Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2023 Jul 26.
Published in final edited form as: Methods Mol Biol. 2023;2666:1–14. doi: 10.1007/978-1-0716-3191-1_1

A Simple Method for the Detection of Wybutosine-modified tRNAPheGAA as a Readout of Retrograde tRNA Nuclear Import and Re-export: HCl/Aniline Cleavage and Non-radioactive Northern Hybridization

Regina T Nostramo 1, Anita K Hopper 1,*
PMCID: PMC10370157  NIHMSID: NIHMS1916078  PMID: 37166653

Abstract

tRNAs are highly mobile molecules that are trafficked back and forth between the nucleus and cytoplasm by several proteins. However, characterization of the movement of tRNAs and the proteins mediating these movements can be difficult. Here, we describe an easy and cost-effective assay to discover genes that are involved in two specific tRNA trafficking events, retrograde nuclear import and nuclear re-export for yeast, S. cerevisiae. This assay, referred to as the hydrochloric acid (HCl)/aniline assay, identifies the presence or absence of a unique modification on tRNAPheGAA called wybutosine (yW), that requires mature, spliced tRNAPheGAA to undergo retrograde nuclear import and subsequent nuclear re-export for its addition. Therefore, the presence/absence of yW-modified tRNAPheGAA serves as a read-out of retrograde nuclear import and nuclear re-export. This simple assay can be used to determine the role of any gene product in these previously elusive tRNA trafficking events.

Keywords: Hydrochloric acid, aniline, northern blot, tRNA retrograde nuclear import, tRNA re-export, wybutosine, yeast

1. Introduction

In eukaryotic cells, tRNAs are trafficked back and forth between the nucleus and cytoplasm. These movements are required for the maturation of primary tRNA transcripts into mature tRNAs, which function as essential adaptor molecules in protein synthesis. The trafficking of tRNAs within the cell consists of three main steps (Fig. 1) [reviewed in [1]]. The first is primary export of tRNAs from the nucleus, where they are transcribed, to the cytoplasm. Second, tRNAs undergo retrograde nuclear import, which relocates them back to the nucleus. Finally, tRNAs are re-exported back to the cytoplasm. Understanding subcellular trafficking of tRNAs and its regulation, as well as the proteins involved in these processes, has and continues to shed light on the physiological and pathophysiological roles of tRNAs in the cell [2-4].

Figure 1. Maturation of tRNAPheGAA in S. cerevisiae.

Figure 1.

Open in a new tab

The maturation of tRNAPheGAA in S. cerevisiae includes the sequential addition of several modifications. Since many of the enzymes that catalyze the addition of these modifications display either nuclear or cytoplasmic localization, tRNAPheGAA must undergo trafficking between these two compartments to become fully mature. After tRNAPheGAA is transcribed in the nucleus, it undergoes multiple processing events and modifications (not shown), resulting in pre-tRNAPheGAA, which contains a 5’ and 3’ exon (black lines) separated by an intron (orange line). Pre-tRNAPheGAA is exported to the cytoplasm in the first trafficking event called primary nuclear export. Once in the cytoplasm, pre-tRNAPheGAA is transported to the surface of the mitochondria where its intron is spliced and the 5’ and 3’ exons are ligated together. Spliced tRNAPheGAA is a substrate for the enzyme Trm7, which methylates positions 32 (Cm) and 34 (Gm) (pink). Next, spliced tRNAPheGAA is trafficked back to the nucleus in a step called retrograde nuclear import. Spliced tRNAPheGAA (but not intron-containing tRNAPheGAA) is a substrate for the nuclear-localized enzyme Trm5, which methylates G at position 37 (m1G) (green). In the final event of its maturation, tRNAPheGAA is re-exported from the nucleus to the cytoplasm where it is modified sequentially by the Tyw1-4 enzymes, resulting in the addition of wybutosine (yW) at position 37 (blue). Therefore, any spliced tRNAPheGAA containing the yW modification must have undergone both retrograde nuclear import and nuclear re-export and can thus serve as a readout of these two trafficking events. [reproduced from Ref. 4 with permission from Oxford Journals.]

The first tRNA trafficking event, primary nuclear export, is perhaps the most well-studied of the three. This is because in organisms like budding and fission yeast a subset of tRNAs possess introns, which are spliced on the surface of the mitochondria immediately following primary nuclear export by exporters such as Los1 [5-7]. Therefore, any intron-containing tRNA that has had its intron removed must have undergone primary export from the nucleus to the cytoplasm. This would be reflected by a decrease in the size of the tRNA, which can be easily detected by Northern blot analysis [8]. To this end, a genome-wide screen using this approach identified three novel proteins (Mex67, Mtr2 and Crm1) that are involved in the primary export of tRNA in yeast, in addition to the canonical tRNA exporter Los1 [2, 9].

Understanding of the two subsequent tRNA trafficking events, specifically retrograde nuclear import and nuclear re-export, however, is not as complete. While the size of intron-containing tRNAs decreases upon primary export and subsequent intron splicing, there is no size change in tRNAs upon retrograde import and re-export. Additionally, tracking tRNA movement by other means like tagging can be complicated given the lack of a 3’ UTR, addition of an amino acid to the 3’ end, and the critical importance of tRNA tertiary structure in mediating its function. Additionally, fractionating the cytoplasm and nucleus in particular organisms, such as Saccharomyces cerevisiae, is extremely difficult and not amenable to genome-wide screens. Therefore, to address this issue we developed a simple assay that allows for the identification of gene products involved in tRNA retrograde nuclear import and re-export. This assay takes advantage of a specific modification, wybutosine (yW), that occurs exclusively on tRNAPheGAA in S. cerevisiae and requires both retrograde nuclear import and nuclear re-export for its addition [10].

The process of tRNAPheGAA maturation in S. cerevisiae, culminating in the addition of the yW modification, begins with its transcription in the nucleus (Fig. 1). Once transcribed, this primary tRNA undergoes 5’ leader and 3’ trailer removal and 3’ CCA addition, resulting in the formation of pre-tRNAPheGAA. Pre-tRNAPheGAA is then exported to the cytoplasm and localized to the surface of the mitochondria for intron splicing by the splicing endonuclease complex [3, 5, 6]. This spliced tRNAPheGAA is now a substrate for the cytoplasmic methyltransferase, Trm7, which methylates positions 32 (Cm32) and 34 (Gm34) [11]. These modifications, particularly Gm34, are prerequisites for the later addition of the yW modification. The tRNA then undergoes retrograde nuclear import, where it is now a substrate for the nuclear-localized methyltransferase Trm5, which methylates G at position 37 (m1G37) [12]. Trm5 only recognizes spliced tRNAPheGAA and not intron-containing tRNAPheGAA [13, 14] and therefore the presence of this modification is indicative of prior primary nuclear export and retrograde nuclear import. Finally, the m1G37-modified tRNAPheGAA is re-exported to the cytoplasm where it is sequentially modified by the enzymes Tyw1, Tyw2, Tyw3 and Tyw4, resulting in a wybutosine-modified tRNAPheGAA [15]. Thus, any tRNAPheGAA containing the yW modification is evidence of a tRNA that has undergone all three trafficking events.

Given the ability of the yW modification to be used as a read-out of retrograde nuclear import and re-export, we developed an easy, cost-effective assay, herein called the hydrochloric acid (HCl)/aniline assay, to detect the presence of this modification [4]. The basis for this assay stems from research conducted in the late 1960’s and 1970’s demonstrating that mild acid treatment of tRNAPheGAA containing yW results in removal of the yW base without cleaving the sugar-phosphate backbone, creating an abasic site [16, 17]. Cleavage of the sugar-phosphate backbone at this abasic site can then be achieved by incubation with aniline at a low pH via a β-elimination reaction [18]. Given that the yW modification is located at nucleotide position 37, the last nucleotide of the 5’ exon, this results in cleavage of tRNAPheGAA into 5’ and 3’ half-sized fragments (Fig. 2A). This drastic change in size can be visualized by Northern blot analysis (Fig. 3, lanes 3 vs. 4). Thus, any mature tRNAPheGAA that is cleaved following sequential HCl and aniline treatment is indicative of a tRNA that has undergone both retrograde nuclear import and nuclear re-export. Conversely, any tRNAPheGAA lacking the yW modification would remain intact following sequential HCl and aniline treatment (Fig. 2B). For example, cells lacking Tyw1, the enzyme that catalyzes the first step in the conversion of m1G37 of tRNAPheGAA to yW, do not contain the yW modification and therefore do not display tRNA cleavage following sequential HCl and aniline treatment when visualized by Northern blot (Fig. 3, lanes 1 vs. 2).

Figure 2. The effects of sequential treatment of tRNAPheGAA with HCl and aniline.

Figure 2.

Open in a new tab

A) Treatment of fully mature tRNAPheGAA containing the wybutosine (yW) modification (green) with HCl elicits the removal of the yW base, leaving an abasic site (AP site; grey unfilled circle). Subsequent treatment with aniline causes scission of the RNA chain at the AP site, resulting in the splitting of the tRNA into a 5’ and 3’ half. B) Treatment of tRNAPheGAA lacking the yW modification with HCl does not elicit AP site formation and therefore no RNA chain scission occurs in response to subsequent aniline treatment.

Figure 3. Northern blot analysis of tRNAPheGAA treated with HCl and aniline.

Figure 3.

Open in a new tab

Small RNAs were isolated from wild-type (WT), tyw1Δ or mtr10Δ cells and subjected to sequential treatment with HCl and aniline. Northern blot analysis was performed using a DIG-labeled tRNAPheGAA 5’/3’ exon probe. For all strains, no tRNAPheGAA strand cleavage was observed when treated with aniline only (lanes 1 and 3). Conversely, nearly all of the tRNAPheGAA was cleaved in WT cells subjected to sequential HCl/aniline treatment (lane 4). This cleavage was absent in tywM cells (lane 2), which lack the Tyw1 enzyme needed for the synthesis of yW. In cells lacking Mtr10, a protein involved in the retrograde nuclear import of tRNAPheGAA, cleavage of the tRNA was greatly inhibited as compared to WT cells (lane 5). The detected RNAs correspond to mature (M; 76 nts), 5’ exon (5’ Ex; 37 nts) or 3’ exon (3’ Ex; 39 nts) tRNAPheGAA. Mature tRNAPheGAA migrates on the gel as two bands. Since two of the 10 copies of this gene differ by a single nucleotide substitution in both the 5’ and 3’ exons, this dual migration pattern may be due to these substitutions or to under-modification of the tRNA. 5S rRNA levels (121 nts) were measured by Northern blot and serve as a loading control.

The HCl/aniline assay can thus be used to detect gene products that play a role in the retrograde nuclear import or re-export steps, as the lack of tRNAPheGAA cleavage following HCl and aniline treatment in a strain deficient in a specific gene product would indicate the role of this gene product in either tRNAPheGAA maturation (as with tyw1Δ cells) or the retrograde nuclear import or re-export processes. For example, Mtr10 is a member of the β-importin family and has previously been shown to function in the import of tRNAs under conditions of amino acid deprivation [19]. Using the HCl/aniline assay, Mtr10 was also shown to function in the constitutive retrograde nuclear import of tRNAPheGAA, as mature, uncleaved tRNAPheGAA levels are increased in mtr10Δ cells following sequential HCl and aniline treatment, as compared to wild-type cells (Fig. 3, lanes 4 vs. 5) [4].

When using the HCl/aniline assay for the identification of novel proteins involved in the retrograde nuclear import or re-export of tRNAPheGAA, a second step, such as fluorescence in situ hybridization (FISH) analysis, will be needed to differentiate between these two processes. For gene products that are involved in retrograde nuclear import of tRNAPheGAA, cytoplasmic accumulation of the tRNA would be observed upon gene deletion/inactivation. Conversely, nuclear accumulation would be observed if the defect occurred in the nuclear re-export step [19].

Overall, the value the HCl/aniline assay will add to the field of tRNA biology is immense. Currently, this assay has been used to identify a constitutive role of Mtr10 in the retrograde import of tRNAPheGAA and confirm a role of Ssa2 in this process under conditions of amino acid deprivation [4], as previously reported [20]. Additionally, this assay was able to demonstrate that Mex67 and Crm1 are required for the re-export of tRNAPheGAA, whereas the canonical tRNA exporters, Los1 and Msn5, are not [4]. Overall, use of the HCl/aniline assay will lead to the identification and characterization of additional gene products involved in the retrograde tRNA nuclear import and re-export processes and deepen our understanding of the role of tRNA trafficking in cell biology.

2. Materials

All solutions should be prepared in filter sterilized double distilled water (ddH2O). Reagents should be stored at room temperature, unless otherwise indicated.

2.1. HCl/aniline assay

1.Stock HCl solution: Dilute 37% (w/w) Hydrochloric acid 100-fold in water.

2.Working HCl solution: In a 1.5 mL microcentrifuge tube, mix 975 μL water and 25 μL of the stock HCl solution.

3. Working aniline solution (0.5M aniline, pH 4.5): Add 8.2 mL water to a 15 mL tube. Then add 910 μL aniline (ACS grade; ≥ 99.5%) and 795 μL glacial acetic acid. Cap and flip the tube several times to mix. Wrap the tube in foil to protect from light. This solution should be prepared just before use (see Notes 1 and 2).

4. 5 mM potassium hydroxide (KOH).

5. 100% ethanol: Store at 4°C.

6. 3 M sodium acetate, pH 5.2.

7. Glycoblue Coprecipitant (15 mg/mL; Invitrogen): This reagent consists of a blue dye covalently linked to glycogen, which coprecipitates with RNA. Glycoblue enhances precipitation of low quantities of RNA and also increases the visibility of the RNA pellet during RNA precipitation.

2.2. Gel Electrophoresis

1. 10% polyacrylamide: In a 1 L beaker, add 424.2g urea to 300 mL water and stir on a heating plate until dissolved, but being careful not to bring to a boil. Remove from heat and allow to cool at room temperature for 5-10 minutes. After the solution is slightly cooled but still warm, add 250 mL 40% acrylamide/bis solution (19:1), 100 mL 10x TBE (see #5 below for recipe) and bring to 1 L with water. Filter sterilize, cover with foil and store at 4°C.

2. Ammonium persulfate (APS): 10% solution in water (Note 3).

3. N,N,N,N’-Tetramethyl-ethylenediamine (TEMED): Store at 4°C.

4. 10% polyacrylamide, 8M urea gel: In a 50 mL conical tube, combine 35 mL 10% polyacrylamide, 300 μL 10% APS and 22.5 μL TEMED. Prepare just before casting gel.

5. 10x TBE Running buffer: In a 1 L beaker, dissolve 108 g Tris base, 55 g boric acid and 7.5 g EDTA, disodium salt in 800 mL water. Stir with heat until dissolved. Bring to 1 L with water. When ready to use, prepare 1x TBE by adding 100 mL 10x TBE to 900 mL water (see Note 4).

6. 2x Loading Dye: Combine 24 g urea, 2 mL 0.5 M EDTA (pH 8.0) and 0.1 mL 1 M Tris buffer (pH 7.5). Adjust the volume to 50 mL with water. Then add 0.05 g of xylene cyanol and 0.05 g bromophenol blue. Store at 4°C.

7. Gel electrophoresis apparatus.

2.3. Transfer and UV-crosslinking

1. 50x TAE transfer buffer: In a 1 L beaker, dissolve 242 g Tris base and 18.61 g EDTA, disodium salt in 700 mL water and stir until dissolved. Add 57.1 mL glacial acetic acid and adjust the volume to 1 L. When ready to use, prepare 1x TAE by adding 20 mL 50x TAE to 980 mL water (see Note 4).

2. Hybond N+ nylon membrane.

3. Spectrolinker XL-100 UV crosslinker: RNAs can be fixed to the Hybond N+ nylon membrane by UV crosslinking at an energy dosage of 120 millijoules/cm2.

4. Transfer apparatus.

2.4. DIG-labeled probes

1. tRNAPheGAA 5’/3’ exon probe: 5’ CGAACACAGGACCTCCAGATCTTCAGTCTGGCGCTCTCCC 3’

This 40 nt oligo is complementary to 20 nts of the 3’ end of the 5’ exon and 20 nts of the 5’ end of the 3’ exon of tRNAPheGAA in Saccharomyces cerevisiae.

2. tRNAPheGAA 5’ exon probe: 5’ CAACTGAGCTAAGTCCGC 3’

This oligo is complementary to the 18 nts at the 5’ end of the 5’ exon of tRNAPheGAA in Saccharomyces cerevisiae.

3. tRNAPheGAA 3’ exon probe: 5’ TGCGAACTCTGTGGATCGAACACAGGACCT 3’

This oligo is complementary to the 30 nts at the 3’ end of the 3’ exon of tRNAPheGAA in Saccharomyces cerevisiae.

4. 5S rRNA probe: 5’ GCACCTGAGTTTCGCGTATGGT 3’

This oligo is complementary to 5S rRNA in Saccharomyces cerevisiae and can be used as a control for equal gel loading (See note 5).

5. DIG Oligonucleotide Tailing Kit, 2nd Generation (Roche): DIG-label the 3’ end of the probes listed above using DIG-dUTP/dATP by first adding 1 μL of 100 μM oligo to 9 μL dH2O, and then adding reagents #1 - 5, according to the manufacturer’s protocol. After incubation at 37°C for 15 minutes, stop the reaction by adding 0.8 μL of 0.5 M EDTA, pH 8.0. One labeling reaction yields a total volume of 20.8 μL DIG-labeled probe, which is enough probe for about 20 blots (1 μL DIG-labeled probe per blot). DIG-labeled probes should be stored at −20°C.

2.5. Northern blot hybridization and detection of DIG-labeled probes

1. Hybridization tubes.

2. Hybridization oven (rotisserie).

3. 20x saline-sodium citrate (SSC) buffer: In a 1 L beaker, combine 175.3 g NaCl and 77.4 g sodium citrate. Add 800 mL water and pH with 12N HCl to 7.0. Bring to 1 L.

4. Prehybridization buffer: 5x saline-sodium citrate (SSC), 0.1% (w/v) N-lauroylsarcosine, 0.02% (w/v) sodium dodecyl sulfate (SDS), 1% (w/v) Roche Blocking Reagent (See Note 6).

5. Wash buffer 1: 2x SSC containing 0.1% SDS.

6. Wash buffer 2: 0.1 M Maleic acid, 0.15 M NaCl, pH 7.5, 0.3% Tween 20.

7. Blocking buffer: 1% (w/v) Roche Blocking Reagent, 0.1 M Maleic acid, 0.15 M NaCl, pH 7.5.

8. Anti-DIG antibody conjugated with alkaline phosphatase.

9. 1x Detection buffer: 0.1 M Tris-HCl, 0.1 M NaCl, pH 9.5.

10. Hybridization bags.

11. CDP-STAR: Disodium 2-chloro-5-(4-methoxyspiro (1,2-dioxetane-3,2’-(5’-chloro) tricyclo [3.3.1.13,7 ]decan)-4-yl)-1-phenyl phosphate.

3. Methods

3.1. HCl/aniline assay

1. Prepare one 1.5 mL microcentrifuge tube for each sample. On ice, mix 10 μg of RNA with water to a volume of 30 μL.

2. Add 20 μL of working HCl solution to each tube, bringing the final volume to 50 μL.

3. To induce wybutosine base excision, incubate tubes at 37°C for 3 hrs (see Note 7).

4. Neutralize the HCl-treated RNA solutions by adding 11.38 μL of 5 mM KOH and keep on ice (See Note 8).

5. Prepare −HCl controls for each sample by mixing 1955.04 ng RNA and water to a volume of 12 μL in a 2 mL microcentrifuge tube. Keep on ice (See Notes 9 and 10).

6. Preheat a heating block to 60°C.

7. Prepare 0.5 M aniline, pH 4.5 (See Note 11).

8. Label a 2mL microcentrifuge tube for each HCl-treated sample (See Note 10). To each tube, add 12 μL 0.5 M aniline, pH 4.5 and 12 μL neutralized, HCl-treated RNA. For −HCl samples, add 12 μL aniline directly to the RNA prepared in step 5.

9. Incubate samples at 60°C for 20 min to induce chain scission at abasic sites.

10. Briefly centrifuge samples, then add the following in order: 451 μL water, 47.5 μL 3 M sodium acetate pH 5.2, 1410 μL ice cold 100% ethanol and 1 μL of 15 mg/mL GlycoBlue coprecipitant (See Note 12). Flip the tubes several times to mix and store at −80°C for at least 1 hr or overnight to precipitate the RNA.

11. Centrifuge samples for 20 min at 4°C at 15,000 rpm.

12. Preheat a water bath to 55°C.

13. After centrifugation, a small blue pellet should be visible. Remove as much supernatant as possible. Wash pellet in 1 mL cold 70% ethanol. Centrifuge for 5 min at 4°C at 15,000 rpm.

14. Remove 70% ethanol. Quick centrifuge the samples and remove all remaining ethanol with gentle suction using a 10 μl pipette tip, being careful not to aspirate the pellet (See Note 13).

15. Allow samples to sit at room temperature with the caps open to air dry for 10-15 min.

16. Add 20 μL water to each tube. Quick spin the samples to ensure the pellet is in the water. Incubate at 55°C for 10 min. Quick spin again.

17. Add 20 μL of 2x northern loading dye to each tube of 20 μL of RNA. At this point the samples can be stored at -80°C.

3.2. Northern blot

1. Prepare a 10% polyacrylamide gel by combining 35 mL 10% polyacrylamide solution, 300 μL 10% ammonium persulfate and 22.5 μL TEMED in a 50 mL conical centrifuge tube. Flip upside down a few times to mix and cast gel within a 16 cm x 18 cm x 1.5 mm gel cassette with 15-well or 24-well comb. Allow approximately 45 min for the gel to solidify.

2. Add 1x TBE to the gel apparatus and clean out the wells to remove any unpolymerized polyacrylamide using a needle and syringe.

3. Heat the samples at 85°C for 5 min. Load 20 μL per lane. Electrophorese at 4°C at 50 V for approximately 18 hrs, until the dye front is about 1 inch from the bottom of the gel.

4. Following electrophoresis, gently pry the gel plates open, allowing the gel to remain on the bottom plate. Cut off the wells of the gel and just below the dye front. Gently rinse the gel with water to remove any gel fragments that could interfere with the transfer step.

5. Cut a piece of Hybond N+ nylon membrane to the size of the gel. Cut a small piece off the top left corner of the membrane. Assemble the transfer cassette in a plastic container containing 1x TAE buffer. In order, add one foam pad, 3 sheets of filter paper, the membrane (with the cut corner oriented at the top left), the gel (with lane 1 on the left), 3 more sheets of filter paper and another foam pad. Seal the cassette and insert into a transfer apparatus containing 1x TAE buffer. Transfer at 15 V for 15 min, then 0.6 A for 2 hrs at 4°C.

6. After the transfer, disassemble the cassette and dry the membrane on a piece of filter paper for a few minutes. Orient the membrane with the RNA side facing up (the cut corner should be at the top left). Then UV crosslink the front of the membrane at an energy dosage of 120 millijoules/cm2. Flip the membrane over and UV crosslink the back of the membrane. At this point the membrane can be stored dry in plastic wrap at −20°C.

7. Place the membrane in a hybridization tube with 10 mL pre-hybridization buffer, with the RNA side facing the center of the hybridization tube. Assure that the membrane is not overlapping itself. Place the tube in a rotisserie hybridization oven and incubate at 37°C for 30 min with rotation. (See Note 14 and 15).

8. Replace the pre-hybridization buffer with hybridization buffer, which is 10 mL prehybridization buffer containing 1 μL tRNAPheGAA DIG-labeled oligo. Any of the tRNAPheGAA oligos listed in section 2.4 can be used in this step. Each of these tRNAPheGAA oligos hybridizes to different parts of tRNAPheGAA (5’ exon, 3’ exon or 5’/3’ exon junction) yielding slightly different detection patterns. See Supplemental Figure 1C in Nostramo and Hopper (2020) for a comparison of the detection patterns that are observed using each of these probes. Since the 5’/3’ exon junction probe will detect both halves of the cleaved tRNAPheGAA, quantitation is easier when using either the 5’ or 3’ exon only probes. Incubate the membrane at 37°C overnight with rotation.

9. Remove hybridization buffer (See Note 16). Wash the membrane four times with 15 mL Wash Buffer 1 for 10 min each. Perform the first three washes at 37°C with rotation. During the fourth wash, turn the temperature of the hybridization oven down to room temperature. The remaining steps should all be performed at room temperature.

10. Discard Wash Buffer 1 and equilibrate the membrane in 10 mL Wash Buffer 2 for 3 min with rotation.

11. Discard Wash Buffer 2 and incubate the membrane in 10 mL Blocking Buffer for 30 min with rotation.

12. Discard the Blocking Buffer and add 10 mL fresh Blocking Buffer containing 1:10,000 dilution of Anti-DIG antibody conjugated to alkaline phosphatase. Incubate with rotation for 30 min.

13. Discard the antibody solution and wash the membrane twice with 15 mL Wash Buffer 2 for 15 min each with rotation.

14. Discard Wash Buffer 2 and equilibrate the membrane in 10 mL Detection Buffer for 3 min with rotation.

15. Discard the Detection buffer and place the membrane on the bottom layer of a hybridization bag. Add 1 mL of CDP-STAR to the membrane and cover with the top layer of the bag. Seal using a heat sealer. Store the membrane in the dark for 5-10 min.

16. Image the membrane in a Chemiluminescence imager (See Note 17).

17. After imaging, place the membrane back into a hybridization tube and wash twice with 15 mL Wash Buffer 1 at 37°C for 15 min each with rotation (See Note 18).

18. To measure 5S rRNA levels, repeat steps 8 – 16 using 1nM DIG-labeled oligo for 5S rRNA (See Note 19).

4. Notes

1. Aniline is very hygroscopic. After opening, the aniline should be tightly sealed, wrapped in Parafilm and stored at 4°C. When stored in this manner, the aniline is good for at least 6 months.

2. The pH of the solution will be 4.5 and does not need to be adjusted.

3. APS should be made fresh just before use, or it can be prepared and frozen at −20°C in aliquots. Do not reuse after thawing.

4. After use, this buffer can be stored at 4°C and used two additional times.

5. Detection of 5S rRNA as a loading control should be performed using hybridization of the indicated probe to the membrane, rather than by standard ethidium bromide staining of the gel. Staining of the gel with ethidium bromide following HCl and aniline treatment leads to a smear in the gel, making the 5S rRNA band difficult to see.

6. For blocking, it is important to use the Roche Blocking Reagent supplied in the Roche DIG Block and Wash Buffer Set, which is supplied as a 10x solution. In our hands, the Roche Blocking Reagent that can be purchased in powdered form and reconstituted to form a 10x solution did not work well, yielding high background levels.

7. Incubation at 37°C for 3 hrs is sufficient for near complete removal of the wybutosine base.

8. At this point, RNA can be stored at −80°C for later treatment with aniline.

9. The −HCl controls are prepared in this way in order to conserve RNA, since in the next step only a portion of the HCl-treated RNA will be used. Alternatively, −HCl samples can be prepared exactly as above for +HCl samples.

10. In this step, a 2 mL microcentrifuge tube and not a 1.5 mL microcentrifuge tube is required. This is to ensure that the aniline can be adequately diluted and removed following RNA precipitation.

11. The working aniline solution should be prepared just prior to use.

12. Glycoblue coprecipitant is needed to help precipitate the low quantities of RNA and to visualize the RNA pellet after precipitation in ethanol.

13. It is important to remove as much liquid as possible since any residual aniline will not easily dry.

14. During the prehybridization, hybridization and detection steps, assure that the membrane is kept wet in order to avoid high non-specific background signals.

15. If a rotisserie hybridization oven is not available, the membrane can be placed in a glass dish with the RNA side facing down and incubated on an orbital platform shaker at the appropriate temperature.

16. Hybridization buffer can be stored at −20°C for up to 1 year and reused once.

17. Typically an exposure time of 2-3 min is sufficient to detect a strong signal.

18. Alternatively, the membrane can be stored in the heat-sealed hybridization bag with the CDP-Star reagent at −20°C for at least a year. For all steps after pre-hybridization, the membrane should be kept wet. Do not let the membrane dry or store dry.

19. For 5S rRNA, typically an exposure time of 30 - 60 seconds is sufficient to detect as strong signal.

Acknowledgements

This work was supported by funding from the National Institutes of Health [grant number GM122884 to A.K.H.].

References

  • 1.Chatterjee K, Nostramo RT, Wan Y, and Hopper AK (2018). tRNA dynamics between the nucleus, cytoplasm and mitochondrial surface: Location, location, location. Biochim Biophys Acta Gene Regul Mech 1861, 373–386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Chatterjee K, Majumder S, Wan Y, Shah V, Wu J, Huang HY, and Hopper AK (2017). Sharing the load: Mex67-Mtr2 cofunctions with Los1 in primary tRNA nuclear export. Genes Dev 31, 2186–2198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Wan Y, and Hopper AK (2018). From powerhouse to processing plant: conserved roles of mitochondrial outer membrane proteins in tRNA splicing. Genes Dev 32, 1309–1314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Nostramo RT, and Hopper AK (2020). A novel assay provides insight into tRNAPhe retrograde nuclear import and re-export in S. cerevisiae. Nucleic Acids Res 48, 11577–11588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yoshihisa T, Ohshima C, Yunoki-Esaki K, and Endo T (2007). Cytoplasmic splicing of tRNA in Saccharomyces cerevisiae. Genes Cells 12, 285–297. [DOI] [PubMed] [Google Scholar]
  • 6.Yoshihisa T, Yunoki-Esaki K, Ohshima C, Tanaka N, and Endo T (2003). Possibility of cytoplasmic pre-tRNA splicing: the yeast tRNA splicing endonuclease mainly localizes on the mitochondria. Mol Biol Cell 14, 3266–3279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hellmuth K, Lau DM, Bischoff FR, Kunzler M, Hurt E, and Simos G (1998). Yeast Los1p has properties of an exportin-like nucleocytoplasmic transport factor for tRNA. Mol Cell Biol 18, 6374–6386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wu J, Huang HY, and Hopper AK (2013). A rapid and sensitive non-radioactive method applicable for genome-wide analysis of Saccharomyces cerevisiae genes involved in small RNA biology. Yeast 30, 119–128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wu J, Bao A, Chatterjee K, Wan Y, and Hopper AK (2015). Genome-wide screen uncovers novel pathways for tRNA processing and nuclear-cytoplasmic dynamics. Genes Dev 29, 2633–2644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ohira T, and Suzuki T (2011). Retrograde nuclear import of tRNA precursors is required for modified base biogenesis in yeast. Proc Natl Acad Sci U S A 108, 10502–10507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Guy MP, Podyma BM, Preston MA, Shaheen HH, Krivos KL, Limbach PA, Hopper AK, and Phizicky EM (2012). Yeast Trm7 interacts with distinct proteins for critical modifications of the tRNAPhe anticodon loop. RNA 18, 1921–1933. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Droogmans L, and Grosjean H (1987). Enzymatic conversion of guanosine 3' adjacent to the anticodon of yeast tRNAPhe to N1-methylguanosine and the wye nucleoside: dependence on the anticodon sequence. EMBO J 6, 477–483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Pintard L, Lecointe F, Bujnicki JM, Bonnerot C, Grosjean H, and Lapeyre B (2002). Trm7p catalyses the formation of two 2'-O-methylriboses in yeast tRNA anticodon loop. EMBO J 21, 1811–1820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Jiang HQ, Motorin Y, Jin YX, and Grosjean H (1997). Pleiotropic effects of intron removal on base modification pattern of yeast tRNAPhe: an in vitro study. Nucleic Acids Res 25, 2694–2701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Noma A, Kirino Y, Ikeuchi Y, and Suzuki T (2006). Biosynthesis of wybutosine, a hyper-modified nucleoside in eukaryotic phenylalanine tRNA. EMBO J 25, 2142–2154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ladner JE, and Schweizer MP (1974). Effects of dilute HCl on yeast tRNAPhe and E. coli tRNA1fMet. Nucleic Acids Res 1, 183–192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Thiebe R, and Zachau HG (1968). A specific modification next to the anticodon of phenylalanine transfer ribonucleic acid. Eur J Biochem 5, 546–555. [DOI] [PubMed] [Google Scholar]
  • 18.Burrows CJ, and Muller JG (1998). Oxidative Nucleobase Modifications Leading to Strand Scission. Chem Rev 98, 1109–1152. [DOI] [PubMed] [Google Scholar]
  • 19.Shaheen HH, and Hopper AK (2005). Retrograde movement of tRNAs from the cytoplasm to the nucleus in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 102, 11290–11295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Takano A, Kajita T, Mochizuki M, Endo T, and Yoshihisa T (2015). Cytosolic Hsp70 and cochaperones constitute a novel system for tRNA import into the nucleus. Elife 4. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES