Skip to main content
Journal of Virology logoLink to Journal of Virology
. 1999 Jan;73(1):225–233. doi: 10.1128/jvi.73.1.225-233.1999

Chimeric Lyssavirus Glycoproteins with Increased Immunological Potential

Corinne Jallet 1, Yves Jacob 1, Chokri Bahloul 1, Astrid Drings 1, Emmanuel Desmezieres 1, Noël Tordo 1, Pierre Perrin 1,*
PMCID: PMC103826  PMID: 9847325

Abstract

The rabies virus glycoprotein molecule (G) can be divided into two parts separated by a flexible hinge: the NH2 half (site II part) containing antigenic site II up to the linear region (amino acids [aa] 253 to 275 encompassing epitope VI [aa 264]) and the COOH half (site III part) containing antigenic site III and the transmembrane and cytoplasmic domains. The structural and immunological roles of each part were investigated by cell transfection and mouse DNA-based immunization with homogeneous and chimeric G genes formed by fusion of the site II part of one genotype (GT) with the site III part of the same or another GT. Various site II-site III combinations between G genes of PV (Pasteur virus strain) rabies (GT1), Mokola (GT3), and EBL1 (European bat lyssavirus 1 [GT5]) viruses were tested. Plasmids pGPV-PV, pGMok-Mok, pGMok-PV, and pGEBL1-PV induced transient expression of correctly transported and folded antigens in neuroblastoma cells and virus-neutralizing antibodies against parental viruses in mice, whereas, pG-PVIII (site III part only) and pGPV-Mok did not. The site III part of PV (GT1) was a strong inducer of T helper cells and was very effective at presenting the site II part of various GTs. Both parts are required for correct folding and transport of chimeric G proteins which have a strong potential value for immunological studies and development of multivalent vaccines. Chimeric plasmid pGEBL1-PV broadens the spectrum of protection against European lyssavirus genotypes (GT1, GT5, and GT6).


Rabies is a fatal form of encephalomyelitis caused by viruses of the Lyssavirus genus of the Rhabdoviridae family. On the basis of nucleotide sequence comparison and phylogenetic analysis, the Lyssavirus genus has been divided into six genotypes (GTs) (7). GT1 includes the classical rabies viruses and vaccine strains, whereas GT2 to GT6 correspond to rabies-related viruses, including Lagos bat virus (GT2), Mokola virus (Mok) [GT3], Duvenhage virus (GT4), European bat lyssavirus 1 (EBL1 [GT5]), and EBL2 (GT6). A new lyssavirus that may belong to a new genotype (GT7) has recently been reported in Australia (16). Based on antigenicity, the Lyssavirus genus was first divided into four serotypes (34) and was recently divided into two principal groups according to the cross-reactivity of virus-neutralizing antibodies (VNAbs) (group 1, GT1, GT4, GT5, GT6, and GT7; group 2, GT2 and GT3) (4). Viruses of group 2 are not pathogenic when injected peripherally in mice (29), and concerning amino acids that play a key role in pathogenicity, their glycoprotein is similar to that of the avirulent GT1 viruses (3, 8).

Currently available vaccines mostly belong to GT1, against which they give protection (23). However, the protection against GT4 to GT6 depends on the vaccine strain. (1, 11, 19). Concerning the protection against the EBLs (GT5 and GT6), the isolation of which has become more frequent in recent years, the rabies vaccine PM (Pitman-Moore) strain induces weaker protection against EBL1 than the PV (Pasteur virus) strain, and few data are reported for EBL2 (11, 19). It is therefore important to study ways of increasing the level of protection against these viruses or broadening the spectrum against rabies-related viruses.

Rabies virus glycoprotein molecule (G) is composed of a cytoplasmic domain, a transmembrane domain, and an ectodomain, exposed as trimers at the virus surface (9, 13). The ectodomain is involved in the induction of both VNAb production and protection after pre- and postexposure vaccination (32, 41). Therefore, much attention has been focused on G in the development of rabies subunit vaccines. It is generally thought that the G ectodomain has two major antigenic sites recognized by about 72.5% (site II) and 24% (site III) of neutralizing monoclonal antibodies (MAbs), respectively, one minor site (site a), and several epitopes recognized by single MAbs (I, amino acid [aa] 231; V, aa 294; and VI, aa 264) (5, 10, 18, 21). Site II is conformational and discontinuous (aa 34 to 42 and aa 198 to 200 associated by disulfide bridges), whereas site III is conformational and continuous (aa 330 to 338). Lysine 330 and arginine 333 in site III play a key role in neurovirulence and may be involved in the recognition of neuronal receptors (8, 40). Sites II and III seem to be close to one another and are exposed at the surface of the protein (12). However, at low pH, the G molecule takes on a fusion-inactive conformation in which site II is not accessible to MAbs, whereas sites a and III remain more or less exposed (14, 15). Moreover, several regions distributed along the ectodomain are involved in the induction of T helper (Th) cells (24, 42). Based on these structural and immunological properties, we have suggested that the G molecule may consist of two immunologically active parts, each potentially able to induce both VNAb and Th cells (4): the NH2-terminal half containing antigenic site II (the site II part) and the COOH-terminal half containing site III and the transmembrane and cytoplasmic domains (the site III part).

In this study, we used in vitro transfection of neuroblastoma cells and DNA-based immunization to study the relative immunological importance of the site II and III parts of lyssavirus glycoproteins. This includes humoral, cell-mediated immune responses and protective activity. We assessed the immunogenic autonomy of each part by using homogeneous and chimeric G genes formed by fusion of the site II part of one GT with the site III part of the same or another GT. The site III part of G of the PV strain (GT1) was the most effective at presenting in vivo the site II parts of various lyssaviruses: Mok (GT3) and EBL1b (GT5). However, the site II part seemed to be required for correct folding and transport of the site III part, as well as for potent immunological responses. We also demonstrated that the EBL1-PV chimeric plasmid gave protection against the challenge virus standard (CVS), EBL1b, and EBL2b, which represent the European lyssavirus GTs (GT1, GT5, and GT6, respectively). These findings show that the site II part of rabies virus G can be exchanged with other lyssavirus glycoproteins and illustrate the potential value of chimeric genes for immunological studies and multivalent vaccine development.

MATERIALS AND METHODS

Mice.

Female BALB/c (6 to 8 weeks of age) and Swiss (body weight, 14 to 16 g) mice were purchased from “Centre d’Elevage et de Recherche” Janvier (Legenest St. Isle, France).

Cells and lyssaviruses.

BHK-21 cells used for the production and titration of lyssaviruses were grown in Eagle’s minimal essential medium (MEM) containing 5% fetal bovine serum (FBS) and 5% newborn calf serum (28). Neuroblastoma cells (Neuro-2a) used for transfection studies with plasmids were grown in MEM containing 8% FBS.

The interleukin-2 (IL-2)-dependent cytotoxic T-lymphocyte line (CTLL) was cultured as previously described (30) in RPMI 1640 medium (Gibco-Flowbio, Courbevoie, France) containing 10% FBS, 1 mM sodium pyruvate, 1 mM nonessential amino acids, 5 × 10−5 M 2-mercaptoethanol, HEPES buffer (Flow Laboratories, Bethesda, Md.), and 5 to 10 U (for 104 cells) of rat IL-2 (supernatant of splenocytes stimulated with concanavalin A [ConA]). Cells were incubated at 37°C in a humidified atmosphere containing 7.5% CO2.

Fixed PV-Paris/BHK-21, CVS rabies strains as well as rabies-related virus strains (EBL1b, EBL2b, and Mok) were multiplied in BHK-21 cells as previously described (28). The EBLs used were EBL1b (strain 8916FRA), derived from a bat isolate from France, and EBL2b (strain 9007FIN; a gift from H. Bouhry), isolated from a human in Finland (1).

Rabies virus antigens and vaccines.

Inactivated and purified lyssaviruses (IPRV) were prepared as described elsewhere (28). Virus was purified from inactivated (β-propiolactone) and clarified infected-cell supernatants by ultracentrifugation through a sucrose gradient. PV glycoprotein was solubilized from IPRV and purified (G PV) as previously described (28, 32).

The two inactivated rabies viruses used for comparative protection studies were prepared with two different strains: (i) PM as a commercial vaccine for human use (Pasteur Vaccins, Marnes-la-Coquette, France; lot Y0047) and (ii) PV as a vaccine for laboratory use (IPRV).

Construction of plasmids expressing lyssavirus G genes.

The region (aa 253 to 275) overlapping the only nonconformational epitope (VI) (Fig. 1) was chosen for the construction of chimeric genes because it is presumably less structurally constrained than the two major antigenic sites, II and III (5, 10). The homogeneous and chimeric lyssavirus G genes (Fig. 1) were introduced into the eukaryotic expression vector pClneo (Promega), propagated and amplified in Escherichia coli strain DH5α by standard molecular cloning protocols (25). Plasmids pGPV-PV and pGMok-PV were prepared as previously described (4). Plasmids pGPV-Mok, pG-PVIII, and pGEBL1-PV were obtained as follows.

FIG. 1.

FIG. 1

(a) Schematic representation of homogeneous and chimeric lyssavirus G proteins. The principal antigenic sites and epitopes are shown along the G PV molecule. Numbers give the positions of amino acid residues on the mature protein (signal peptide cleaved). (b) The exact sequences of all proteins including the Mok-Sad construct (26) around the linear region (underlined) carrying epitope VI (aa 264) are shown. Black and gray boxes outline the EBL1 and Mok sequences, respectively. Dashes represent amino acids similar to those in the PV sequence, and dots correspond to gaps.

For pGPV-Mok, the coding sequence of the site II part of G PV (aa 1 to 257) was amplified by reverse transcription-PCR (RT-PCR) by using the degenerated primers PVXbaI (5′ TTCTAGAGCCACCATGGTTCCTCAGGCTCTCCTG 3′) and PVBclI (5′ ATTGATCAACTGACCGGGAGGGC 3′). The PCR product was inserted into the SmaI site of pUC19 and then excised with BclI and EcoRI and ligated between the same sites in pGMok-Mok, giving pGPV-Mok, which contains an in-frame fusion of aa 1 to 257 from G PV with aa 258 to 503 from G Mok.

The pG-PVIII gene, with an internal in-frame deletion between the end of the PV signal peptide and residue 253, was obtained by introducing a synthetic adapter between the EcoRI and BclI restriction sites of the pGMok-PV plasmid. This PV adapter, containing a single EcoRI site, was generated by annealing 200 pmol of each of the following primers in 250 mM Tris-HCl (pH 7.7): PVp1 (5′AATTCTAGAGCCGCCACCATGGTTCCTCAGGCTCTCCTGTTTGTA CCCCTTCTGGTTTTTCCATTGTGTTTTGGGAAGAATTCCCCCCCCGG TCAGTT 3′) and Pvp2 (5′GATCAACTGACCGGGGGGGGAATTCTTCCCAAAACACAATGGAAAAACCAGAAGGGGTACAAACAGGAGAGCCTGAGGAACCATGGTGGCGGCTCTAG 3′).

To generate the pGEBL1-PV gene, a synthetic adapter corresponding to aa 2 to 14 from EBL1a (strain 8615POL) (1) and single BstEII and EcoRI restriction sites was generated in the same way as that for pG-PVIII by annealing with primers EBL1p1 (5′AATTTCCCAATCTACACCATCCCGGATAAAATCGGACCGTGGTCACCTATTCCG 3′) and EBL1p2 (5′AATTCGGAATAGGT GACCACGGTCCGATTTTATCCGGGATGGTGTAGATTGGGA3′). This EBL1 adapter was ligated in frame into the EcoRI site of pG-PVIII. A fragment corresponding to aa 15 to 253 from EBL1a (strain 8615POL) was then generated by RT-PCR of viral RNA by using primers EBL1p3 (5′CCGTGGTCACCTAT TGATATAAACCATCTCAGCTGCCCAAACAACTTGATCGTGGAAGAT GAG3′) and EBL1p4 (5′GGAATTCGAGCACCATTCTGGAGCTTC 3′. The RT-PCR product was digested with BstEII and EcoRI and was ligated into the same sites introduced via the EBL1 adapter, resulting in an in-frame fusion between the PV signal peptide, the EBL1a site II part, and the PV site III part.

The identity of each construct was confirmed by automatic sequencing with dye terminator reaction on an ABI 377 sequencer (Perkin-Elmer).

Transient expression experiments.

The ability of plasmids to induce transient expression of G-related antigens was tested after transfection of Neuro-2a cells by using the DOTAP [(N-(1-2,3,-dioleoyloxy)propyl)-N,N,N-trimethylammoniummethyl-sulfate] cationic liposome-mediated method according to the manufacturer’s (Boehringer Mannheim) instructions. Each well of a cell culture microplate (Falcon) was inoculated with 3 × 104 cells (in MEM–10% FBS) and incubated for 24 h at 37°C in a humidified atmosphere containing 7.5% CO2. The plate was then washed with MEM without FBS and incubated as described above for 1 h. The cell supernatant was removed, and the wells were washed and filled with 50 μl of transfection solution, containing 0.1 μg of plasmid and 6 μl of DOTAP in sterile HEPES-buffered saline (150 mM NaCl, 20 mM HEPES) previously incubated at room temperature for 15 min. The plate was incubated for 5 h at 37°C in the presence of 7.5% CO2. Two hundred microliters of MEM containing 2% FBS was added to each well, and the plate was incubated for 24 to 140 h under the same conditions, before analysis of transient expression by indirect immunofluorescence.

Antibodies.

Polyclonal antibodies (PAbs) directed against PV and Mok G were obtained as described elsewhere, by rabbit immunization with purified virus glycoprotein (28). A PAb against EBL1b virus was obtained by mouse immunization with inactivated and purified virus.

Three MAbs directed against PV G were also used. The PVE12 MAb (a gift from M. Lafon) recognizes site II of native G (20). The D1 MAb (immunoglobulin G1 [IgG1] isotype), produced in our laboratory, recognized site III of native but not sodium dodecyl sulfate (SDS)-treated G. The 6A1 MAb (a gift from F. Lafay) recognizes SDS-denatured G protein and more precisely two peptides located downstream from site III, near the COOH-terminal part of the G ectodomain (aa 342 to 433 and 397 to 450) (18).

Immunofluorescence microscopy.

Transient expression of G antigens in transfected cells was assessed with and without permeabilization (30-min incubation with 80% acetone on ice followed by air drying). Transfected cells were incubated for 1 h at 37°C with PAb or MAb. They were washed with phosphate-buffered saline (PBS) and incubated for 1 h at 37°C with goat anti-rabbit or anti-mouse fluorescein isothiocyanate-conjugated secondary antibody (Nordic Immunology Laboratories, Tilburg, The Netherlands). Cells were washed, mounted in glycerol, and examined with a Leica inverted fluorescence microscope.

Injection of plasmids into mice.

For immunological studies, BALB/c mice were anesthetized with pentobarbital (30 mg/kg of body weight), and 20 μg of plasmid (diluted in PBS) was injected into each anterior tibialis muscle. This was more effective than injection via the quadriceps route (personal observation). Blood was collected for antibody assay of serum on various days by retro-orbital puncture.

IL-2 release assay.

Spleens were removed from naive or plasmid-injected BALB/c mice. Splenocytes (1-ml aliquots containing 6 × 106 cells) were stimulated with 0.5 μg of lyssavirus antigen or 5 μg of ConA (Miles) in 24-well plates (Nuclon-Delta; Nunc, Roskilde, Denmark) and cultured as described elsewhere (17, 30) in RPMI 1640 medium (Gibco) containing 10% FBS, 1 mM sodium pyruvate, 1 mM nonessential amino acids, 5 × 10−5 M 2-mercaptoethanol, and 10 mM HEPES buffer (Flow Laboratories). Cells were incubated for 24 h at 37°C in a humidified atmosphere containing 7% CO2. Under these conditions, the cells producing IL-2 are mainly CD4+ cells (17). IL-2 produced in supernatants of splenocyte cultures was titrated by bioassay with CTLL cells as previously described (29). Cell proliferation was determined in triplicate, based on the uptake of [3H]thymidine (New England Nuclear). The IL-2 concentration is given in units per milliliter, with mouse recombinant IL-2 (Genzyme Corporation, Cambridge, Mass.) used as the reference. CTLL cells grew in the presence of mouse IL-2 and anti-IL-4 antibodies, but not in the presence of IL-4 (up to 10 U/ml) and in the absence of IL-2 (17). So, IL-2 was predominantly detected by this technique.

Antibody assays.

Total antirabies IgG or IgG1, IgG2a, and IgG3 isotypes were assayed by enzyme-linked immunosorbent assay (ELISA) with microplates coated with IPRV as previously described (33) with rabbit anti-mouse IgG isotype serum as the secondary antibody (Nordic Immunology Laboratories) and a goat anti-rabbit IgG peroxidase conjugate (Nordic Immunology Laboratories) as the tertiary antibody.

Lyssavirus-neutralizing antibodies were titrated by the rapid fluorescent focus inhibition test (RFFIT) (38) with the previously described modifications (33). Infected-cell supernatants (PV, CVS, and EBL2 viruses) and purified viruses (Mok and EBL1 viruses) were used. Anti-PV or -CVS antibody titers are expressed in international units per milliliter, with the 2nd International Standard (Statens Seruminstitut, Copenhagen, Denmark) as the reference. For determination of the titers of antibodies against other lyssaviruses, we took the serum dilution causing 50% inhibition of the fluorescent focus rate as having the same VNAb titer as that of the reference assayed against CVS.

Protection test.

The protective activity of vaccines and plasmids was determined according to the National Institutes of Health potency test (36). Dilutions of vaccine were injected intraperitoneally (i.p.) into mice on days 0 and 7, whereas plasmids (40 μg) were injected into each anterior tibialis muscle on day 0 only. Mice were then intracerebrally (i.c.) challenged on day 21 with about 30 50% lethal doses (LD50s) of one of the various lyssaviruses (CVS, EBL1b, or EBL2b). The animals were observed for 28 days.

RESULTS

Transient expression of lyssavirus G genes.

Plasmids containing homogeneous (pGPV-PV), truncated (pG-PVIII), and chimeric (pGEBL1-PV, pGMok-PV, and pGPV-Mok) lyssavirus G genes were used to transfect Neuro-2a cells. Cell staining by indirect immunofluorescence is shown in Fig. 2 and can be summarized as follows. After transfection with pGPV-PV, antigen was detected with PV PAb (Fig. 2A), PV D1 MAb (Fig. 2B), or PV E12 Mab (not shown), mostly at the cell membrane (similar results were found with nonpermeabilized cells [data not shown]), and very little antigen was detected with the 6A1 Mab (Fig. 2C). Cells transfected with pG-PVIII were round and completely stained (both cytoplasm and membrane) with PV PAb (Fig. 2D) or 6A1 MAb (Fig. 2F), but not with PV D1 MAb (Fig. 2E). Cells transfected with pGEBL1-PV were stained mostly at the cell membrane with PV PAb (Fig. 2G), PV D1 MAb (Fig. 2H), or EBL1 PAb (Fig. 2I). Cells transfected with pGMok-PV were stained (mainly at the membrane) with PV PAb (Fig. 2J), PV D1 MAb (Fig. 2K), or Mok PAb (Fig. 2L), and very few were stained with the 6A1 MAb (data not shown). Cells transfected with pGPV-Mok were stained with PV PAb (Fig. 2M) or Mok PAb and were round (Fig. 2N). It seems that cell transfection allowed us to distinguish between two types of G antigens: (i) those stained principally at the membrane of cells normal in shape, in particular, with neutralizing MAbs directed to sites II (PV E12) and III (PV D1); (ii) those stained in both the cytoplasm and membrane of round cells, particularly with the MAb (6A1) that recognizes the denatured G molecule.

FIG. 2.

FIG. 2

Indirect immunofluorescence microscopy of lyssavirus G protein production in Neuro-2a cells 48 h after transient transfection with various plasmids: pGPV-PV (A, B, and C), pG-PVIII (D, E, and F), pGEBL1-PV (G, H, and I), pGMok-PV (J, K, and L), and pGPV-Mok (M, N, and O). Forty-eight hours after transfection, cells were permeabilized and stained with antibodies: anti-PV G PAb (A, D, G, J, and M), PV D1 anti-native PV G site III MAb (B, E, H, and K), 6B1 anti-denatured G site III MAb (C and F), anti-EBL-1 G Pab (I), anti-Mok G PAb (L and N), and serum from an unimmunized mouse (O).

The kinetics of G protein expression was studied upon transfection of cells with three representative plasmids: pGPV-PV (homogeneous), pGEBL1-PV (chimeric), and pG-PVIII (truncated). pGPV-PV produced G antigens in about 60% of cells when stained with PV PAb, whereas very few cells were stained with the PV 6A1 MAb at any time point (Fig. 3a). About 55% of cells transfected with pGEBL1-PV were stained with PV PAb, and up to 15% were stained with the 6A1 MAb (Fig. 3b), indicating that some G molecules were denatured. Ten to twenty percent of the cells transfected with pG-PVIII were round and stained with PV PAb, whereas 5 to 10% were positive by the 6A1 MAb, indicating that G molecules were denatured (Fig. 3c).

FIG. 3.

FIG. 3

Kinetic study of antigen synthesis in Neuro-2a cells transiently transfected with pGPV-PV (a), pGEBL1-PV (b), or pG-PVIII (c). Cells were permeabilized at various times and stained with PV PAb (open bars) or the anti-denatured G site III 6B1 MAb (solid bars).

Induction of IL-2-producing cells.

The ability of the plasmids pGPV-PV, pG-PVIII, pGEBL1-PV, pGMok-PV, and pGPV-Mok to induce IL-2-producing cells was assayed (Fig. 4). Plasmids with the site III part of PV, whether unfused (pG-PVIII) or fused with any lyssavirus site II part (pGPV-PV, pGEBL1-PV, and pGMok-PV), efficiently induced IL-2-producing cells (240 to 550 mU/ml). This was true even for pG-PVIII, which, however, had only low efficiency for both cell transfection (see above) and antibody induction (see below). For the chimeric plasmids pGEBL1-PV and pGMok-PV, the T-cell response was greater after stimulation with inactivated and purified PV than with the EBL1b and Mok viruses. This was not due to the quality of the purified antigens, because immunization of BALB/c mice with PV, EBL1b or Mok IPRV followed by in vitro stimulation with the same antigen induced similar levels of IL-2 production (PV, 250 mU/ml; EBL1b, 350 mU/ml; and Mok, 400 mU/ml). In contrast, the plasmid pGPV-Mok induced only a weak Th cell response (IL-2 titer, 50 mU/ml), which was similarly produced in vitro after stimulation with either IPRV PV or Mok virus.

FIG. 4.

FIG. 4

Induction of IL-2-producing cells by plasmids encoding various lyssavirus G proteins. BALB/c mice (two animals for each plasmid) were injected intramuscularly (50 μl in each anterior tibialis muscle) with 40 μg of plasmid (pGPV-PV, pG-PVIII, pGEBL1-PV, pGMok-PV, and pGPV-Mok). Spleens were removed 21 days later, and splenocytes were specifically stimulated in vitro by inactivated and purified viruses (PV, EBL1, or Mok), G PV, or polyclonally stimulated by ConA. The amount of IL-2 released was then assayed in triplicate by bioassay, and the titers were expressed as units per milliliter.

Serological assays.

The truncated pG-PVIII plasmid did not induce the production of rabies antibodies, when assayed by RFFIT and ELISA. However when IL-2 was injected together with pG-PVIII and then injected alone 7 days later, antibodies were detected on day 21 only by ELISA (data not shown). Thus, the site III part was expressed in vivo and induced a weak production of nonneutralizing antibodies, which was boosted by exogenous IL-2.

In contrast, when the site III part of PV was linked with the homologous site II part, as in pGPV-PV, it displayed strong immunogenicity. A single injection of pGPV-PV plasmid into mice resulted in high levels of VNAbs measured 27 days later against both the homologous PV and CVS viruses and the heterologous EBL2b virus (Fig. 5a). The antibody isotype induced was mainly IgG2a, but a weak IgG1 response was also observed (data not shown). However, the correlation between VNAb titers against PV was stronger with the IgG2a titer (r = 0.974) than with the IgG1 titer (r = 0.71), indicating that VNAbs induced by DNA-based immunization were mainly IgG2a. The VNAb titer against the homologous PV and CVS viruses increased when mice had a booster injection on day 30 and their sera were checked at day 40, but not the VNAb titers against the heterologous EBL2b virus, which remained unchanged (Fig. 5a). Under these conditions, we also demonstrated a relationship between VNAb level induced by pGPV-PV and the protection of mice against an i.c. challenge with CVS: all animals with a VNAb titer (on day 20) above 1.5 IU/ml survived the challenge on day 21 (data not shown). In contrast, no significant amount of VNAb against EBL1b was produced, neither after a single injection nor after a booster injection.

FIG. 5.

FIG. 5

Induction of VNAb against European lyssavirus GTs by pGPV-PV or pGEBL1-PV plasmid. BALB/c mice were injected with 40 μg of plasmid in the tibialis muscle. (a) Mice received a boost on day 30. Sera (pool of three samples) were assayed on days 27 and 40 for VNAb against viruses of GT1 (CVS and PV), GT4 (EBL1b), and GT5 (EBL2b). (b) Four mice received only one injection of plasmid, and blood samples were collected at various intervals by transorbital puncture. Sera were assayed by RFFIT with PV and EBL1b viruses for VNAb determination.

Thus, we investigated the capability of the site III part of PV to carry the heterologous EBL1 site II part, following our previous observation that the chimeric plasmid pGMok-PV induced VNAbs against both PV and Mok viruses (4). A single injection of the chimeric plasmid pGEBL1-PV similarly induced VNAbs against both PV and EBL1b viruses (Fig. 5b). Fourteen days after injection, the titers were 2 IU/ml, and they increased to 17 IU/ml after 80 days. The level of VNAb production against EBL1b was always higher than that against PV, but the difference was not significant. Taken together, these results clearly demonstrate that chimeric G genes encoding the site III part of PV and the site II part of G of other lyssaviruses, such as EBL1b and Mok (4), are very potent inducers of VNAbs against both parental viruses. In contrast, the symmetric pGPV-Mok construct did not induce VNAbs against either the PV or Mok virus (not shown).

Assays of protection against European lyssaviruses.

We tested the ability of both the homogeneous pGPV-PV plasmid and the chimeric pGEBL1-PV plasmid to induce protection against an i.c. challenge with viruses representing lyssavirus GTs involved in the transmission of encephalomyelitis in Europe (CVS for GT1, EBL1b for GT5, and EBL2b for GT6). We compared their efficiency with that of a commercially available vaccine (PM strain [GT1]) and a laboratory preparation (PV strain [GT1]) (Fig. 6).

FIG. 6.

FIG. 6

Comparative protection induced by pGPV-PV and pGEBL1-PV plasmids and rabies virus PM and PV vaccines against CVS, EBL1b, and EBL2b. For immunization with inactivated viruses (a, b, and c), BALB/c mice (nine animals per series) were injected i.p. on days 0 and 7 with 0.5 ml of PM vaccine diluted 1/10 (solid circles) or with 2 μg of IPRV PV (solid squares). For DNA-based immunization (d, e, and f), BALB/c mice (five animals for each plasmid) were injected in the tibialis muscle with PBS (open circles) or with 40 μg of one of the various plasmids pGPV-PV (diamonds), EBL1-PV (solid triangles), and pClneo backbone (crosses). Swiss mice (six animals) were injected with pGPV-PV (open squares). BALB/c and Swiss mice were challenged i.c. on day 21 with about 30 LD50s of CVS (a and d), EBL1b (b and e), and EBL2b (c and f).

The plasmid backbone (pClneo) did not induce protection against any virus (Fig. 6d, e, and f). In contrast, pGPV-PV protected 70% of BALB/c mice (and 85% of the Swiss mice) against CVS (Fig. 6d), 30% of them against EBL1b (Fig. 6e), and 72% of them against EBL2b (Fig. 6f). Under the same conditions, pGEBL1-PV protected 60% of BALB/c mice against CVS (Fig. 6d), 75% of them against EBL1b (Fig. 6e), and 80% of them against EBL2b (Fig. 6f). Thus, if immunization with any of the two plasmids showed no significant difference in the protection against CVS (GT1) and EBL2b (GT6), the chimeric pGEBL1-PV was far more efficient against EBL1b (GT5) and is clearly the best candidate for protection with DNA-based immunization against the three European lyssavirus genotypes.

Concerning the protection induced by inactivated cell culture vaccines using the PM and PV strains against the same challenges, a human dose of PM vaccine diluted 1/10 protected 80% of mice against CVS (Fig. 6a), 36% of mice against EBL1b (Fig. 6b), and 80% of mice against EBL2b (Fig. 6c). Under the same conditions, 2 μg of IPRV PV protected 100% of mice against both CVS (Fig. 6a) and EBL1b (Fig. 6b) and 85% of mice against EBL2b (Fig. 6c). It seems that for a vaccine dose which protected 80 to 85% of the animals against EBL2b, the PV strain protected 100% of mice and the PM strain protected only 36% of mice against EBL1b. Thus, the PM strain is less effective than the PV strain against EBL1b.

DISCUSSION

The immunogenicity and structure of lyssavirus glycoproteins were assessed by using homogeneous and chimeric plasmids for DNA-based immunization and cell transfection. We investigated the respective functions of G antigenic site II and III parts in the immunological properties of the lyssavirus G proteins and in their protective activity against various genotypes. The only known linear region of the ectodomain, carrying the linear virus-neutralizing epitope VI around aa 264 (10), was used as a flexible hinge to separate the two main antigenic sites: the site II part on the NH2 side and the site III part on the COOH side. The plasmids tested carried either full-length G genes of a homogeneous (pGPV-PV or pGMok-Mok) or chimeric (pGMok-PV, pGEBL1-PV, or pGPV-Mok) nature or a truncated G gene (pG-PVIII). All of them encoded a signal peptide promoting the protein translocation into the endoplasmic reticulum, as well as the transmembrane and endoplasmic domains for the membrane anchorage.

All plasmids were transiently expressed in transfected Neuro-2a cells and could be classified into two families according to antigen location: (i) those located mainly at the membrane (pGPV-PV, pGMok-Mok, pGEBL1-PV, and pGMok-PV); and (ii) those located inside round cells (pG-PVIII and pGPV-Mok). The G proteins from the first family are normally transported to the membrane and recognized by virus-neutralizing MAbs specific for antigenic sites II and III. This suggests a native folding of these sites as it was evidenced after cell infection with the PV strain (not shown). In contrast, the G proteins from the second family are stained by using PAb or nonneutralizing MAb. For example, the truncated G-PVIII is stained by a MAb recognizing the denatured G protein, but not by a virus-neutralizing MAb directed against site III. This indicates that folding and transport were not correct and possibly induced modifications in cell shape.

It is interesting to consider which of the maturation steps (folding, posttranslational modifications, and oligomerization) are primarily affected in the synthesis of G proteins of the second family. Glycosylation plays a key role in the folding of rabies virus G protein and in its transport from the endoplasmic reticulum to the Golgi apparatus (14, 37). Even though several potential N-linked glycosylation sites exist along the lyssavirus G proteins (12, 39), only Asn319 is shared by all of them, and it is the only N-linked glycosylation site in EBL1 (3), i.e., in the G protein encoded by pGEBL1-PV plasmid. This demonstrates that glycosylation of Asn319 is sufficient for correct folding and transport of the G protein (37). Since Asn319 is present in pG-PVIII and pGPV-Mok, other factors than glycosylation are probably required for the maturation of these antigens. The cooperative conformation of a lyssavirus site II could be a prerequisite for the correct folding of the PV site III, as demonstrated in both homogeneous (G PV-PV) and chimeric (G Mok-PV and G EBL1-PV) full-length G proteins. However, the symmetrical observation for the Mok site III is not true, since the pGPV-Mok plasmid mainly produced a denaturated chimeric G protein. An alternative hypothesis would be impairment in oligomerization, as supported by the observation that G PV-Mok and G-PVIII induced a low level of antibody or no antibody. Rabies virus G protein oligomerization was shown to be important in both antibody accessibility and immunogenicity (31), and B cells preferentially recognize highly repetitive and organized antigens (2).

Although the antigen produced by the pG-PVIII plasmid does not seem to be correctly folded, it induces IL-2-producing cells in mice at a level similar to that of the plasmids having the site III part of PV fused to any lyssavirus site II (pGPV-PV, pGMok-PV, and pGEBL1-PV). This shows that the Th epitopes are presented and recognized in vivo by Th cells independently of the correct folding of the G protein. IPRV PV was more effective than Mok and EBL1b virus for the stimulation in vitro of splenocytes from mice immunized with the chimeric plasmids pGMok-PV and pGEBL1-PV. In addition, both homogeneous pGMok-Mok (4) and chimeric pGPV-Mok plasmids induced lower levels of Th cells. Taken together, these data suggest that the site III part from the PV strain is more effective for inducing Th cells than the PV strain site II part or the Mok virus site III part.

It is striking that the high levels of IL-2-producing cells induced by immunization with pG-PVIII did not stimulate any antibody production. Only exogenous IL-2 coinjected and boosted 7 days later generated an appreciable antibody level (no VNAb due to the incorrect folding of G-PVIII). This adjuvant effect of IL-2 given as purified protein was previously observed with inactivated rabies antigens according to the same protocol used for IL-2 administration (30), whereas a DNA vector encoding IL-2 was not effective (27). Therefore, exogenous IL-2 appears more effective than endogenous IL-2 from any origin, whether produced by Th cells or gene expression from a plasmid.

A key point of this paper is the clear demonstration that lyssavirus glycoprotein molecules can be split into two structurally and immunologically dependent parts: the COOH half carrying site III and anchoring the protein to the membrane and the NH2 half carrying site II, which stabilizes the conformation of site III. In any combination between site II and site III, the sites are not equivalent. For example, the pGPV-Mok chimera, with an organization similar to that in wild-type G proteins, is expressed in cells, but does not induce VNAb production. In contrast, the site III part of the PV glycoprotein can present various lyssavirus sites II (PV, EBL1, or Mok) with a high level of immunological potency. For example, production of a VNAb, predominantly of the IgG2a subclass, is induced, suggesting that a Th1-like Th cell response is induced by DNA-based immunization (22, 43). A limited flexibility is authorized at the site II-site III junction, at least between aa 257 (pGMok-PV) and aa 247. The latter position marked the junction of a chimeric G gene previously produced by fusion of the site II part of Mok (Eth-16 strain [GT3]) with the site III part of the SAD strain (GT1), homologous to the PV strain (26). Like G PV-PV, G Mok-PV and G EBL1-PV, G Mok-SAD was normally expressed, transported to the cell surface, and immunoprecipitated with MAb recognizing correctly folded antigenic site III (25). However, G Mok-SAD cannot rescue infectious particles, indicating that if the folding of the hybrid was acceptable for immunological properties, it was not sufficient for either oligomerization, attachment to the receptor, or conformational changes necessary to mediate fusion.

We used the lyssavirus chimeric G gene to investigate protection against all lyssavirus GTs circulating in Europe. This concerned not only the rabies viruses (GT1) prevented by classical vaccines, but also the EBLs EBL1 (GT5) and EBL2 (GT6), each of which has been recently subdivided into two very closely related phylogenetic lineages, a and b (1, 6). The protection afforded against EBL1 and EBL2 depends on both vaccine and virus strains. Protection against EBL1a (strain Hamburg) is achieved in mice by the PV strain (21) but not the PM or Flury LEP strain (21, 35). However, the PM strain induces partial protection against EBL2b (a human isolate from Finland) (11). We verified that for doses of PV and PM vaccine which induced similar levels of protection against CVS (80 to 100%) and EBL2b (80 to 85%), the PV vaccine gave greater protection against EBL1b (100%) than did the PM vaccine (36%). This emphasized the advantage of using PV rather than PM as the virus strain for the production of cell culture vaccine. According to protective activity, EBL2b seems to be equidistant from PV and PM, and EBL1b might be closer to PV than to the PM strain. However, according to phylogenetic relationships as well as amino acid conservation in the G ectodomain, strong similarity is observed between PM and PV, while EBL1 and EBL2 strains are equidistant from each of them and from each other (3).

DNA-based immunization with the pGPV-PV plasmid also induced a high VNAb level and gave similar protection (75%) against CVS and EBL2b, confirming an antigenic community between the glycoproteins of GT1 and GT6. However, both the VNAb level and the protection against EBL1b (36%) were weak, contrasting with the 100% protection obtained with PV IPRV. The difference could be due to technical difficulties (injection into the tibialis muscle used for DNA immunization is less reproducible) or to an adjuvant effect of other viral proteins on G immunogenicity for immunization with IPRV.

Because pGPV-PV plasmid did not gave satisfactory protection against all European lyssavirus GTs, the chimeric pGEBL1-PV plasmid was constructed to achieve this goal. It induced high levels of VNAb against the two parental genotypes. This indicates that the site III part of PV presents the site II part of rabies-related viruses, and each part maintains its ability to induce specific VNAbs. pGEBL1-PV also induced a high level of protection against EBL2b, similar to that induced by the homogeneous pGPV-PV gene. This indicates that PV site III is mainly involved in protection against EBL2, as previously noted for another chimeric G protein, G Mok-PV (4). The protection induced by pGEBL1-PV mostly correlated with the VNAb production, and the lower level of protection induced against CVS (GT1) could reflect the better immunogenicity of site II (EBL1b sequence [GT5]) compared to site III (PV sequence [GT1]) as suggested by Benmansour et al. (5).

In conclusion, using the capacity of the site III part of PV to correctly present the site II part of Mok (4) or EBL1b virus, we have demonstrated that chimeric G proteins could be used to broaden the range of protection against lyssaviruses. Thus, the simultaneous use of pGMok-PV and pGEBL1-PV chimeric plasmids would be the first experimental vaccine preventing all lyssavirus infection. Work is currently in progress to construct a unique chimeric plasmid offering protection against the six genotypes and to take advantage of the flexibility at the site II-site III junction to carry and potentiate foreign epitopes and promote the lyssavirus G protein as an immunogenic backbone for transdisease vaccines.

ACKNOWLEDGMENTS

We are grateful to Y. Gaudin for helpful discussion and to P. Bouige for the preparation of the PV D1 monoclonal antibody.

A.D. and C.B. were supported by fellowships from the G. Daimler-K. Benz Foundation and the Tunisian government, respectively.

REFERENCES

  • 1.Amengal B, Whitby J, Cobo S, Bourhy H. Evolution of European bat lyssaviruses. J Gen Virol. 1997;78:2319–2328. doi: 10.1099/0022-1317-78-9-2319. [DOI] [PubMed] [Google Scholar]
  • 2.Bachmann M, Zinkernagel R. Neutralizing antiviral B cell responses. Annu Rev Immunol. 1997;15:235–270. doi: 10.1146/annurev.immunol.15.1.235. [DOI] [PubMed] [Google Scholar]
  • 3.Badrane, H., C. Bahloul, P. Perrin, and N. Tordo. Genetic diversity of lyssaviruses: implications in vaccinology, pathogenesis and phylogeny. Submitted for publication.
  • 4.Bahloul C, Jacob Y, Tordo N, Perrin P. DNA-based immunization for exploring the enlargement of immunological cross-reactivity against the lyssaviruses. Vaccine. 1998;16:417–425. doi: 10.1016/s0264-410x(97)00204-1. [DOI] [PubMed] [Google Scholar]
  • 5.Benmansour A, Leblois H, Coulon P, Tuffereau C, Gaudin Y, Flamand A, Lafay F. Antigenicity of rabies virus glycoprotein. J Virol. 1991;65:4198–4203. doi: 10.1128/jvi.65.8.4198-4203.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bourhy H, Kissi B, Lafon M, Sacramento D, Tordo N. Antigenic and molecular characterization of bat rabies virus in Europe. J Clin Microbiol. 1992;30:2419–2426. doi: 10.1128/jcm.30.9.2419-2426.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bourhy H, Kissi B, Tordo N. Molecular diversity of the Lyssavirus genus. Virology. 1993;194:70–81. doi: 10.1006/viro.1993.1236. [DOI] [PubMed] [Google Scholar]
  • 8.Coulon P, Ternaux J-P, Flamand A, Tuffereau C. An avirulent mutant of rabies virus is unable to infect motoneurons in vivo and in vitro. J Virol. 1998;72:273–278. doi: 10.1128/jvi.72.1.273-278.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Delagneau J F, Perrin P, Atanasiu P. Structure of the rabies virus: spatial relationships of the proteins G, M1, M2 and N. Ann Inst Pasteur Virol. 1981;132E:473–493. [Google Scholar]
  • 10.Dietzschold B, Gore M, Marchadier D, Niu H-S, Bunschoten H, Otvos L, Jr, Wunner W H, Ertl H C J, Osterhaus A D M E, Koprowski H. Structural and immunological characterization of a linear virus-neutralizing epitope of the rabies virus glycoprotein and its possible use in a synthetic vaccine. J Virol. 1990;64:3804–3809. doi: 10.1128/jvi.64.8.3804-3809.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Fekadu M, Shaddock J, Sanderlin D, Smith J. Efficacy of rabies vaccines against virus isolated from European house bats (Eptesicus serotinus), classic rabies and rabies-related virus. Vaccine. 1988;6:533–539. doi: 10.1016/0264-410x(88)90107-7. [DOI] [PubMed] [Google Scholar]
  • 12.Gaudin Y. Folding of rabies virus glycoprotein: epitope acquisition and interaction with endoplasmic reticulum chaperones. J Virol. 1997;71:3742–3750. doi: 10.1128/jvi.71.5.3742-3750.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Gaudin Y, Ruigrok R, Tuffereau C, Knossow M, Flamand A. Rabies glycoprotein is a trimer. Virology. 1992;187:627–632. doi: 10.1016/0042-6822(92)90465-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gaudin Y, Tuffereau C, Durrer P, Flamand A, Ruigrok R W H. Biological function of the low-PH, fusion-inactive conformation of rabies virus glycoprotein (G): G is transported in a fusion-inactive state-like conformation. J Virol. 1995;69:5528–5534. doi: 10.1128/jvi.69.9.5528-5534.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gaudin Y, Tuffereau C, Segretain D, Knossow M, Flamand A. Reversible conformational changes and fusion activity of rabies virus glycoprotein. J Virol. 1991;65:4853–4859. doi: 10.1128/jvi.65.9.4853-4859.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hooper P, et al. A new lyssavirus—the first endemic rabies related virus recognized in Australia. Bull Inst Pasteur. 1997;95:209–218. [Google Scholar]
  • 17.Joffret M-L, Zanetti C, Morgeaux S, Leclerc C, Sureau P, Perrin P. Appraisal of rabies vaccine potency by determination of in vitro, specific interleukin-2 production. Biologicals. 1991;19:113–123. doi: 10.1016/1045-1056(91)90009-9. [DOI] [PubMed] [Google Scholar]
  • 18.Lafay F, Benmansour A, Chebli K, Flamand A. Immunodominant epitopes defined by a yeast-expressed library of random fragments of the rabies virus glycoprotein map outside major antigenic sites. J Gen Virol. 1996;77:339–346. doi: 10.1099/0022-1317-77-2-339. [DOI] [PubMed] [Google Scholar]
  • 19.Lafon M, Bourhy H, Sureau P. Immunity against the European bat rabies (Duvenhage) virus induced by rabies vaccines: an experimental study in mice. Vaccine. 1988;6:362–368. doi: 10.1016/0264-410x(88)90184-3. [DOI] [PubMed] [Google Scholar]
  • 20.Lafon M, Perrin P, Versmisse P, Sureau P. Use of a monoclonal antibody for quantitation of rabies vaccine glycoprotein by enzyme immunoassay. J Biol Stand. 1985;13:295–301. doi: 10.1016/s0092-1157(85)80042-1. [DOI] [PubMed] [Google Scholar]
  • 21.Lafon M, Wiktor T, MacFarlan R. Antigenic sites on the CVS rabies virus glycoprotein: analysis with monoclonal antibodies. J Gen Virol. 1983;64:843–845. doi: 10.1099/0022-1317-64-4-843. [DOI] [PubMed] [Google Scholar]
  • 22.Leclerc C, Dériaud E, Rojas M, Whalen R. The preferential induction of Th1 immune response by DNA-based immunization is mediated by the immunostimulatory effect of plasmid DNA. Cell Immunol. 1997;179:97–106. doi: 10.1006/cimm.1997.1161. [DOI] [PubMed] [Google Scholar]
  • 23.Lodmell D L, Smith J S, Esposito J J, Ewalt L C. Cross-protection of mice against a global spectrum of rabies virus variants. J Virol. 1995;69:4957–4962. doi: 10.1128/jvi.69.8.4957-4962.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.MacFarlan R, Dietzschold B, Wiktor T, Kiel M, Houghten R, Lerner R, Sutcliffe G, Koprowski H. T cell responses to cleaved rabies virus glycoprotein and to synthetic peptides. J Immunol. 1984;133:2748–2752. [PubMed] [Google Scholar]
  • 25.Maniatis T, Fritsch E F, Sambrook J. Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory; 1982. [Google Scholar]
  • 26.Mebatsion T, Schnell M J, Conzelmann K-K. Mokola virus glycoprotein and chimeric proteins can replace rabies virus glycoprotein in the rescue of infectious defective rabies virus particles. J Virol. 1995;69:1444–1451. doi: 10.1128/jvi.69.3.1444-1451.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Pasquini S, Xiang Z, Wang Y, Deng H, Blaszczyk M, Ertl H. Cytokines and costimulatory molecules as antigenic adjuvants. Immunol Cell Biol. 1997;75:397–401. doi: 10.1038/icb.1997.62. [DOI] [PubMed] [Google Scholar]
  • 28.Perrin P. Techniques for the preparation of rabies conjugates. In: Meslin F-X, Kaplan M, Koprowski H, editors. Laboratory techniques in rabies. Geneva, Switzerland: World Health Organization; 1996. pp. 433–445. [Google Scholar]
  • 29.Perrin P, De Franco M, Jallet C, Fouque F, Morgeaux S, Tordo N, Colle J-H. The antigen-specific cell-mediated immune response in mice is suppressed by infection with pathogenic lyssaviruses. Res Virol. 1996;147:289–299. doi: 10.1016/0923-2516(96)82287-4. [DOI] [PubMed] [Google Scholar]
  • 30.Perrin P, Joffret M-L, Leclerc C, Oth D, Sureau P, Thibodeau L. Interleukin-2 increases protection against experimental rabies. Immunobiology. 1988;177:199–209. doi: 10.1016/S0171-2985(88)80039-1. [DOI] [PubMed] [Google Scholar]
  • 31.Perrin P, Joffret M-L, Oth D, Leclerc C, Sureau P, Thibodeau L. Interleukin-2 production in vitro: a new approach to the study of rabies vaccine immunogenicity as appraised by testing different glycoprotein presentations. Vaccine. 1988;6:331–338. doi: 10.1016/0264-410x(88)90179-x. [DOI] [PubMed] [Google Scholar]
  • 32.Perrin P, Thibodeau L, Sureau P. Rabies immunosomes (subunit vaccine) structure and immunogenicity. Pre- and post exposure protection studies. Vaccine. 1985;3:325–332. doi: 10.1016/s0264-410x(85)90224-5. [DOI] [PubMed] [Google Scholar]
  • 33.Perrin P, Versmisse P, Delagneau J F, Lucas G, Rollin P, Sureau P. The influence of the type of immunosorbent on rabies antibody EIA: advantages of purified glycoprotein over whole virus. J Biol Stand. 1986;14:95. doi: 10.1016/0092-1157(86)90027-2. [DOI] [PubMed] [Google Scholar]
  • 34.Schneider L G, Dietzschold B, Dierks R E, Mathaeus W, Enzmann P-J, Strohmaier K. Rabies group-specific ribonucleoprotein antigen and a test system for grouping and typing rhabdoviruses. J Virol. 1973;11:748–755. doi: 10.1128/jvi.11.5.748-755.1973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Schneider L G. Antigenic variants of rabies virus. Comp Immunol Microbiol Infect Dis. 1982;5:101–107. doi: 10.1016/0147-9571(82)90021-2. [DOI] [PubMed] [Google Scholar]
  • 36.Seligmann E. The NIH test for potency. In: Kaplan M, Koprowski H, editors. Laboratory techniques in rabies. Geneva, Switzerland: World Health Organization; 1973. pp. 279–286. [PubMed] [Google Scholar]
  • 37.Shakin-Eshleman S, et al. N-linked glycosylation of rabies glycoprotein. J Biol Chem. 1992;267:10690–10698. [PubMed] [Google Scholar]
  • 38.Smith J, Yager P, Baer G. A rapid fluorescent focus inhibition test (RFFIT) for determining virus-neutralizing antibody. In: Meslin F-X, Kaplan M, Koprowski H, editors. Laboratory techniques in rabies. 4th ed. Geneva, Switzerland: World Health Organization; 1996. pp. 181–189. [Google Scholar]
  • 39.Tordo N. Characteristics and molecular biology of the rabies virus. In: Meslin F-X, Kaplan M, Koprowski H, editors. Laboratory techniques in rabies. Geneva, Switzerland: World Health Organization; 1996. pp. 28–51. [Google Scholar]
  • 40.Tuffereau C, Benejean J, Alfonso A-M R, Flamand A, Fishman M C. Neuronal cell surface molecules mediate specific binding to rabies virus glycoprotein expressed by a recombinant baculovirus on the surfaces of lepidopteran cells. J Virol. 1998;72:1085–1091. doi: 10.1128/jvi.72.2.1085-1091.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Wiktor T, Gyorgy E, Schlumberger D, Sokol F, Koprowski H. Antigenic properties of rabies virus components. J Immunol. 1973;110:269–276. [PubMed] [Google Scholar]
  • 42.Wunner W, Dietzschold B, Macfarlan R, Smith C, Golub E, Wiktor T. Localization of immunogenic domains on the rabies virus glycoprotein. Ann Inst Pasteur. 1985;136E:353–362. [Google Scholar]
  • 43.Xiang Z, Spitalnik S, Tran M, Wunner W, Cheng J, Ertl H. Vaccination with a plasmid vector carrying the rabies virus glycoprotein gene induces protective immunity against rabies virus. Virology. 1994;199:132–140. doi: 10.1006/viro.1994.1105. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES