Skip to main content
Orphanet Journal of Rare Diseases logoLink to Orphanet Journal of Rare Diseases
. 2023 Jul 21;18:200. doi: 10.1186/s13023-023-02816-0

Congenital coralliform cataract is the predominant consequence of a recurrent mutation in the CRYGD gene

Kai-Jie Wang 1, Jue-Xue Wang 1, Jin-Da Wang 1, Meng Li 1, Jing-Shang Zhang 1, Ying-Yan Mao 1, Xiu-Hua Wan 1,2,
PMCID: PMC10362579  PMID: 37480084

Abstract

Background

Congenital cataract is a leading cause of treatable childhood blindness and both clinically and genetically heterogeneous. Among the already characterized phenotypes, coralliform cataract is a rare special form of congenital cataracts. Although previous studies had shown that mutations in the γD-crystallin (CRYGD) can result in congenital coralliform cataracts, no conclusive genotype-phenotype correlation might be drawn. Here we aimed to identify the spectrum and frequency of CRYGD gene mutations in congenital coralliform cataracts of Chinese origin.

Methods

The medical records of 392 Chinese families with congenital cataracts were reviewed between January 2011 and December 2021. The families, clinically documented to have congenital coralliform cataracts, were screened for mutations in candidate CRYGD gene. The genomic DNA of all subjects was extracted from peripheral blood leukocytes. PCR amplified and direct sequencing were performed to identify the disease-causing mutation.

Results

A total of 12 families with coralliform cataracts were recruited in this study in the past 10 years, accounting for 3.1% of the families with congenital cataracts. Of the 12 families, all affected individuals presented with bilateral non-progressive coralliform cataracts since birth, with the best-corrected Snellen visual acuities ranging from 20/200 to 20/25. A recurrent c.70 C > A (p. P24T) mutation in CRYGD was identified in 10 families (83.3%) with congenital cataract, which co-segregated with all affected individuals and was not observed in unaffected family members or ethnically matched normal controls.

Conclusions

The coralliform cataract is characterized by being bilateral, non-progressive and present at birth. A recurrent p.P24T CRYGD mutation occurs independently in 83.3% of the Chinese families with congenital coralliform cataracts and most likely represents a mutational hot spot, which underscore the relations between coralliform cataract and p.P24T CRYGD.

Keywords: Coralliform cataract, CRYGD, Mutation

Background

Congenital cataract (CC), which refers to any opacification of the lens, is usually onset at birth or during one year after birth. It has been reported as one of the most common causes of blindness and severe visual impairment in childhood worldwide [1], with the overall prevalence of 0.63 to 9.74/10 000 children [2]. Wu et al. estimated the global CC prevalence to be 4.24/10,000, with the highest prevalence observed in Asia (7.43/10 000), followed by the USA (4.39/10 000), Europe (3.41/10 000) and Australia (2.23/10 000) [3]. A multicenter neonatal eye screening program in China reported CC accounted for 1.24% among 13,514 abnormal cases in 64 632 newborns [4].

The etiologies of CC are diverse and complicated. About one third of isolated congenital cataracts are genetically determined, of which autosomal dominant congenital cataract (ADCC) is the most common mode of inheritance [5, 6]. Clinical and genetic heterogeneity of congenital cataracts are well substantiated [6]. To date, at least 43 genes (http://cat-map.wustl.edu/) have been reported to be associated with various forms of isolated CC, including genes encoding crystallins, membrane proteins, transcription factors, cytoskeletal proteins and others [7]. Of the cataract mutations reported to date, about half of them involve mutations in crystallins, a quarter in connexins, and the rest divide among the other genes [1]. Crystallins play an important role in maintaining lens transparency, which constitute 90% of the lens proteins [8]. Mutations in major crystallin genes such as γ-crystallin (CRYG) in humans have been well documented. Among the already characterized phenotypes, coralliform cataract is a rare special form of congenital cataracts with a ‘coral-like’ pattern of opacity in the lens. Previous studies had shown that mutations in the CRYGD gene can result in congenital coralliform cataracts [914], although an insertional mutation in the connexin 46 had also been identified causing coralliform cataract in a Chinese family [15]. Therefore, it is appropriate to consider the CRYGD gene as the top list of functional candidates in congenital coralliform cataracts.

In this study, a total of 12 genetically unrelated families with autosomal dominant coralliform cataract were identified in the past 10 years. We performed the molecular analysis of the families with coralliform cataract to identify the CRYGD mutation spectrum and further analyze the genotype-phenotype correlations in Chinese families.

Methods

Subjects

This study was approved by the Medical Ethics Committee of Beijing Tongren Hospital and in accordance with the tenets of the Declaration of Helsinki. Twelve families with congenital coralliform cataracts were recruited at Beijing Tongren Hospital (Capital Medical University, Beijing, China), from January 2011 to December 2021. Both affected and unaffected individuals were subject to detailed ophthalmic examinations, including visual acuity, intraocular pressure, slit-lamp examinations; A-scan and B-scan ultrasonography; and fundus photochromy. No evidence of systemic abnormalities and other history of disease were examined in the probands. Unrelated control subjects were recruited from people who attended Beijing Tongren Hospital for eye examinations and aged older than 60 years without other eye diseases, except mild senile cataracts and mild refractive errors. Blood samples were collected from all participants after signing informed consent. Peripheral venous blood was collected for genomic DNA extraction using QIAamp DNA kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol.

Mutation analysis

PCR amplification was performed in the coding exons and splice sites of CRYGD gene (Genbank NM_006891.4) using primer pairs listed in Table 1. After purification, the PCR products were sequenced using an ABI3730 Automated Sequencer (PE Biosystems, Foster City, CA) to analyze the cosegregation of the genotype with the disease phenotype.

Table 1.

Primer sequences for CRYGD

Amplicon Forward Primers (5′→3′) Reverse Primers (5′→3′)
1 CAACAAGCCCCGTGGTCTA GGGTCCTGACTTGAGGATG
2 GCTTTTCTTCTCTTTTTATTTCTG AAGAAAGACACAAGCAAATCAG

Forward and reverse primer sequences were provided for each amplicon of the CRYGD gene

The sequence of CRYGD in the probands was compared to the reference sequence (Genbank NM_006891.4) and potentially disease-causing variants were assessed for segregation with the disease in Sanger-sequenced affected and unaffected family members. The Genome Aggregation Database (gnomAD) v3.1.2 (https://gnomad.broadinstitute.org/) was used for variant analysis. Cat-Map (https://cat-map.wustl.edu/, accessed on 1 February 2023), an online chromosome map and reference database for cataract in humans, was used to search for previous variant descriptions and clinical associations.

Results

Clinical findings

A total of 392 families with CC were identified in 2011–2021, twelve of them (3.1%) with coralliform cataracts. Of the 12 families, they were all from different ethnic groups in China, and all affected individuals had the same cataract phenotype, showing bilateral coralliform shape opacification characterized by the white opaque involving the central portion of the lens to a variable extent, with appearance resembling the coralliform shape (Fig. 1). A review of ophthalmic records indicated that bilateral and symmetrical cataracts were diagnosed at birth in all 12 families but were without progressive development of lens opacities, necessitating cataract extraction. The best-corrected Snellen visual acuities of the probands ranged from 20/200 to 20/25, with age-at-surgery ranging from 1 year to 17 years. The clinical characteristics of the probands in 12 families were summarized in Table 2.

Fig. 1.

Fig. 1

Slit lamp photographs of the probands identified p.P24T mutation. The photographs of the probands show coralliform shape opacification characterized by the white opaque involving the central portion of the lens

Table 2.

Clinical characteristics of the probands in our study

Family ID Phenotype Description Age of onset BCVA (OD;OS) Age at surgery(years) Inheritance Pattern Affected(N)/
Unaffected(N)

CC02

CC07

CC21

CC47

CC165

CC198

CC241*

CC248

CC281

CC302*

CC345

CC382

coralliform

coralliform

coralliform

coralliform

coralliform

coralliform

coralliform

coralliform(cataract extraction)

coralliform

coralliform

coralliform

coralliform

SB

SB

SB

SB

SB

SB

SB

SB

SB

SB

SB

SB

20/40; 20/50

20/40; 20/40

20/25; 20/25

20/200; 20/200

20/100; 20/200

20/100; 20/60

20/100; 20/100

20/200; 20/200

20/50; 20/40

20/200; 20/200

20/30; 20/30

20/30; 20/40

Not

17

Not

5

10

5

7

1

Not

7

Not

Not

AD

AD

AD

AD

AD

AD

AD

AD

AD

AD

AD

AD

7/10

7/9

9/13

5/11

6/7

4/10

4/9

5/7

3/4

2/5

3/4

5/6

SB, since birth; BCVA, best corrected visual acuity; AD, autosomal dominant; OD, oculus dexter; OS, oculus sinister

*No mutation found in CRYGD

Mutation analysis

Direct sequencing of the entire coding region of CRYGD in 12 unrelated families with CC identified a recurrent c. 70 C > A mutation in 10 unrelated families (Fig. 2), which resulted in the substitution of proline at position 24 by threonine (p. P24T; Fig. 3). This variant was cosegregated with all affected individuals, and was not detected in any of the unaffected individuals or 110 normal controls. The variant had no or very low allele frequency in the gnomAD database, with a frequency of 0.003338% in South Asian population, but not detected in all the other populations of African/African-American, Latino/Admixed American, Ashkenazi Jewish, East Asian and European.

Fig. 2.

Fig. 2

Pedigrees of the families identified mutations in this study. Squares and circles indicate males and females, respectively. Blackened symbols denote affected status. The proband is denoted by an arrow, and asterisks indicate participants enrolled in this study

Fig. 3.

Fig. 3

DNA sequence chromatograms. A single variant is observed at position 70 (C > A) as a C/A double peak (indicated by an arrow)

This study identified the p.P24T CRYGD mutation in 10 of 12 families from Chinese affected by coralliform cataracts, accounting for 83.3% of coralliform cataracts in this group of families. In contrast, no causative mutation in CRYGD gene was observed in family CC241 and CC302, which needed to be further investigated for the causative mutations.

Discussion

In this study, we identified 12 families with bilateral and symmetrical congenital coralliform cataract in 392 CC families. To explore the relations between the CRYGD mutation and coralliform phenotype, the entire coding region of CRYGD in 12 unrelated Chinese families were sequenced. We identified a recurrent p.P24T mutation in 10 of 12 unrelated families, accounting for 83.3% of coralliform cataracts, and no other mutations in CRYGD were detected, which indicated that CRYGD might play an important role in the development of congenital coralliform cataract.

Crystallins are the predominant structural proteins in the human lens, comprised by two families with different characteristics: the α-crystallins, functioning as chaperones, and the βγ-crystallins, sharing the same structural unit “Greek key motif” [8]. As the smallest and simplest members of crystallins, γ-crystallins are mainly distributed in the nuclear region of the lens, and have two-domain structures with two Greek key motifs [16]. The solubility and stability of γD-crystallin is indispensable for the lens transparency. Mutation in CRYGD gene may destroy the solubility and stability of the crystallin proteins, subsequently reduce lens transparency causing CC.

Results of functional studies had shown that the p.P24T mutant protein had a significantly lower solubility compared with wild-type γD-crystallin [17]. Boatz et al. found that p.P24T variant aggregated under in vivo conditions with a native-like fold by a non-amyloid mechanism, which was considered to be the surface-mediated changes in protein–protein interactions [18]. Li et al. revealed that p.P24T mutant changed a pyrrole ring of the wild type into a hydrophilic structure, affecting the correct folding of the protein [19]. The findings presumed that the p.P24T might initiate aggregation or polymerization and result in the formation of CC.

Until now, at least 27 mutations in CRYGD gene, including p.P24T, have been reported to be associated with CC (http://cat-map.wustl.edu/). Different mutations presented with various phenotypes because of genotypic heterogeneity. For example, p.Y56X, p.R36P and p.R140X mutations were reported to be associated with nuclear cataract; the p.R77S was related with anterior polar coronary cataract; the p.R140X caused total cataract; p.W157X resulted in lamellar cataract [2025]. In this study, we identified the p.P24T mutation in 83.3% of the Chinese families with coralliform cataract. Of interest, no mutation in CRYGD gene was observed in other two families, suggesting that the CRYGD might be the most common mutated gene in patients with coralliform cataract. This mutation had also been found independently in more than 20 pedigrees of different origin, as listed in Table 3. Among them, Yang et al. identified the p.P24T mutation in two Chinese families and compared the disease-associated haplotypes by analyzing microsatellites closely flanking the CRYGD gene. A different haplotype was found in the two families, strongly suggesting p.P24T may be a mutational hot spot but not a common founder [14]. In this study, our ten p.P24T-bearing families were from different ethnic groups in China. The distribution patterns together with reported haplotype data further supported this finding. However, the mechanism responsible for the increased mutation rate at position 24 needed to be further investigated.

Table 3.

Summary of identified p.P24T mutation in the CRYGD

Mode of Inheritance Morphology of Cataract Other Phenotypes Pedigrees Origin Reference
AD lamellar non-syndromic 1 Indian [26]
AD cerulean blue dot non-syndromic 1 Moroccan [27]
AD silica-like nuclear non-syndromic 1 Australia [28]
AD coralliform non-syndromic 1 Chinese [11]
AD coralliform or axial non-syndromic 1 Caucasian [12]
AD fasciculiform non-syndromic 1 Chinese [29]
AD coralliform and cerulean non-syndromic 2 Saudi [13]
AD coralliform non-syndromic 2 Chinese [14]
AD aculeiform non-syndromic 1 Indian [30]
AD coralliform non-syndromic 1 Chinese [31]
AD coralliform non-syndromic 1 Caucasian-American [10]
AD unknown 1 Australia [32]
AD coralliform non-syndromic 2 Chinese [33]
AD coralliform nystagmus 1 Chinese [34]
AD coralliform non-syndromic 1 Chinese [35]
AD unkonwn non-syndromic 1 Chinese [24]
AD unkonwn 1 Chinese [36]
AD coralliform iris coloboma 1 Chinese [19]
AD Coralliform/ lamellar non-syndromic 2 Chinese [37]
AD unknown 1 UK [38]
AD total non-syndromic 1 Turkey [39]
AD coralliform non-syndromic 2 Chinese [9]

AD. autosomal dominant

p.P24T was also found to be responsible for several different phenotypes of CC except for coralliform cataract, e.g., lamellar cataract, cerulean cataract, the fasciculi form cataract and total cataract [914, 19, 24, 2639]. Although there was variability in cataract phenotypes among the p.P24T-bearing families, coralliform cataract was the most common phenotype, and more importantly, all Chinese families including our ten families were involved coralliform cataract. Additionally, the clinical findings with regard to age of onset and progression were consistent in this study. These results underscored the close relations between non-progressive coralliform cataract and p.P24T CRYGD, at least in the Chinese population.

Conclusions

In this study, 3.1% of 392 CC families had coralliform cataract, which was characterized by being bilateral, non-progressive and present at birth. The recurrent p.P24T CRYGD mutation was identified in 83.3% of the Chinese families with congenital coralliform cataract. Our results suggested that p.P24T mutation might be a mutational hot spot and closely related to the coralliform phenotype, which further provide evident for the molecular diagnosis and genetic counseling.

Acknowledgements

We thank the family members for taking part in this study.

Authors’ contributions

KJW and JXW conceived, analyzed the data, wrote and provided critical revision of the manuscript. JXW performed the experiments. JDW, ML, JSZ and YYM provided critical revision of the manuscript. XHW designed the study and contributed in data analysis. All authors read and approved the final manuscript.

Funding

This work is supported by Beijing Natural Science Foundation (M22021), National Natural Science Foundation of China (82171037) and Beijing Hospitals Authority Clinical medicine Development of special funding support (XMLX202133).

Data Availability

All data generated and analyzed during the study are available in the published manuscript.

Declarations

Competing interests

The authors declare that they have no competing interests.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Beijing Tongren Hospital (Beijing, China) (No. TRECKY2015-118). Informed consent was obtained from all patients for being included in the study.

Consent for publication

Not applicable.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Li J, Chen X, Yan Y, Yao K. Molecular genetics of congenital cataracts. Exp Eye Res. 2020;191:107872. doi: 10.1016/j.exer.2019.107872. [DOI] [PubMed] [Google Scholar]
  • 2.Sheeladevi S, Lawrenson JG, Fielder AR, Suttle CM. Global prevalence of childhood cataract: a systematic review. Eye (Lond) 2016;30:1160–9. doi: 10.1038/eye.2016.156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wu X, Long E, Lin H, Liu Y. Prevalence and epidemiological characteristics of congenital cataract: a systematic review and meta-analysis. Sci Rep. 2016;6:28564. doi: 10.1038/srep28564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Fei P, Liu Z, He L, Li N, Xu L, Zhang M, et al. Early detection of ocular abnormalities in a chinese multicentre neonatal eye screening programme-1-year result. Acta Ophthalmol. 2021;99:e415–e22. doi: 10.1111/aos.14586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Rahi JS, Dezateux C. Congenital and infantile cataract in the United Kingdom: underlying or associated factors. British congenital cataract Interest Group. Invest Ophthalmol Vis Sci. 2000;41:2108–14. [PubMed] [Google Scholar]
  • 6.Messina-Baas O, Cuevas-Covarrubias SA. Inherited congenital cataract: a Guide to suspect the genetic etiology in the Cataract Genesis. Mol Syndromol. 2017;8:58–78. doi: 10.1159/000455752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Reis LM, Semina EV. Genetic landscape of isolated pediatric cataracts: extreme heterogeneity and variable inheritance patterns within genes. Hum Genet. 2019;138:847–63. doi: 10.1007/s00439-018-1932-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hejtmancik JF, Riazuddin SA, McGreal R, Liu W, Cvekl A, Shiels A. Lens Biology and Biochemistry. Prog Mol Biol Transl Sci. 2015;134:169–201. doi: 10.1016/bs.pmbts.2015.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cai SP, Lu L, Wang XZ, Wang Y, He F, Fan N, et al. A mutated CRYGD associated with congenital coralliform cataracts in two chinese pedigrees. Int J Ophthalmol. 2021;14:800–4. doi: 10.18240/ijo.2021.06.03. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mackay DS, Bennett TM, Culican SM, Shiels A. Exome sequencing identifies novel and recurrent mutations in GJA8 and CRYGD associated with inherited cataract. Hum Genomics. 2014;8:19. doi: 10.1186/s40246-014-0019-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Xu WZ, Zheng S, Xu SJ, Huang W, Yao K, Zhang SZ. [Localization and screening of autosomal dominant coralliform cataract associated gene] Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2004;21:19–22. [PubMed] [Google Scholar]
  • 12.Mackay DS, Andley UP, Shiels A. A missense mutation in the gammaD crystallin gene (CRYGD) associated with autosomal dominant “coral-like” cataract linked to chromosome 2q. Mol Vis. 2004;10:155–62. [PubMed] [Google Scholar]
  • 13.Khan AO, Aldahmesh MA, Ghadhfan FE, Al-Mesfer S, Alkuraya FS. Founder heterozygous P23T CRYGD mutation associated with cerulean (and coralliform) cataract in 2 saudi families. Mol Vis. 2009;15:1407–11. [PMC free article] [PubMed] [Google Scholar]
  • 14.Yang G, Xiong C, Li S, Wang Y, Zhao J. A recurrent mutation in CRYGD is associated with autosomal dominant congenital coralliform cataract in two unrelated chinese families. Mol Vis. 2011;17:1085–9. [PMC free article] [PubMed] [Google Scholar]
  • 15.Zhou D, Ji H, Wei Z, Guo L, Li Y, Wang T, et al. A novel insertional mutation in the connexin 46 (gap junction alpha 3) gene associated with autosomal dominant congenital cataract in a chinese family. Mol Vis. 2013;19:789–95. [PMC free article] [PubMed] [Google Scholar]
  • 16.Vendra VP, Khan I, Chandani S, Muniyandi A, Balasubramanian D. Gamma crystallins of the human eye lens. Biochim Biophys Acta. 2016;1860:333–43. doi: 10.1016/j.bbagen.2015.06.007. [DOI] [PubMed] [Google Scholar]
  • 17.Ji F, Koharudin LM, Jung J, Gronenborn AM. Crystal structure of the cataract-causing P23T γD-crystallin mutant. Proteins. 2013;81:1493–8. doi: 10.1002/prot.24321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Boatz JC, Whitley MJ, Li M, Gronenborn AM, van der Wel PCA. Cataract-associated P23T γD-crystallin retains a native-like fold in amorphous-looking aggregates formed at physiological pH. Nat Commun. 2017;8:15137. doi: 10.1038/ncomms15137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Li B, Lu B, Guo X, Hu S, Zhao G, Huang W, et al. Two pathogenic gene mutations identified associating with congenital cataract and Iris Coloboma respectively in a chinese family. J Ophthalmol. 2020;2020:7054315. doi: 10.1155/2020/7054315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Santana A, Waiswol M, Arcieri ES, Cabral de Vasconcellos JP, Barbosa de Melo M. Mutation analysis of CRYAA, CRYGC, and CRYGD associated with autosomal dominant congenital cataract in brazilian families. Mol Vis. 2009;15:793–800. [PMC free article] [PubMed] [Google Scholar]
  • 21.Roshan M, Vijaya PH, Lavanya GR, Shama PK, Santhiya ST, Graw J, et al. A novel human CRYGD mutation in a juvenile autosomal dominant cataract. Mol Vis. 2010;16:887–96. [PMC free article] [PubMed] [Google Scholar]
  • 22.Wang L, Chen X, Lu Y, Wu J, Yang B, Sun X. A novel mutation in γD-crystallin associated with autosomal dominant congenital cataract in a chinese family. Mol Vis. 2011;17:804–9. [PMC free article] [PubMed] [Google Scholar]
  • 23.Zhai Y, Li J, Zhu Y, Xia Y, Wang W, Yu Y, et al. A nonsense mutation of γD-crystallin associated with congenital nuclear and posterior polar cataract in a chinese family. Int J Med Sci. 2014;11:158–63. doi: 10.7150/ijms.7567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li J, Leng Y, Han S, Yan L, Lu C, Luo Y, et al. Clinical and genetic characteristics of chinese patients with familial or sporadic pediatric cataract. Orphanet J Rare Dis. 2018;13:94. doi: 10.1186/s13023-018-0828-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Berry V, Ionides A, Pontikos N, Georgiou M, Yu J, Ocaka LA, et al. The genetic landscape of crystallins in congenital cataract. Orphanet J Rare Dis. 2020;15:333. doi: 10.1186/s13023-020-01613-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Santhiya ST, Shyam Manohar M, Rawlley D, Vijayalakshmi P, Namperumalsamy P, Gopinath PM, et al. Novel mutations in the gamma-crystallin genes cause autosomal dominant congenital cataracts. J Med Genet. 2002;39:352–8. doi: 10.1136/jmg.39.5.352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Nandrot E, Slingsby C, Basak A, Cherif-Chefchaouni M, Benazzouz B, Hajaji Y, et al. Gamma-D crystallin gene (CRYGD) mutation causes autosomal dominant congenital cerulean cataracts. J Med Genet. 2003;40:262–7. doi: 10.1136/jmg.40.4.262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Burdon KP, Wirth MG, Mackey DA, Russell-Eggitt IM, Craig JE, Elder JE, et al. Investigation of crystallin genes in familial cataract, and report of two disease associated mutations. Br J Ophthalmol. 2004;88:79–83. doi: 10.1136/bjo.88.1.79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Shentu X, Yao K, Xu W, Zheng S, Hu S, Gong X. Special fasciculiform cataract caused by a mutation in the gammad-crystallin gene. Mol Vis. 2004;10:233–9. [PubMed] [Google Scholar]
  • 30.Vanita V, Singh D. A missense mutation in CRYGD linked with autosomal dominant congenital cataract of aculeiform type. Mol Cell Biochem. 2012;368:167–72. doi: 10.1007/s11010-012-1355-2. [DOI] [PubMed] [Google Scholar]
  • 31.Jia X, Zhang F, Bai J, Gao L, Zhang X, Sun H, et al. Combinational analysis of linkage and exome sequencing identifies the causative mutation in a chinese family with congenital cataract. BMC Med Genet. 2013;14:107. doi: 10.1186/1471-2350-14-107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ma AS, Grigg JR, Ho G, Prokudin I, Farnsworth E, Holman K, et al. Sporadic and familial congenital cataracts: Mutational Spectrum and New Diagnoses using next-generation sequencing. Hum Mutat. 2016;37:371–84. doi: 10.1002/humu.22948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Yang G, Chen Z, Zhang W, Liu Z, Zhao J. Novel mutations in CRYGD are associated with congenital cataracts in chinese families. Sci Rep. 2016;6:18912. doi: 10.1038/srep18912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Zhai Y, Li J, Yu W, Zhu S, Yu Y, Wu M, et al. Targeted Exome sequencing of congenital cataracts related genes: broadening the mutation spectrum and genotype-phenotype correlations in 27 chinese Han families. Sci Rep. 2017;7:1219. doi: 10.1038/s41598-017-01182-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ma C, Zheng G, Hao L. [Analysis of disease-causing gene mutation in three chinese families with congenital inherited cataract] Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 2018;35:165–8. doi: 10.3760/cma.j.issn.1003-9406.2018.02.004. [DOI] [PubMed] [Google Scholar]
  • 36.Zhuang J, Cao Z, Zhu Y, Liu L, Tong Y, Chen X, et al. Mutation screening of crystallin genes in chinese families with congenital cataracts. Mol Vis. 2019;25:427–37. [PMC free article] [PubMed] [Google Scholar]
  • 37.Fan F, Luo Y, Wu J, Gao C, Liu X, Mei H, et al. The mutation spectrum in familial versus sporadic congenital cataract based on next-generation sequencing. BMC Ophthalmol. 2020;20:361. doi: 10.1186/s12886-020-01567-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Jackson D, Malka S, Harding P, Palma J, Dunbar H, Moosajee M. Molecular diagnostic challenges for non-retinal developmental eye disorders in the United Kingdom. Am J Med Genet C Semin Med Genet. 2020;184:578–89. doi: 10.1002/ajmg.c.31837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Taylan Sekeroglu H, Karaosmanoglu B, Taskiran EZ, Simsek Kiper PO, Alikasifoglu M, Boduroglu K, et al. Molecular etiology of isolated congenital cataract using next-generation sequencing: single center exome sequencing data from Turkey. Mol Syndromol. 2020;11:302–8. doi: 10.1159/000510481. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated and analyzed during the study are available in the published manuscript.


Articles from Orphanet Journal of Rare Diseases are provided here courtesy of BMC

RESOURCES