WDR54 exerts oncogenic roles in T‐cell acute lymphoblastic leukemia

Abstract

WDR54 has been recently identified as a novel oncogene in colorectal and bladder cancers. However, the expression and function of WDR54 in T‐cell acute lymphoblastic leukemia (T‐ALL) were not reported. In this study, we investigated the expression of WDR54 in T‐ALL, as well as its function in T‐ALL pathogenesis using cell lines and T‐ALL xenograft. Bioinformatics analysis indicated high mRNA expression of WDR54 in T‐ALL. We further confirmed that the expression of WDR54 was significantly elevated in T‐ALL. Depletion of WDR54 dramatically inhibited cell viability and induced apoptosis and cell cycle arrest at S phase in T‐ALL cells in vitro. Moreover, knockdown of WDR54 impeded the process of leukemogenesis in a Jurkat xenograft model in vivo. Mechanistically, the expression of PDPK1, phospho‐AKT (p‐AKT), total AKT, phospho‐ERK (p‐ERK), Bcl‐2 and Bcl‐xL were downregulated, while cleaved caspase‐3 and cleaved caspase‐9 were upregulated in T‐ALL cells with WDR54 knockdown. Additionally, RNA‐seq analysis indicated that WDR54 might regulate the expression of some oncogenic genes involved in multiple signaling pathways. Taken together, these findings suggest that WDR54 may be involved in the pathogenesis of T‐ALL and serve as a potential therapeutic target for the treatment of T‐ALL.

Our findings suggest that WDR54 may be involved in the pathogenesis of T‐ALL and may serve as a potential therapeutic target for the treatment of T‐ALL.

Abbreviations

T‐ALL

T‐cell acute lymphoblastic leukemia

p‐AKT

phospho‐AKT

p‐ERK

phospho‐ERK

qRT‐PCR

quantitative real‐time PCR

GFP

the green fluorescent protein (GFP)

CCLE

the Cancer Cell Line Encyclopedia

MTX

methotrexate

PDPK1

3‐phosphoinositide‐dependent protein kinase 1

1. INTRODUCTION

T‐cell acute lymphoblastic leukemia (T‐ALL) is a highly proliferative hematological malignancy that accounts for 10%–15% of pediatric and 20%–25% of adult acute lymphoblastic leukemia cases. ¹ , ² , ³ , ⁴ T‐ALL treatment has progressed significantly in the past few years, contributing to an improved clinical complete remission rate. ⁵ However, the outcomes for patients with relapsed or refractory T‐ALL are extremely poor, with 5‐year survival rates of less than 10%. ⁶ , ⁷ Numerous aberrantly expressed genes during tumorigenesis that are associated with leukemia survival are proposed to be the main cause of treatment failure, drug resistance, and tumor recurrence. ⁸ , ⁹ , ¹⁰ , ¹¹ Therefore, there is an urgent need to identify new therapeutic targets that drive the pathogenesis of T‐ALL and develop new targeted drugs.

Protein–protein interactions (PPIs) are essential components of both physiological and pathological biological processes and are an emerging class of therapeutic targets. ¹² , ¹³ , ¹⁴ , ¹⁵ , ¹⁶ The WD40 repeat (WDR) domain is one of the most abundant protein interaction domains in humans. ¹⁷ , ¹⁸ So far, more than 360 WDR domain‐containing proteins have been reported. ¹⁸ , ¹⁹ Among them, two WDR domain proteins, WDR5 and EDD, have been identified as potential drug targets. ²⁰ , ²¹ , ²² , ²³ , ²⁴

WDR54 was recently identified as an oncogene in colorectal cancer and bladder cancer. ²⁵ , ²⁶ WDR54 could promote cell proliferation by activating AKT, ERK, and β‐catenin signaling in cancers. ²⁵ , ²⁶ Mechanistically, the cross‐linking and ubiquitination of WDR54 were found to regulate ERK activity in response to EGF stimulation. ²⁷ These studies suggest that WDR54 may be involved in the proliferation of tumors. However, the expression and biological function of WDR54 in T‐ALL have not been investigated.

In this study, we investigated the expression pattern, biological function, and potential molecular mechanisms of WDR54 in T‐ALL. The results revealed that the mRNA and protein levels of WDR54 were significantly higher in T‐ALL cell lines and patients. In addition, WDR54 depletion suppressed the proliferation, induced apoptosis and cell cycle arrest in vitro and impeded the process of leukemogenesis in a Jurkat xenograft model in vivo. Mechanistically, we demonstrated that WDR54 exhibited its leukemogenic effects through regulating proliferation and apoptosis‐related signal pathways.

2. MATERIALS AND METHODS

2.1. Cell culture

Human HEK293T, Jurkat, Molt4, CCRF‐CEM, and BALL‐1 cell lines were obtained from the Cell Resource Center, Peking Union Medical College (which is the headquarters of National Science and Technology Infrastructure‐National Biomedical Cell‐Line Resource, NSTI‐BMCR). The lymphoma cell lines Raji and Namalwa were kindly provided by Dr Jianxiang Wang (Chinese Academy of Medical Sciences and Peking Union Medical College). HEK293T cells were cultured in DMEM medium with 10% FBS (Gibco), and leukemia cells were grown in RPMI 1640 medium with 10% FBS (Gibco). Cell lines were incubated at 37°C in a humidified atmosphere of 5% CO₂.

2.2. RNA isolation and quantitative real‐time PCR

Total RNA was extracted using an RNAiso Plus Kit (TaKaRa). The cDNA was synthesized using 1 μg RNA with the PrimeScript RT Reagent Kit (TaKaRa) according to the manufacturer's instructions. Quantitative real‐time PCR (qRT‐PCR) was performed on a 7500 Real‐Time PCR System (Applied Biosystems) with an SYBR Green PCR Kit (TaKaRa). Normalized to GAPDH or β‐actin, the relative mRNA expression was determined using the comparative Ct method (2−ΔΔCt). All the data were collected from three to four independent experiments in replicates. The primer sequences were as follows: WDR54: sense 5‐ CTCACCTCACATCGAGGAATACA‐3 and antisense 5‐ AGTACAATGTTGGGACCCTTTG‐3; Bcl‐2: sense 5‐ TTCTTTGAGTTCGGTGGGG‐3 and antisense 5‐ CAGGAGAAATCAAACAGAGGC‐3; Mcl‐1: sense 5‐ TTTCAGCGACGGCGTAACAA‐3 and antisense 5‐ CAAACCCATCCCAGCCTCTTT‐3; PDPK1: sense 5‐ ATTCCGAGCTGGAAACGAGTAT‐3 and antisense 5‐ CTAACCGCTTTGTGGCATCTAA‐3; β‐actin: sense 5‐CATGTACGTTGCTATCCAGGC‐3 and antisense 5‐CTCCTTAATGTCACGCACGAT‐3; GAPDH: sense 5‐CCAGAACATCATCCCTGCCTCTACT‐3 and antisense 5‐GGTTTTTCTAGACGGCAGGTCAGGT‐3.

2.3. Immunoblotting

Cells were lysed in RIPA buffer (50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% NP‐40, 0.1% SDS) supplemented with a phosphatase‐inhibitor cocktail, protease‐inhibitor cocktail, and 1 mM PMSF followed by mild sonication. Proteins were separated by SDS‐PAGE and transferred to PVDF membranes (Millipore). Immunoblots were generally incubated in primary antibodies at 4°C overnight and conjugated secondary antibodies for 2 h at room temperature. The PVDF membrane was then incubated with Chemiluminescent Substrate (MIKX) and detected by the Chemiluminescent Imaging System (Tanon 5200). Primary antibodies used in the experiments include β‐actin (1:50000, AC026, ABclonal), WDR54 (1:1000, HPA043257, Sigma), AKT (1:1000, 9272, Cell Signaling Technology), p‐AKT (1:1000, 4060, Cell Signaling Technology), ERK (1:1000, 4370, Cell Signaling Technology), p‐ERK (1:1000, 4695, Cell Signaling Technology), Bcl‐2 (1:1000, 3498, Cell Signaling Technology), Bcl‐xL (1:1000, ab98143, Abcam), cleaved Caspase‐3 (1:1000, 9664, Cell Signaling Technology), Caspase‐9 (1:1000, 9502, Cell Signaling Technology), GAPDH (1:5000, 60,004‐1‐Ig, Proteintech), and PDPK1 (1:1000, 17,086‐1‐AP, Proteintech).

2.4. Lentiviral vector construction and transduction

The shRNAs and guide RNAs were obtained from the MISSION shRNA library (Sigma‐Aldrich) and designed from Zhang laboratory's online CRISPR design tool (http://crispr.‐mit.edu/), respectively. The target sequences of shWDR54 were as follows: shWDR54‐1: sense 5‐CCGGCAGGGCCAGAATTCACATTATCTCGAGATAATGTGAATTCTGGCCCTGTTTTTG‐3 and antisense 5‐AATTCAAAAACAGGGCCAGAATTCACATTATCTCGAGATAATGTGAATTCTGGCCCTG‐3; shWDR54‐2: sense 5‐CCGGCCAGATGCCAATCACAGACATCTCGAGATGTCTGTGATTGGCATCTGGTTTTTG‐3 and antisense 5‐AATTCAAAAACCAGATGCCAATCACAGACATCTCGAGATGTCTGTGATTGGCATCTGG‐3. The guide oligonucleotides targeting WDR54 were synthesized as follows: sgWDR54‐1: sense 5‐CACCGCTCGTACATCTGGAAGACCG‐3 and antisense 5‐AAACCGGTCTTCCAGATGTACGAGC‐3; sgWDR54‐2: sense 5‐CACCGCTGGTACTCACCTCACATCG‐3 and antisense 5‐AAACCGATGTGAGGTGAGTACCAGC‐3. The fragments of shRNA and sgRNA were subcloned into the lentiviral vectors pLKO.1 and LentiCRISPR‐v2, respectively. Lentivirus packaging was performed using HEK293T with psPAX2 and pMD2G. Jurkat and Molt4 cells were transfected with prepared shRNA lentivirus for generating WDR54 knockdown cell lines. The green fluorescent protein (GFP)‐positive cells were sorted by FACS Aria III (BD Biosciences, USA). To generate WDR54 knockout cells, Jurkat cells were infected with lentivirus expressing LentiCRISPR‐V2‐sgWDR54. Puromycin was added to the medium at 48 h post‐infection. To generate single‐clonal cell lines, puromycin‐selected cells were diluted into 96‐well cell plates. WDR54 knockout colonies were subsequently screened out by western blot.

2.5. MTS assays

Cell viability was measured by MTS assay. Cells were plated into 96‐well plates at a density of 1 × 10⁴ cells/well in 100 μL RPMI 1640 medium. At 0 h, 24 h, 48 h, and 72 h post‐seeded, 100 μL MTS (Promega) were added to each well. The plate was subsequently incubated at 37°C for 2 h. The absorbance value at 490 nm was evaluated using a Synergy H4 Hybrid Microplate Reader.

2.6. Flow cytometry analyses

For apoptosis assessment, cells were stained with Annexin V‐Alexa Fluor 647 and propidium iodide (PI) according to the manufacturer's instructions (Biolegend) on day 3 post‐infection. For cell cycle analysis, cells were fixed with 75% ethanol overnight, treated with RNase A (10 mg/mL) for 15 min and stained with 50 μg/mL PI for 10 min. Cells with GFP fluorescence or stained with indicated antibodies were analyzed by Beckman Coulter. Cell sorting was conducted using a FACS AriaII (BD Bioscences).

2.7. Human T‐cell acute lymphoblastic leukemia xenograft

To visualize leukemia burden in vivo using a small animal living imaging system, Jurkat cells were infected with lentivirus expressing pLVX‐CMV‐MCS‐P2A‐Fluc‐PGK‐Puro to generate puro‐resistant Jurkat‐luci cells. Jurkat‐luci cells were then infected with lentivirus expressing shC or shWDR54, and the percentage of GFP⁺ cells was detected by flow cytometry before transplantation. 2.5 × 10⁶ cells were injected into the 6–8‐week‐old male NCG mice by i.v. Bioluminescent images were obtained using Caliper IVIS Lumina II (Caliper Life Sciences) on days 14, 21, 28, 35, and 42. Four mice from each group were killed when the mice from the shC group became moribund. Cells from bone marrow were collected by flushing with PBS. Cells were stained with human CD45 antibody and analyzed by flow cytometry. The NCG mice were purchased from GemPharmatech (Nanjing) and housed in a sterile facility. All animal experiments were approved by the Institutional Animal Care and Use Committee of Shenzhen University.

2.8. Statistical analyses

Data were presented as mean ± SD and analyzed using SPSS software. Log‐rank analysis was used to evaluate differences in Kaplan–Meier survival curves. Statistical significance was calculated using a two‐tailed Student's t‐test, with a p‐value <0.05 considered significant. Briefly, asterisks indicate significant differences (*p < 0.05; **p < 0.01; and ***p < 0.001). Data with no statistical significance have no asterisk.

3. RESULTS

3.1. WDR54 is highly expressed in T‐cell acute lymphoblastic leukemia patients and cell lines

To investigate the expression of WDR54 in T‐ALL, we first analyzed gene expression profiles of four independent T‐ALL patient cohorts using microarray data from GEO datasets. ²⁸ , ²⁹ , ³⁰ , ³¹ , ³² Our analysis showed a significant increase in mRNA expression of WDR54 in T‐ALL patient samples compared to normal bone marrow cells (Figure 1A–C) or normal T cells (Figure 1D). Consistently, the data from BloodSpot also indicated that WDR54 was highly expressed in T‐ALL (Figure S1A). Moreover, analysis of the Cancer Cell Line Encyclopedia (CCLE) ³³ revealed that the expression level of WDR54 in T‐ALL is the third highest among 1429 human cancer cell lines (Figure S1B). To further confirm the high expression level of WDR54 in T‐ALL, primary patient T‐ALL samples and cell lines were collected, and the mRNA and protein expression of WDR54 was assessed by qRT‐PCR and western blot. Significantly higher expression of WDR54 was observed in primary human T‐ALL (Figure 1E,G) and in T‐ALL cell lines (Figure 1F,H) compared to healthy donors.

FIGURE 1.

High WDR54 expression in T‐cell acute lymphoblastic leukemia (T‐ALL). (A–C) WDR54 mRNA levels were analyzed in normal bone marrow (BM) and primary T‐ALLs from microarray datasets GSE7186 (A), GSE26713 (B), and GSE13159 (C). (D) Expression analysis of WDR54 among normal T cells and T‐ALL patients (GSE146901). (E) WDR54 mRNA levels were revealed by RT‐PCR in BMMNCs derived from healthy donors and T‐ALL patients. β‐actin was used as an internal control. (F) Relative WDR54 mRNA levels in BMMNCs derived from healthy donors, Jurkat, Molt4, CCRF‐CEM, BALL‐1, Raji, and Namalwa cells as indicated. β‐actin was used as an internal control. (G) The protein expression of WDR54 in BMMNCs derived from healthy donors and T‐ALL patients was examined by western blot. β‐actin was used as a loading control. N, normal donors; P, T‐ALL patients. (H) Immunoblots of WDR54 in BMMNCs and six lymphoid cell lines as indicated. β‐actin was used as a loading control. **p < 0.01, ***p < 0.001.

3.2. WDR54 depletion reduces cell viability in T‐cell acute lymphoblastic leukemia cells

To study the potential role of WDR54 in the pathogenesis of T‐ALL, we first knocked down the WDR54 gene in Molt4 and Jurkat cells using two short hairpin RNAs (shRNAs). Molt4 and Jurkat cells were stably transfected with lentiviral pLKO.1‐GFP constructs encoding either shC or shWDR54, respectively. The green fluorescent protein (GFP) positive cells were sorted by flow cytometry for the following functional analysis. The typical flow plots before and after sorting were shown in Figure S2. The silencing effect was determined by western blot and qRT‐PCR. As expected, the two shRNAs markedly inhibited WDR54 expression in Molt4 (Figure 2A,B) and Jurkat cells (Figure 2D,E). The cell viability was assessed by MTS assay, and the results revealed that cell viability was significantly reduced by WDR54 knockdown in both Molt4 and Jurkat cell lines (Figure 2C,F). The WDR54 gene was also knocked out in Jurkat cells using the CRISPR/Cas9 system (Figure 2G). Consistent with the results of WDR54 knockdown, WDR54 knockout markedly decreased the viability of Jurkat cells (Figure 2H). Furthermore, overexpression of WDR54 significantly accelerated cell growth in Molt4 cells (Figure 2I, Figure S3). These results indicate that WDR54 may be important in maintaining T‐ALL cell viability.

FIGURE 2.

WDR54 inhibition compromises T‐cell acute lymphoblastic leukemia (T‐ALL) cell viability. (A, D) The expression of WDR54 was detected by western blot in Jurkat (A) and Molt4 cells (D) that were transfected with WDR54 shRNA, respectively. (B, E) WDR54 mRNA levels were analyzed by quantitative reverse transcription‐PCR in Molt4 cells (B) and Jurkat cells (E). (C, F) Cell viability was determined by MTS in Molt4 cells (C) and Jurkat cells (F). (G) Jurkat cells were infected with lentiviruses expressing sgRNA targeting WDR54. Single WDR54 knockout clones were obtained by the limiting dilution method at day 5 post‐transductions. The protein level was subsequently detected by immunoblots. (H) MTS assay was performed after WDR54 knockout in Jurkat cells. (I) Cell viability was determined by MTS in Molt4 cells with WDR54 overexpression. *p < 0.05, **p < 0.01, ***p < 0.001.

3.3. WDR54 silencing induces cell apoptosis and cell cycle arrest at S phases in T‐cell acute lymphoblastic leukemia cells

We next examined the effect of WDR54 silencing on cell apoptosis and cell cycle in T‐ALL cells. Molt4 and Jurkat cells were stained with Wright's dye. The typical apoptotic morphology, including vacuolar degeneration and nuclear fragmentation, was observed in T‐ALL cells following the depletion of WDR54 (Figure 3A,C). We further detected the percentage of apoptotic cells by flow cytometry using Annexin V/PI staining. Flow analysis showed that silencing WDR54 induced the apoptosis in Molt4 and Jurkat cells (Figure 3B,D). In addition, the distribution of the cell cycle was determined by flow cytometry using PI staining. Knockdown of WDR54 induced cell cycle arrest in the S phases in Molt4 and Jurkat cells (Figure 3E,F). These results indicate that WDR54 may be implicated in regulating the apoptotic process and cell cycle control in T‐ALL cells.

FIGURE 3.

WDR54 depletion induces cell apoptosis and cell cycle arrest at S phases in Molt4 and Jurkat cells. (A, C) Morphological analysis was performed by Wright staining at 96 h following viral infection in Molt4 (A) and Jurkat cells (C). (B, D) Cell apoptosis was analyzed in Molt4 (B) and Jurkat cells (D) by flow cytometry using Annexin V/propidium iodide (PI) staining 3 days post‐infection. Representative flow cytometry graphs were shown on the left, and the quantification of cell apoptosis was on the right. (E) Jurkat cells were labeled with PI and analyzed by flow cytometry (left: representative flow cytometry graphs; right: quantification of cell apoptosis). (F) Cell cycle distribution of Molt4 cells. **p < 0.01, ***p < 0.001.

3.4. WDR54 knockdown enhances methotrexate‐induced apoptosis in T‐cell acute lymphoblastic leukemia cells

Methotrexate (MTX) is an effective agent in the treatment of T‐ALL. We next examined the effect of WDR54 expression on MTX‐induced apoptosis in T‐ALL cells. As shown in Figure 4A, the proportion of apoptotic cells treated with MTX was significantly increased in WDR54 silenced Molt4 cells compared with the control group (Figure 4A). Similar results were observed in Jurkat cells with WDR54 depletion (Figure 4B). These data indicate that WDR54 knockdown may enhance the sensitivity to MTX in a dosage‐dependent manner.

FIGURE 4.

WDR54 knockdown increases the sensitivity to methotrexate (MTX) in T‐cell acute lymphoblastic leukemia (T‐ALL) cells. (A, B) Cell apoptosis was analyzed in Molt4 (A) and Jurkat cells (B) by flow cytometry using Annexin V/propidium iodide (PI) staining. Cells were infected with lentiviruses expressing control or WDR54. shRNAs were treated with 10 nM, 15 nM, or 20 nM of MTX for 48 h. Cells were then subjected to cell apoptosis detection by flow cytometry. *p < 0.05, **p < 0.01.

3.5. WDR54 depletion impedes T‐cell leukemogenesis in vivo

To assess the role of WDR54 in leukemogenesis in vivo, we established a human xenograft using Jurkat cells (Figure 5A). To visualize leukemia cell expansion in vivo, we successfully established a Jurkat cell line expressing firefly luciferase (Jurkat‐luc), selected by puromycin. Jurkat‐luc cells were then infected by lentiviruses expressing shC or shWDR54 with GFP as an expression marker. Before transplantation, the infection efficiency of lentiviruses was determined by the percentage of GFP‐positive cells (Figure 5B); 2.5 × 10⁶ Jurkat‐luc cells were engrafted into each immunocompromised NCG mouse by intravenous inoculation. From the second week after implantation, bioluminescence imaging was used to monitor leukemogenesis weekly (Figure 5C). Compared with the mice in the control cohort, the knockdown of WDR54 significantly inhibited leukemogenesis, as revealed by the decreased intensity of bioluminescence (Figure 5D). When the control mice became moribund, four mice from each group were killed to assess the leukemia burden in vivo. Flow cytometry analysis showed that mice bearing Jurkat cells with WDR54 knockdown manifested decreased hCD45⁺ leukemia cells in bone marrow (Figure 5E). Consistently, WDR54 depletion significantly prolonged the life span of mice (Figure 5F). These results suggest that WDR54 may play a vital role in T‐ALL initiation and progression.

FIGURE 5.

WDR54 knockdown decreases leukemia burden and prolongs survival in vivo. (A) Schematic diagram of the treatment regimen. Jurkat‐luci cells were infected with lentiviruses expressing control (shC) or WDR54 shRNA (shWDR54‐1 or shWDR54‐2). The percentage of GFP⁺ cells was analyzed by flow cytometry on day 3 post‐transfection. 2.5 × 10⁶ cells expressing more than 95% GFP⁺ cells were injected into NCG mice. On different days after transplantation, bioluminescent images were obtained by using Caliper IVIS Lumina II. Control mice became moribund around 40 days post‐engraftment. Four mice in each group were killed to assess leukemia burden in bone marrow. The diagram was drawn by Figdraw. (B) The percentage of GFP⁺ cells before transplantation. (C) Representative luciferase luminescence images of Jurkat xenografts on different days. (D) Quantitative analysis of the average bioluminescence intensity (n = 5). (E) Human CD45⁺ cells from bone marrow were detected by flow cytometry on day 40 after transplantation. Quantification analysis of human CD45⁺ cells was shown on the right (n = 4), and a representative flow plot showing the frequencies of CD45⁺ cells or GFP⁺ cells was shown on the right. (F) Kaplan–Meier survival curves of Jurkat xenografts (n = 7; long‐rank test). **p < 0.01, ***p < 0.001.

3.6. WDR54 affects the expression of AKT, ERK, and apoptotic signaling‐related molecules in T‐cell acute lymphoblastic leukemia cells

To determine the mechanism underlying the oncogenic role of WDR54 in T‐ALL leukemogenesis, we examined the effect of WDR54 on the expression of AKT, ERK, and apoptotic signaling‐related molecules. The expression of p‐AKT, p‐ERK was dramatically downregulated in Molt4 and Jurkat cells with WDR54 knockdown, while the level of ERK was not affected in both cell lines (Figure 6A). These results were consistent with previously reported data on colorectal cancer. ²⁵ However, we observed that knockdown of WDR54 unexpectedly reduced the levels of AKT in both T‐ALL cells (Figure 6A), suggesting that WDR54 may mediate AKT expression in a cell‐type‐specific manner. Furthermore, we examined the expression of apoptosis‐related molecules in T‐ALL cells. Our result showed that Bcl‐2 and Bcl‐xL were significantly downregulated in shWDR54‐infected cells compared to the control cells (Figure 6B). We also detected the mRNA level of Bcl‐2. The mRNA level of Bcl‐2 was significantly reduced in Jurkat and Molt4 cells with WDR54 knockdown (Figure S4A,B), indicating that reduced Bcl‐2 protein level may be due to a decrease in transcript level. However, the depletion of WDR54 had little effect on mRNA and protein levels of Mcl‐1 (Figure S4C–F). In addition, the protein levels of cleaved caspase‐3 and cleaved caspase‐9 were upregulated in Molt4 and Jurkat cells with WDR54 knockdown (Figure 6B).

FIGURE 6.

WDR54 modulates PDPK1, AKT, ERK, cleaved caspase‐3, cleaved caspase‐9, Bcl‐2, and Bcl‐xL signal pathways in T‐cell acute lymphoblastic leukemia (T‐ALL) cell lines. Cell lysates from shC or shWDR54 cells at 3 days post‐infection were analyzed. (A) The protein expression of p‐AKT, AKT, p‐ERK, and ERK in Molt4 (left) and Jurkat (right) cells was detected by immunoblots, respectively. (B) Analysis of cleaved caspase‐3, cleaved caspase‐9, Bcl‐2, and Bcl‐xL was performed by immunoblots. (C) Heatmap analysis of RNAseq expression data showing differentially expressed genes in Jurkat cells (p < 0.05). (D) The mRNA level of PDPK1 was detected by real‐time PCR in Molt4 cells (left) and Jurkat cells (right). (E) The protein expression of PDPK1 in Molt4 cells (left) and Jurkat cells (right). ***p < 0.001.

3.7. WDR54 may regulate the expression of some oncogenic genes involved in multiple signaling pathways

To further explore the mechanistic link between WDR54 expression and leukemogenesis in T‐ALL, we performed RNA sequencing (RNA‐seq) analysis in Jurkat cells treated with scramble shRNA or WDR54 shRNAs. Our results revealed that the knockdown of WDR54 resulted in decreased expression of some oncogenic genes (gene names are listed in Figure 6C). These genes are involved in signaling transductions of PI3K/AKT, MAPK, NOTCH, and Wnt pathways.

Interestingly, RNA‐seq analysis showed that the knockdown of WDR54 led to reduced expression of 3‐phosphoinositide‐dependent protein kinase 1 (PDPK1), which could phosphorylate AKT and activate the AKT signaling. We further validated the mRNA expression of PDPK1 in Jurkat and Molt4 cells by real‐time PCR. The results showed that the mRNA level of PDPK1 was downregulated in Jurkat and Molt4 cells with WDR54 depletion (Figure 6D), which was consistent with the sequencing result. The protein expression of PDPK1 was significantly decreased in Jurkat and Molt4 cells with WDR54 knockdown (Figure 6E). These data suggest that WDR54 may regulate the AKT signal pathway via targeting PDPK1. Our data imply that WDR54 exhibited an oncogenic function in T‐ALL via multiple signaling pathways.

4. DISCUSSION

Aberrant activation of oncogenic signaling pathways, such as PI3K‐AKT and MEK–ERK, have been implicated in the pathogenesis of human T‐ALL. T‐ALL cells exerted upregulated activity of the PI3K‐AKT and MEK–ERK pathways, which are involved in T‐cell survival, expansion, and differentiation. ³⁴ , ³⁵ , ³⁶ , ³⁷ , ³⁸ , ³⁹ , ⁴⁰ It has been widely reported that specific AKT inhibitor MK2206 and MEK‐signaling inhibitor U0126 could effectively suppress T‐ALL cell growth in a time‐ and dose‐dependent manner. ³⁶ , ⁴¹ , ⁴² A recent study reported that WDR54 could activate the AKT, ERK, or β‐catenin signaling pathways and promote cell proliferation in colorectal cancer and bladder cancer. ²⁵ , ²⁶ Mechanistically, WDR54 was found to be cross‐linked by the action of transgluaminase, resulting in the activation of the EGF receptor‐mediated signaling pathway. ²⁷ In this study, we revealed that WDR54 was highly expressed in T‐ALL cells and exhibited an oncogenic function in T‐ALL. Our results further showed that WDR54 knockdown could downregulate the expression of PDPK1, p‐AKT, total AKT, and p‐ERK in T‐ALL cells, indicating that WDR54 may be implicated in the pathogenesis of T‐ALL through the upregulation of AKT and ERK signaling. RNA‐seq analysis illustrated that WDR54 may regulate the expression of some oncogenic genes involved in multiple signaling pathways, including NOTCH and Wnt signaling. Future studies are needed to investigate the molecular mechanism by which WDR54 regulates multiple signaling pathways in T‐ALL.

The WDR domain typically contains a seven‐bladed β propeller structure and is thought to be an essential subunit of protein complexes implicated in a wide variety of cellular functions, such as cell cycle, signal transduction, transcriptional regulation, the ubiquitin‐mediated degradation, and cell apoptosis. ¹⁸ , ⁴³ , ⁴⁴ , ⁴⁵ WDR domain‐containing proteins have been shown to mediate protein–protein or protein–DNA interactions through their WDR domain. ⁴⁶ , ⁴⁷ As a WDR domain‐containing protein, WDR54 has been found to be elevated and associated with prognosis in colorectal cancer patients and bladder cancer patients. ²⁵ , ²⁶ Huang et al. recently identified WDR54 as a hallmark gene of diabetes mellitus‐related atherogenesis using weight gene correlation network analysis. ⁴⁸ In our study, bioinformatics analysis showed that WDR54 was highly expressed in T‐ALL. Our results further demonstrated the elevated expression of WDR54 in T‐ALL. Depletion of WDR54 significantly suppressed cell viability and induced apoptosis and cell cycle arrest in vitro. Consistently, knockout of WDR54 resulted in reduced cell viability in T‐ALL cells. Moreover, silencing WDR54 markedly decreased the expression of Bcl‐2 and Bcl‐xL and upregulated the expression of cleaved caspase 3 and cleaved caspase 9 in T‐ALL cells. In Jurkat xenograft model, WDR54 silencing potently inhibited T‐cell leukemogenesis.

In conclusion, we illustrate that WDR54 is overexpressed in T‐ALL and involved in the viability, apoptosis, cell cycle, and leukemogenesis of T‐ALL cells through the upregulation of AKT and ERK signaling. This study uncovers that WDR54 acts as an oncogene and may be a potential therapeutic target in T‐ALL.

AUTHOR CONTRIBUTIONS

Conceptualization, H.L., N.Z. and D.S.L.; methodology, H.L., N.Z., D.S.L., D.L.Z. and Q.F.X.; formal analysis, H.L., S.W., X.Z., Z.X.L., Z.Y.Z, and J.X.S.; investigation, H.L., Z.J.S., V.W.W.X., S.S.L., Y.C., and L.Z.; writing—original draft preparation, H.L. and D.L.Z.; writing—review and editing, L.H., N.Z., and D.S.L.; supervision, L.H., N.Z., and D.S.L.; project administration, D.S.L. and N.Z.; funding acquisition, D.S.L., N.Z., and S.S.L. All authors have read and agreed to the published version of the manuscript.

FUNDING INFORMATION

The National Natural Science Foundation of China (31970739), Anhui Natural Science Foundation (2108085QH. 322), and Shenzhen Natural Science Fund (20200826134656001).

CONFLICT OF INTEREST STATEMENT

The authors have no conflict of interest.

ETHICS STATEMENTS

Approval of the research protocol by an Institutional Reviewer Board: Institutional Research Ethics Committee of Shenzhen University.

Informed Consent: N/A.

Registry and the Registration No. of the study/trial: N/A.

Animal Studies: The animal study protocol was approved by the Institutional Animal Care and Use Committee of Shenzhen University.

Supporting information

Figures S1–S4:

Li H, Zhang D, Fu Q, et al. WDR54 exerts oncogenic roles in T‐cell acute lymphoblastic leukemia. Cancer Sci. 2023;114:3318‐3329. doi: 10.1111/cas.15872