr. Liao Ying) was not.

Whilst we are enormously grateful to Dr. Ying for the time expended on this review, we

unfortunately seem to have reached an impasse, and I explain below how and why this reviewer’s

three remaining objections lack merit. I have copied Dr. Ying’s comments in boldface, with our

responses below.

1. The author should re-perform the Western blot in Fig 1b and get better quality figure.

The current Western blot figure quality is not acceptable, as there is no clear S protein

band, even in the positive control (lane 3).

Ms. Sepotokele did repeat the Western blot several times, but she was unable to improve the quality.

The S protein band, although faint, is still clearly visible. The figure we present is the best we can

do at this time. It would be a shame to reject this novel work for this reason.

As we explained to the reviewer in our previous responses, included here for your benefit, the

reason for the faintness of the S-protein band in the Western blot is attributed to the fact that (a) the

plant extract containing the VLPs is only partially purified and plant proteins cross-react nonspecifically with chicken antiserum (chickens are fed plant matter, so this is to be expected) and (b)

that the only available IBV-positive antisera was collected from commercial chickens that were

immunized with heterologous IBV vaccines, not the QX-like variant our VLP is based on. Thus, repeating the Western blot over and over again is not going to increase the intensity of the S-protein

band whatsoever.

Finally, as we previously rebutted, peptide mass fingerprinting on this exact band confirmed that it

is indeed the S-protein.

Alternatively, if the acceptance of the manuscript comes down to this minor issue, we could remove

this Western Blot entirely, report it as “data not shown”; the peptide mass fingerprinting results are

already included as supplemental data. Please let us know if this would be acceptable?

2. S antibody measurement in the chicken serum after immunization is necessary.

We already explained this point in the prior revision, the hemagglutinin inhibition (HI) test

specifically measures S antibodies, so we did indeed measure the S antibodies in the chickens after

immunization; it is very strange that the reviewer won’t accept this fact.

3. The QX strain infection experiment after immunization is necessary to show the VLP

protection efficiency, by using the H120 vaccination as control. As the title of this manuscript

is “Optimization of Infectious Bronchitis virus-like particle expression in Nicotiana

benthamiana as potential poultry vaccines”. The study should include experiments to show

the VLP as potential vaccines. The successful expression of S protein and HI experiment are

not enough to demonstrate it is potential vaccines.

We completely disagree with Dr Ying’s view that successful expression of the S protein, and indeed

the proof we presented in the study that S-specific antibodies are raised in chickens immunized

with this VLP (as shown by HI), are insufficient to demonstrate the VLP’s potential as a vaccine.

It is very well known that the levels of coronavirus S-protein antibodies provide a predictive

correlate of protection in the host. With regard to the first sentence, the H120 vaccine is one of

many applied in the poultry industry globally, and is not a benchmark for establishing IBV vaccine

efficacy. Furthermore, the use of the word “Potential” in the title is deliberate.

We also, in our prior rebuttal, carefully explained that this study, which focused on optimising the

Gammacoronavirus VLP expression in planta (which, we point out again, is a world first) was

followed up by a vaccine-challenge study. For your confidential information, we attach a copy of

our submitted manuscript, to prove to you that these two manuscripts are intended to be

complimentary studies. There was too much information to describe all our processes and results

in a single paper, hence our decision to split it into an optimisation study (for a “potential”

vaccine), followed by the in vitro vaccine-challenge study with the optimised VLP.

To support our manuscript’s acceptance to PLOS ONE in its current form, we must point out that

two expert reviewers for PLOS ONE have already approved this manuscript. Ms Sepotokele is a

PhD candidate, and her thesis in which this work was presented has already been examined and

passed. I can confidentially disclose that the data in this manuscript was additionally reviewed

and approved by two external examiners (and an internal examiner). The two external examiners

were Prof. Janet Daly from Nottingham University, who is a leading world expert in veterinary

vaccine development (including plant VLPs), and Prof Inge Hitzeroth from the University of

Cape Town, who is a leading expert in plant-based vaccine development.

In conclusion, I am respectfully requesting that all of the abovementioned reasons and explanations

are taken into account, and that you exercise your discretion as the academic editor to make a final

decision on whether or not our manuscript will be accepted to PLOS ONE in its current form.

Yours sincerely,

Prof. Celia Abolnik

NRF-DSI SARChI- Poultry Health and Production

PhD Promotor

Email: celia.abolnik@up.ac.za

Attachment

Submitted filename: Response to reviewers and editor 260523.docx

Click here for additional data file.^{(14.9KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0288970.r005

Decision Letter 2

Haitham Mohamed Amer

19 Jun 2023

PONE-D-23-05238R2Optimization of Infectious Bronchitis virus-like particle expression in Nicotiana benthamiana as potential poultry vaccinesPLOS ONE

Dear Dr. Sepotokele,

Please submit your revised manuscript by Aug 03 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Haitham Mohamed Amer, PhD

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: All comments have been addressed

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Reviewer #1: I was happy with the authors' modifications after the first round of reviews. I'm still ok with this manuscript being published.

Reviewer #3: This is a resubmission of a manuscript that has already been reviewed twice. From the correspondence associated with this latest version, it appears that although Reviewer 1 for second revision was happy with the changes made, Reviewer 2 (Dr. Liao Ying) was still not satisfied. Given that this manuscript has already been extensively reviewed by others, I will concentrate on the outstanding issues raised by Dr. Ying.

1. I disagree with the comment of Dr. Ying that there are no clear bands in the western blot in Fig. 1B. The bands corresponding to the full-length S protein are clearly visible in lanes 8-15, as are higher molecular weight forms which are commonly seen with multimeric proteins. The fact that the positive control does not give a clear band representing full-length S protein is really neither here nor there - it would only be an issue if no bands were seen in the test samples.

That said, I feel the authors do not do themselves any favours by not mentioning the absolutely obvious band at around 50kDa in lanes 4-7. This is also present in the positive control. This most probably represents the cleaved form of the S protein (S1 and/or S2) and such cleavage has been reported previously with plant expressed SARS-CoV-2 S protein (see Fig 2 oof reference [30]. The fact that this cleavage appears to be greatly reduced with the modified S protein (lanes 8-15) validates the authors' modification strategy and this should highlighted. At any rate the appearance of the 50kDa product must be discussed.

Two more minor points:

I do think that the S protein can be described as being comprised of two "subunits". This implies separately synthesised polypeptides which - the usual description is two "domains".

Fig.1 would greatly benefit from having a simple version of the constructs shown as an addition panel (C?). This would greatly assist the reader and avoid the necessity for constantly cross-referencing with the SI.

2. I have no problem with the immunological analysis as presented in the revised ms.

3. From the correspondence, it is clear the authors have additional information about the immunological properties of their VLPs which they wish to present in a separate MS. Though I appreciate their desire to present the work in two papers, I really thing the data would be better combined, especially as the current MS is so short (only 3 figures!). I think one MS would make far greater impact overall and I urge the authors to consider this.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #3: Yes: George P. Lomonossoff

**********

PLoS One. 2023 Jul 20;18(7):e0288970. doi: 10.1371/journal.pone.0288970.r006

Author response to Decision Letter 2

26 Jun 2023

Response to Reviewers PLOS One

Reviewer #1: I was happy with the authors' modifications after the first round of reviews. I'm still ok with this manuscript being published.

RESPONSE: Thank you.

RESPONSE: The bands present in lanes 4-7 at around 50 kDa (Western blot Fig. 1B), were thought to correlate to the highly conserved 45 kDa IBV Nucleocapsid protein, which would be present in the positive control because the positive control contains it. The reason this protein was only observed in lanes 4-7, was because those lanes contained the mIBV-S2P VLPs that had been produced by co-infiltrating with the IBV Membrane, Envelope, and Nucleocapsid proteins. It is not present in lanes 8-15 because constructs mIBV-S2P-IAV-H6TM/CT (8-11) and mIBV-S2P-NDV-FTM/CT (12-15) were not co-infiltrated with the IBV M, E, and N proteins, but co-infiltrated with accessory proteins corresponding to IAV and NDV instead.

This was discussed in lines 257-260. No further changes made.

Two more minor points:

I do think that the S protein can be described as being comprised of two "subunits". This implies separately synthesised polypeptides which - the usual description is two "domains".

RESPONSE: “subunit/s” has been replaced with “domain/s” where necessary.

RESPONSE: Thank you for the suggestion. Fig 1. has now been amended to include an additional panel C, which contains the constructs. Fig S3 has accordingly been removed to avoid repetition.

2. I have no problem with the immunological analysis as presented in the revised ms.

RESPONSE: Thank you.

RESPONSE: While we do understand this concern, the present manuscript covers the extensive work and technical details (multiple constructs and combinations of accessory proteins) that went into obtaining successful IBV VLP expression for the first time (which is novel), and we demonstrated the immunogenicity in chickens to prove that the S protein is properly folded and presented on the VLP. The second manuscript is a classical vaccine-efficacy study that is more suited to a veterinary journal, and we felt that with a single paper those reviewers might consider the in-depth description of how the VLP was developed of less interest to veterinarians and poultry scientists, and consequently request that the developmental data (that is of interest to plant scientists designing such VLPs) be removed. For this reason, we deemed it necessary to publish these aspects of the studies separately.

The second manuscript that was submitted to “Poultry Science” has already been reviewed and we are busy preparing a revised version that incorporates those reviewers’ suggested changes, therefore we are unwilling to withdraw it at this stage in order to incorporate the data here (along with the other reason we describe above). We hope that Prof. Lomonossoff is satisfied with this explanation.

Attachment

Submitted filename: Response to Reviewers PLOS One 260623.docx

Click here for additional data file.^{(17.8KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0288970.r007

Decision Letter 3

Haitham Mohamed Amer

10 Jul 2023

Optimization of Infectious Bronchitis virus-like particle expression in Nicotiana benthamiana as potential poultry vaccines

PONE-D-23-05238R3

Dear Dr. Sepotokele

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Haitham Mohamed Amer, PhD

Academic Editor

PLOS ONE

PLoS One. doi: 10.1371/journal.pone.0288970.r008

Acceptance letter

Haitham Mohamed Amer

12 Jul 2023

PONE-D-23-05238R3

Optimization of Infectious Bronchitis virus-like particle expression in Nicotiana benthamiana as potential poultry vaccines

Dear Dr. Sepotokele:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Haitham Mohamed Amer

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Protein sequence of the synthetic gene mIBV-S2P.

(DOCX)

Click here for additional data file.^{(12.4KB, docx)}

S2 Fig

(DOCX)

Click here for additional data file.^{(13.3KB, docx)}

S3 Fig. Densitometric analysis by SDS-PAGE of partially-purified mIBV-S2P-NDV-F^TM/CT VLPs.

(DOCX)

Click here for additional data file.^{(794.1KB, docx)}

(PNG)

Click here for additional data file.^{(8.5MB, png)}

S5 Fig. Original uncropped, unedited Western blot (B) of partially-purified plant-produced IBV S protein (Primary antibody–IBV antisera, secondary antibody—Goat-α-Chicken IgY HRP).

(TIF)

Click here for additional data file.^{(12.9MB, tif)}

S1 Raw images

(PDF)

Click here for additional data file.^{(970.1KB, pdf)}

Attachment

Submitted filename: Plos one manuscript review comment.docx

Click here for additional data file.^{(13.9KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(25.6KB, docx)}

Attachment

Submitted filename: Response to reviewers and editor 260523.docx

Click here for additional data file.^{(14.9KB, docx)}

Attachment

Submitted filename: Response to Reviewers PLOS One 260623.docx

Click here for additional data file.^{(17.8KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0288970.ref001] 1.World Bank & TAFS-Forum. (2011). World livestock disease atlas: A quantitative analysis of global animal health data (H. S. N. The World Bank, Washington, DC 20433, USA Ed.). (available online—accessed July 2022).

[pone.0288970.ref002] 2.Liu G., Lv L., Yin L., Li X., Luo D., Liu K., et al. (2013). Assembly and immunogenicity of coronavirus-like particles carrying infectious bronchitis virus M and S proteins. Vaccine 31. 5524–5530. doi: 10.1016/j.vaccine.2013.09.024 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref003] 3.Cavanagh D., and Gelb J. Jr (2008). Infectious Bronchitis. In Saif Y. M., Fadly A. M., Glisson J. R., McDougald L. R., Nolan L. K., Swayne D. E. (Eds). Diseases of Poultry. Wiley-Blackwell, Ames, IA, USA, 117–135. [Google Scholar]

[pone.0288970.ref004] 4.Jackwood M. W., and de Wit S. (2013). Infectious Bronchitis. Diseases of Poultry. Chapter b. 139–153. [Google Scholar]

[pone.0288970.ref005] 5.Ujike M., and Taguchi F. (2015). Incorporation of Spike and Membrane glycoproteins into coronavirus virions. Viruses 7. 1700–1725. doi: 10.3390/v7041700 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref006] 6.Kant A., Koch G., van Roozelaar D. J., Kusters J. G., Poelwijk F. A., and van der Zeijst B. A. (1992). Location of antigenic sites defined by neutralizing monoclonal antibodies on the S1 avian infectious bronchitis virus glycopolypeptide. Journal of General Virology 73 (Pt 3). 591–596. doi: 10.1099/0022-1317-73-3-591 [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref007] 7.Jara M., Crespo R., Roberts D. L., Chapman A., Banda A., and Machado G. (2021). Development of a Dissemination Platform for Spatiotemporal and Phylogenetic Analysis of Avian Infectious Bronchitis Virus. Frontiers in Veterinary Science 8. Article 624233. 1–12. doi: 10.3389/fvets.2021.624233 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref008] 8.de Wit J. J. S., Cook J. K. A., and van der Heijden H. M. (2011). Infectious bronchitis virus variants: a review of the history, current situation and control measures. Avian Pathology 40. 223–235. doi: 10.1080/03079457.2011.566260 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref009] 9.Erfanmanesh A., Ghalyanchilangeroudi A., Nikaein D., Hosseini H., and Mohajerfar T. (2020). Evaluation of inactivated vaccine of the variant 2 (IS-1494 /GI-23) genotype of avian infectious bronchitis. Comp Immunol Microbiol Infect Dis. 71. 101497. doi: 10.1016/j.cimid.2020.101497 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref010] 10.WOAH, 2019. Avian infectious bronchitis. WOAH Terrestrial Manual, Chapter 3.3.2. 796–809. https://www.woah.org/en/disease/avian-infectious-bronchitis/

[pone.0288970.ref011] 11.Jordan B. (2017). Vaccination against infectious bronchitis virus: a continuous challenge. Veterinary Microbiology. 1–7. doi: 10.1016/j.vetmic.2017.01.002 [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref012] 12.McGinnes L. W., and Morrison T. G. (2014). Newcastle disease virus-like particles: Preparation, Purification, Quantification, and Incorporation of Foreign Glycoproteins. Curr Protoc Microbiol 30. 1–28. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref013] 13.Ong H. K., Tan W. S., and Ho K. L. (2017). Virus like particles as a platform for cancer vaccine development. Peer J. 1–31. doi: 10.7717/peerj.4053 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref014] 14.Blokhina E. A., Kupriyanov V. V., Ravin N. V., and Skryabin K. G. (2013). The Method of Noncovalent in vitro Binding of Target Proteins to Virus-Like Nanoparticles Formed by Core Antigen of Hepatitis B. Virus. Dokl Akad Nauk 448. 719–721. [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref015] 15.Ukrami A., Sakurai A., Ishikawa M., Yap M. L., Flores-Garcia Y., Haseda Y., et al. (2017). Development of a novel virus-like particle vaccine platform that mimics the immature form of alphavirus. Clinical and Vaccine Immunology 24. Issue 7. 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref016] 16.Zdanowicz M., and Chroboczek J. (2016). Virus-like particles as drug vectors. Acta biochimica Polonica 63. No 3. 469–473. [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref017] 17.Lv L., Li X., Liu G., Li R., Liu Q., Shen H., et al. (2014). Production and immunogenicity of chimeric virus-like particles containing the spike glycoprotein of infectious bronchitis virus. J. Vet. Sci 15 (2). 209–216. doi: 10.4142/jvs.2014.15.2.209 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref018] 18.Wu X., Zhai X., Lai Y., Zuo L., Zhang Y., Mei X., et al. (2019). Construction and immunogenicity of novel chimeric virus-like particles bearing antigens of infectious bronchitis virus and Newcastle disease virus. Viruses 11 (254). 1–13. doi: 10.3390/v11030254 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref019] 19.Xu P., Wu X., Wang H., Ma B., Ding M., and Yang X. (2016). Assembly and immunogenicity of baculovirus-derived infectious bronchitis virus-like particles carrying membrane, envelope and the recombinant spike proteins. Biotechnol Lett 38. 299–304. doi: 10.1007/s10529-015-1973-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref020] 20.D’Aoust M., Lavoie P., Couture M. M., Trépanier S., Guay J., Dargis M., et al. (2008). Influenza virus-like particles produced by transient expression in Nicotiana benthamiana induce a protective immune response against a lethal viral challenge in mice. Plant Biotechnology Journal 6. 930–940. [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref021] 21.Peyret H., Steele J. F. C., Jung J. W., Thuenemann E. C., Meshcheriakova Y., and Lomonossoff G. P. (2021). Producing Vaccines against Enveloped Viruses in Plants: Making the Impossible, Difficult. Vaccines 9 (7). 780. doi: 10.3390/vaccines9070780 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref022] 22.Rybicki E. P. (2009). Plant-produced vaccines: promise and reality. Drug Discov. Today 14. 16–24. doi: 10.1016/j.drudis.2008.10.002 [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref023] 23.Smith T., O’Kennedy M. M., Wandrag D. B. R., Adeyemi M., and Abolnik C. (2019). Efficacy of a plant-produced virus-like particle vaccine in chickens challenged with Influenza A H6N2 virus. Plant Biotechnology Journal. 1–11. doi: 10.1111/pbi.13219 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref024] 24.Stoger E., Fischer R., Moloney M., and Ma J. K. (2014). Plant molecular pharming for the treatment of chronic and infectious diseases. Annu. Rev. Plant Biol. 65. 743–768. doi: 10.1146/annurev-arplant-050213-035850 [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref025] 25.Thuenemann E. C., Meyers A. E., Verwey J., Rybicki E. P., and Lomonossoff G. P. (2013). A method for rapid production of heteromultimeric protein complexes in plants: assembly of protective bluetongue virus-like particles. Plant Biotechnology Journal. 1–8. doi: 10.1111/pbi.12076 [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref026] 26.Moustafa K., Makhzoum A., and Tremouillaux-Guiller J. (2016). Molecular farming on rescue of pharma industry for next generations. Crit. Rev. Biotechnol 36. 840–850. doi: 10.3109/07388551.2015.1049934 [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref027] 27.D’Aoust M., Couture M. M. J., Charland N., Trépanier S., Landry N., Ors F., et al. (2010). The production of hemagglutinin-based virus-like particles in plants: a rapid, efficient and safe response to pandemic influenza. Plant Biotechnology Journal 8. 607–619. doi: 10.1111/j.1467-7652.2009.00496.x [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref028] 28.Pallesen J., Wang N., Corbett K. S., Wrapp D., Kirchdoerfer R. N., Turner H. L., et al. (2017). Immunogenicity and structures of a rationally designed prefusion MERS-CoV spike antigen. Proceedings of the National Academy of Sciences of the United States of America 114, E7348–e7357. doi: 10.1073/pnas.1707304114 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref029] 29.Ward B. J., Gobeil P., Séguin A., Atkins J., Boulay I., Charbonneau P. Y., et al. (2021). Phase 1 randomized trial of a plant-derived virus-like particle vaccine for COVID-19. Nat Med. 27 (6). 1071–1078. doi: 10.1038/s41591-021-01370-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref030] 30.Jung J., Zahmanova G., Minkov I., and Lomonossoff G. P. (2022). Plant-based expression and characterization of SARS-CoV-2 virus-like particles presenting a native spike protein. Plant Biotechnology Journal 20. 1363–1372. doi: 10.1111/pbi.13813 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref031] 31.Sepotokele, K. M. (2020). Towards producing infectious bronchitis virus-like particles in plants as potential vaccine candidates. MSc Dissertation, University of Pretoria. Accessible at: https://repository.up.ac.za/handle/2263/86941.

[pone.0288970.ref032] 32.O’Hara J. M., Whaley K., Pauly M., Zeitlin L., and Mantis N. J, (2012). Plant-based expression of a partially humanized neutralizing monoclonal IgG directed against an immunodom-inant epitope on the ricin toxin A subunit. Vaccine 30 (7). 1239–1243. doi: 10.1016/j.vaccine.2011.12.058 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref033] 33.Abolnik C., O’Kennedy M. M., Murphy M-A., and Wandrag D. B. R. W. (2022). Efficacy of a plant-produced clade 2.3.4.4 H5 influenza virus-like particle vaccine in layer hens. Veterinary Vaccines. In press. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref034] 34.Sainsbury F., Thuenemann E. C., and Lomonossoff G. P. (2009). pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotechnology Journal 7. 682–693. doi: 10.1111/j.1467-7652.2009.00434.x [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref035] 35.Miller J. H, (1972). Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. [Google Scholar]

[pone.0288970.ref036] 36.Jutras P. V., D’Aoust M., Couture M. M., Vézina L., Goulet M., Michaud D., et al. (2015). Modulating secretory pathway pH by proton channel co-expression can increase recombinant protein stability in plants. Biotechnology Journal 10. 1–9. doi: 10.1002/biot.201500056 [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref037] 37.Strasser R., Stadlmann J., Schähs M., Stiegler G., Quendler H., Mach L., et al. (2008). Generation of glycol-engineered Nicotiana benthamiana for the production of monoclonal antibodies with a homogeneous human-like N-glycan structure. Plant Biotechnology Journal 6. 392–402. [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref038] 38.Shevchenko A., Tomas H., Havlis J., Olsen J. V., and Mann M. (2007). In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nature Protocols 1 (6). 2856–2860. [DOI] [PubMed] [Google Scholar]

[pone.0288970.ref039] 39.Ruano M., El-Attrache J., and Villegas P. (2000) A rapid-plate hemagglutination assay for the detection of infectious bronchitis virus. Avian Dis. 44. 99–104. [PubMed] [Google Scholar]

[pone.0288970.ref040] 40.Castells-Graells R., and Lomonossoff G. P. (2021). Plant-based production can result in covalent cross-linking of proteins. Plant Biotechnology Journal 19. 1095–1097. doi: 10.1111/pbi.13598 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref041] 41.Cavanagh D. (2003). Severe acute respiratory syndrome vaccine development: experiences of vaccination against avian infectious bronchitis coronavirus. Avian Pathology 32. 567–582. doi: 10.1080/03079450310001621198 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref042] 42.Williams A. K., Wang L., Sneed L. W., and Collisson E. W. (1992). Comparative analysis of the nucleocapsid genes of several strains of infectious bronchitis virus and other coronaviruses. Virus Res. 25. 213–222. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref043] 43.Battisti A. J., Meng G., Winkler D. C., McGinnes L. W., Plevka P., Steven A. C., et al. (2012). Structure and assembly of a paramyxovirus matrix protein. Proc Natl Acad Sci 109. 13996–14000. doi: 10.1073/pnas.1210275109 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref044] 44.Chen B. J., Leser G. P., Morita E., and Lamb R. A. (2007). Influenza virus hemagglutinin and neuraminidase, but not the matrix protein, are required for assembly and budding of plasmid-derived virus-like particles. J. Virol. 81. 7111–7123. doi: 10.1128/JVI.00361-07 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0288970.ref045] 45.Temiz S. A., Abdelmaksoud A., Dursun R., and Vestita M. (2021). Acral chilblain-like lesions following inactivated SARS-CoV-2 vaccination. Int J Dermatol. 60 (9). 1152–1153. doi: 10.1111/ijd.15619 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Optimization of infectious bronchitis virus-like particle expression in Nicotiana benthamiana as potential poultry vaccines

Kamogelo M Sepotokele

Martha M O’Kennedy

Daniel B R Wandrag

Celia Abolnik

Roles

Abstract

Introduction

Methods

Recombinant plasmid design and construction

Fig 1.

Table 1. Primers used for synthetic construct design.

Agroinfiltration

Protein extraction and purification

Analysis by SDS PAGE, Western blot and LC-MS/MS

Transmission electron microscopy

S protein quantitation

Immunization of chickens

Serological testing

Results

Agroinfiltration and protein expression

Fig 2. Negative-stained transmission electron microscopy images of (A) live QX-like IBV strain ck/ZA/3665/11 and (B) IBV virus-like particles expressed with the mIBV-S2P-NDV-FTM/CT construct in N. benthamiana.

Immunogenicity in chickens

Fig 3. Hemagglutination inhibition (HI) titres for chicken sera after a single vaccination with 5 and 20 μg doses of IB VLPs.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Haitham Mohamed Amer

Roles

Author response to Decision Letter 0

Decision Letter 1

Haitham Mohamed Amer

Roles

Author response to Decision Letter 1

Decision Letter 2

Haitham Mohamed Amer

Roles

Author response to Decision Letter 2

Decision Letter 3

Haitham Mohamed Amer

Roles

Acceptance letter

Haitham Mohamed Amer

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases

Fig 2. Negative-stained transmission electron microscopy images of (A) live QX-like IBV strain ck/ZA/3665/11 and (B) IBV virus-like particles expressed with the mIBV-S2P-NDV-F^TM/CT construct in N. benthamiana.