Protocol of Tecopox study: a multicentre, open-label, double-arm trial to evaluate the efficacy and safety of oral tecovirimat therapy for patients with smallpox or monkeypox

Abstract

Introduction

Monkeypox was originally endemic locally in West Africa; however, outbreaks in non-endemic countries have been recognised since May 2022. The effectiveness of tecovirimat has been estimated against smallpox, which belongs to the same Orthopoxvirus genus as monkeypox. Thus, tecovirimat is expected to be effective against monkeypox. This study aims to evaluate the efficacy and safety of oral tecovirimat therapy for patients with smallpox and monkeypox and to prepare a scheme for oral tecovirimat use in Japan.

Methods and analysis

This nationwide, multicentre, non-randomised, open-label, double-arm study will involve viral examination of the blood, throat swabs, urine and skin lesions, performed periodically. Participants will freely decide whether to participate in an administered group (supportive treatment plus oral tecovirimat) or a non-administered group (only supportive treatment). Tecovirimat will be administered for 14 days. To ensure that financial problems do not preclude participation in the study, the research fund will cover the cost of tecovirimat and basic hospitalisation fees. The primary endpoint is the percentage of patients with negative PCR results (cycle threshold value ≥40) for skin lesion specimens at 14 days after inclusion in the study. Secondary endpoints include mortality at 14 and 30 days, viral load in each sample, duration of fever and adverse events. The sample size is estimated to be 50 patients with monkeypox or smallpox.

Ethics and dissemination

Written informed consent will be obtained from all participants. This study was approved by the Certified Review Board of National Center for Global Health and Medicine and published in the Japan Registry of Clinical Trials. The results of this study will be published in peer-reviewed journals and/or in presentations at academic conferences.

Trial registration number

jRCTs031220169.

Strengths and limitations of this study.

• This is a nationwide, multicentre, non-randomised, open-label, double-arm study to be conducted in Japan to investigate the clinical efficacy and safety of tecovirimat in patients with smallpox and monkeypox.

• The study will include patients who have a definite PCR-based diagnosis of smallpox or monkeypox.

• Pregnant women can also join the administered group if they fully understand the potential risks and benefits of tecovirimat therapy.

• The primary endpoint is the proportion of patients with a cycle threshold value of 40 or more on PCR testing of skin lesions at 14 days from enrolment in the study, which is an objective indicator.

• Participants will voluntarily choose to join either the ‘administered group’, or the ‘non-administered group’, and it is unclear whether comparability between the two groups can be ensured.

Introduction

The coronavirus disease (COVID-19) has emphasised the threat that emerging and re-emerging infectious diseases pose to human beings, in spite of the sufficiently advanced scientific and medical domains. Preparedness for infectious diseases includes rapid, accurate identification and evaluation of epidemiological information, which are facilitated by the establishment of systems; strengthening of quarantine systems and isolation of patients and their contacts, with the development of laws to enable both; and the securing and strengthening of laboratory systems. Similar to the experience with COVID-19, infectious disease-causing pathogens can easily and rapidly spread in today’s globalised world, wherein the post-recognition preparation for each emerging and re-emerging infectious disease may already be too late to control spread and mitigate consequences. Thus, deliberate peacetime preparations are essential wherein, especially, the development of new vaccines and therapeutics plays a very important role.

Monkeypox—an infectious acute disease with various types of skin lesions caused by the monkeypox virus belonging to the genus Orthopoxvirus—has surged during the COVID-19 pandemic. Symptoms persist for 2–4 weeks and resolve spontaneously in most cases of monkeypox; however, severe disease can occur, and mortality rates of 3–6% have been reported.¹ Since its discovery in human patients in 1970, the disease has remained endemic in Central and West Africa,² and outbreaks in non-endemic countries have been identified since May 2022.³ Analysis of global epidemiological data collected until 24 January 2023,⁴ has revealed a lower case fatality rate (0.21%) in the current outbreak than that reported previously; however, proctitis necessitating opioid analgesia⁵ and complication-associated hospitalisation rates of 2–9% have been reported.^6–8 Furthermore, vertical transplacental infection transmission to the fetus can lead to premature miscarriage or stillbirth.⁹

The eradication of smallpox, from the same Orthopoxvirus genus as monkeypox, was declared by the WHO in 1980.¹⁰ However, the pathogen is on a watchlist for potential bioterrorism,¹¹ and infectious disease crisis management preparations for smallpox resurgence are essential. The potential efficacy and safety of tecovirimat against smallpox have been reported previously; authors have demonstrated that a 14-day course of tecovirimat achieves ≥90% survival in animal models and healthy volunteers randomised to receive an equivalent dose of tecovirimat or placebo for 14 days.¹² The dose of tecovirimat was calculated using simulation models. As smallpox and monkeypox belong to the Orthopoxvirus genus, tecovirimat is expected to be effective against monkeypox and, in fact, tecovirimat is approved for monkeypox treatment in Europe.¹³ An expanded access programme has been established for the use of tecovirimat in patients with monkeypox in the Central African Republic and the USA,^{14 15} and tecovirimat was used to treat patients with monkeypox in the USA during the most recent outbreak.¹⁶

As of September 2022, there are no officially approved medicines in Japan that are effective against smallpox or monkeypox. However, as mentioned above, oral tecovirimat is expected to be sufficiently effective against smallpox and monkeypox, and the creation of a tecovirimat treatment algorithm for patients with these infections is very important in the risk management preparations against emerging and re-emerging infectious diseases. This study aimed to evaluate the efficacy and safety of oral tecovirimat therapy for patients with smallpox and monkeypox and to prepare a treatment algorithm for tecovirimat use in Japan.

Methods and analysis

Study design and settings

Considering the population and geographical distribution, this nationwide, multicentre, non-randomised, open-label, double-arm study will be conducted at seven hospitals in Japan (Sapporo, Sendai, Tokyo, Aichi, Osaka, Fukuoka and Okinawa), and participant enrolment will commence from the release of the research database (Japan Registry of Clinical Trials (jRCT)) until 31 March 2023 and will continue until 31 July 2023. However, the study period could be extended to accumulate the requisite number of cases, considering the prevalence of smallpox and monkeypox in Japan. This follows Standard Protocol Items: Recommendations for Interventional Trials reporting guidelines.¹⁷ This study protocol is the latest V.3.2, updated on 12 October 2022, as of the submission.

Intervention

There are two groups in this study: the administered and non-administered groups. Participants voluntarily chose the group that they wish to join. Participants in the administered group will receive 14 days of standard supportive treatment and oral tecovirimat (body weight-calibrated dosage in accordance with the European Medical Agency guidelines;¹³ table 1). Tecovirimat oral dosing would occur within 30 min following a moderate-to-high fat meal. The participants in the non-administered group received only standard supportive treatment. The Japanese Ministry of Health, Labour and Welfare (MHLW) will obtain the tecovirimat from the pharmaceutical company and the study drug will be distributed free of charge to each study site.

Table 1.

Dose of oral tecovirimat for 14 days

Body weight, kg	Dosage, mg every 12 hours (in general, after breakfast and dinner)
13 to <25	200
25 to <40	400
≥40	600

When the participants wish to change their group, they can do so after withdrawing their consent and can then re-participate in the opposite group. Because all participants will stay in the hospital during the intervention, there are no specific strategies to improve the adherence. Any concomitant care and medication will be permitted as per clinical indications.

Participants

In patients with smallpox or monkeypox, at least one to three or all of the following criteria must be fulfilled:

1. Written informed consent is obtained.

2. Weight at least 13 kg at the time of providing consent.

3. Definite diagnosis of smallpox or monkeypox by positive PCR results obtained using the patients’ specimens as samples.

4. Consents to hospitalisation from the start of the study until resolution of the skin lesion.

5. If participating in the administered group, consents to hospitalisation until completion of the 14-day oral tecovirimat therapy.

In addition, patients with any of the following conditions will be excluded from this study.

1. History of anaphylaxis to oral tecovirimat or any of its components.

2. Deemed by the primary investigator as unsuitable to participate in the study.

Lactating women can participate in the administered group only after they have been informed that tecovirimat has not been previously studied in lactating women and agree to discontinue breast feeding during the treatment period and for 30 days after the last tecovirimat dose. Those who choose to continue breast feeding would not be able to participate in the administered group. Pregnant women can participate in the administered group only if they fully understand the risks and benefits of tecovirimat. The description of risks and benefits include that reproductive toxicity has not been adequately evaluated in animal studies, that no clear reproductive toxicity has been demonstrated to date, that there is no actual experience with administration to pregnant women, that the drug’s product information does not recommended tecovirimat use for pregnant women, that there is currently no other effective treatment for smallpox and monkeypox and that these diseases can cause miscarriage, premature labour and stillbirth. In the non-administered group, both lactating and pregnant women can participate without any restrictions. The principal investigator or co-investigator will explain this study directly (in person) to the patient or surrogate and obtain their consent.

Consideration of the financial burden on participants

As tecovirimat will be provided free of charge by the MHLW, participants will not have to pay for tecovirimat. In addition, the research fund covers the hospitalisation costs during study participation. Therefore, regardless of their nationality and insurance status, the participants will not have to pay for basic inpatient care. However, participants will bear the cost of the post-discharge follow-up visits at the outpatient clinic; a sum of 10 000 yen per visit is provided as a burden-reduction payment. This burden-reduction payment will not be applicable if follow-up visits are replaced by online methods.

Data collection and measurement

After confirming the inclusion criteria, the investigator will verify the following patient background: date of birth, age, sex, body weight, race, occupation, medical history, current medications, allergies, smallpox vaccination, international travel during the past 6 months and sexual contact during the past 6 months. In premenopausal women, a pregnancy test will be performed using blood or urine tests. Blood, urine, pharyngeal swabs and skin lesion samples will be collected for viral examination. The pharyngeal sample will be swabbed from the posterior wall of the pharynx, and then soaked in the virus transport medium. For skin lesion specimens, the contents of the blisters, pustules and crusts should be appropriately selected and collected according to the instructions in the manual of the National Institute of Infectious Diseases (NIID).¹⁸ The most severe representative skin rash is selected for sampling. While only one rash is chosen, multiple sampling will be allowed if a patient has multiple rashes of similar severity or if a new, more severe lesion appears during the clinical course. The abovementioned samples will be collected prior to the first dose of tecovirimat in the administered group, or within the same day of participation in the non-administered group.

Patients will be evaluated clinically and for adverse events daily by medical examination and interview, which will include assessments of their general condition and skin lesions. A researcher will classify the general condition as bedridden, weakly ambulant and fully ambulant. On days 3, 7, 10 and 14, blood tests, including white blood cell count and the differential count; haemoglobin level; platelet count; and total bilirubin, aspartate aminotransferase, alanine aminotransferase, creatinine and blood sugar levels, will be performed for safety evaluation; and blood, urine, throat swabs and skin lesions for viral examination to evaluate efficacy will be collected. The evaluation and sample collection will be repeated on days 21, 30, 60 and 120. Semen specimens will be collected for viral testing on days 60 and 120. Medical examinations and interviews can be replaced by online methods, such as telephonic interviews, when it is difficult for the patient to visit the hospital, and sample collection is waived in this situation.

Blood examinations for safety evaluation and pregnancy tests will be performed at each hospital using equipment that is routinely employed in the clinical setting. All specimens for viral examination will be stored at 2–8°C after collection and during transport if they are sent immediately after collection, whereas samples and specimen that cannot be sent immediately will be stored frozen below −20°C, and if possible, below −80°C before transportation to the NIID. Considering the similarities between the clinical manifestations of infections with varicella zoster, monkeypox and variola viruses, particularly between the cutaneous lesions, it is important to use precise diagnostic measures, such as PCR, to identify the diseases. The copy numbers of the monkeypox and variola viruses will be measured using specific multiplex quantitative PCR (qPCR) based on a previous report.¹⁹ Namely, the qPCR will use specific primer and probe sets targeted to the F3L gene of the monkeypox virus (forward primer: CATCTATTATAGCATCAGCATCAGA, reverse primer: GATACTCCTCCTCGTTGGTCTAC, probe: HEX-TGTAGGCCGTGTATCAGCATCCATT-BHQ1), the B12R gene of the variola virus (forward primer: ATGTTCAAGCTGTTAATATCAATCTCG, reverse primer: TTTGCCACTGAACCATTCTATCAT, probe: FAM-CTGTCGGAGCCACAGTTTCGAGACG-BHQ1), and the ORF38 gene of the varicella zoster virus (forward primer: AAACCGCACATGATAACGC, reverse primer: GATTAGGACCATCCCCCG, probe: TexasRed-ACAATGAGTAGTGGCTTTATGGCGAG-BHQ3). Total nucleic acids will be extracted from 200 µL specimens using a High Pure Viral Nucleic Acid Kit (Roche Applied Science) according to the manufacturer’s protocols, with a 50 µL elution volume. The qPCR assay will be performed by adding 3 µL of the extracted nucleic acid solution to the 23 µL of the reaction mixture containing 2× QuantiTect Probe PCR Master Mix, H₂O supplied in the QuantiTect Probe PCR Kit (Qiagen, Hilden, Germany) and 0.2 µM of each specific primer and probe and H₂O. The qPCR will be performed using a LightCycler 96 (Roche, Basel, Switzerland) under the following conditions: 95°C for 10 min, followed by 45 cycles of 95°C for 15 s and 63°C for 60 s. This method has been validated using a monkeypox virus preserved by the NIID. After viral examination, the specimens will be stored appropriately in the NIID for future analysis.

Data will be monitored by an independent researcher with no conflict of interest. The monitoring staff has been selected from among the researchers of the principal investigating institution and is independent of this study. Interim analysis and audit are not planned. Any adverse events equivalent to Common Terminology Criteria for Adverse Events (CTCAE) V.5.0 Grade 3 or more will be recorded and the relationship of this event to the study will be determined.

Outcomes

The primary endpoint is the proportion of patients with a cycle threshold (Ct) value of 40 or higher on PCR testing of skin lesions at 14 days from enrolment in the study. Secondary endpoints include the mortality rate at 14 and 30 days; viral load in blood, throat swab, skin lesion and urine at 14, 21, 30, 60 and 120 days; viral load in semen at 60 and 120 days; duration of fever (≥37.5°C) from the enrolment in the study; incidence of adverse events; and the general condition at entry, at 14 and 30 days after enrolment in the study. If multiple samples of skin lesions are taken from a participant on the same day, the sample with the lowest Ct value will be considered for the analysis.

Sample size calculation

The total sample size is set to 50 patients. No data is available on the rate of negative PCR results for skin lesions in patients with monkeypox who are treated with tecovirimat. However, in a previous study,²⁰ both pharyngeal swab and blood specimens were negative on the PCR test on day 14 of illness in one patient who was treated with tecovirimat. We inferred a similar high probability that skin lesions would be negative, and that the probability of achieving the primary endpoint in our study group is 75%. With regard to the course of three patients with untreated monkeypox in the same report,²⁰ only one out of six pharyngeal swabs and blood specimens (1/6, 16.7%) was PCR-negative on day 14 of the disease. Assuming that skin lesions would have a lower rate of negative results, we estimated an 8% chance that the non-administered group in our study would achieve the primary endpoint. As our study did not use randomisation, we considered the number of cases to be administered: a non-administered ratio of 2:1. The final number of patients was calculated to be 12 in the administered group and 6 in the non-administered group. Thus, considering dropout of 30%, 25 patients will be needed for the monkeypox trial. As there are no available data for patients with smallpox treated with or without tecovirimat, the same number of cases as for monkeypox will be used and a total of 50 cases have been set as the sample size.

Data analysis plan

The full analysis set (FAS) comprises all enrolled participants, after excluding those who are ineligible, those who withdraw consent for the entire study and those who do not receive tecovirimat for the efficacy endpoints. The per-protocol set (PPS) will consist of the FAS population, after excluding participants with serious violation of the study protocol and those who discontinue. The safety analysis population will be defined as all enrolled participants, but excluding those who withdraw consent for the entire study. For all efficacy evaluations, FAS analysis will be the primary analysis and PPS analysis will be performed as a reference. A safety analysis will be conducted in the safety analysis population. Patients who are on tecovirimat at the time of participation and who do not withdraw their consent for the entire study but wish to discontinue tecovirimat will be included in the analysis as the administered group in accordance with the intention-to-treat principle. Participants who dropout will be included in the analysis unless they withdraw their consent for the entire study; such cases will be considered treatment failures, that is, we will assume that the Ct values for their skin rash samples at 14 days after study enrolment are less than 40.

Descriptive statistics will be performed for age, sex, occupation, height, weight, underlying disease and concurrent medication. The proportion of participants achieving the primary endpoint will be compared between the administered and non-administered smallpox and monkeypox groups using the Fisher’s exact test. Given the non-randomised group allocation in our study, if there is a clear intergroup difference in the participants’ background, we will consider weighting the two groups using a propensity score. If statistical analysis becomes difficult due to an imbalance between groups, the results will be reported as descriptive epidemiology. Statistical significance was set at p<0.05.

For the secondary endpoints, categorical variables will be presented as percentages, and continuous variables as medians or means for each endpoint for each disease. The two groups will be compared using the Fisher’s exact test and Mann-Whitney U test, as appropriate. The general condition will be compared between the two groups using a χ² test with a 2×3 cross tabulation table. If the difference is significant, 2×2 comparisons will be performed thrice to determine the effect of tecovirimat. The statistical significance has been set at p<0.017 following Bonferroni correction. As with the primary endpoint, if there is an apparent imbalance between the groups, we will consider comparing the two groups after adjustment.

Patient and public involvement

Patients and the public are not involved in the development of this study protocol.

Ethics and dissemination

This study will be conducted in compliance with the ethical principles of the Declaration of Helsinki and relevant national acts. Written informed consent will be obtained from all participants. The study will require that patients with monkeypox be hospitalised until all skin lesions have resolved and, in the administered group, until they have completed 14-day oral tecovirimat therapy, as inclusion criteria for study participation. Thus, if participants wish to leave the hospital during the course of the study before meeting the abovementioned criteria, this would hinder their discharge. To avoid such a situation, we will provide appropriate information that they can withdraw their consent, which is a general right of participants. The study was approved by the Certified Review Board of National Center for Global Health and Medicine (approval number NCGM-C-0 04 505–03) and was published in jRCT. In case of the need for protocol amendments, the research group will communicate with any relevant parties and modify promptly. Collected samples will be anonymous and labelled with a research ID number. All records will be stored in a locked cabinet or protected by password. Data will be available on reasonable request. Only the authorised staff in the research team will have access to the data set. The collected specimens and data can be used for other studies after approval by the relevant ethics committee. This study contracted with the insurance for clinical trials which will provide compensation for harm resulting from trial participation. The results of this study will be published in peer-reviewed journals and academic conferences. The tecovirimat supplier will not be involved in the designing or reporting of this study. Authorship of the researchers will be determined in accordance with the recommendations of the International Committee of Medical Journal Editors. While we do not use professional writers, the manuscript will be edited by a commercial language proofreading service.

Discussion

This study aimed to verify the efficacy and safety of oral tecovirimat therapy in patients with smallpox and monkeypox and to prepare a treatment algorithm for tecovirimat use in Japan. If the efficacy and safety of oral tecovirimat can be confirmed in our study, it could be a significant tool for future outbreaks. However, because our study was designed and planned promptly as part of crisis management to establish a scheme to use tecovirimat in Japan, the ability to provide the opportunity for hospital admission and drug delivery in any region of Japan was prioritised, rather than its scientific robustness and ease of study execution. Similarly, to provide treatment opportunities to all patients who want to receive tecovirimat, we adopted a method to determine the participants’ study group according to their own wishes, without randomisation. The reason why not only monkeypox but also smallpox was included in this study is to provide tecovirimat within the same framework without delay in case of smallpox resurgence.

Participants in this study are required to be hospitalised until resolution of the skin lesion in participants with monkeypox, and if they are in the administered group, until completion of the tecovirimat therapy. Patients with smallpox are not required to undergo this procedure. This difference is due to the classification of these two diseases under the Japanese Act on the Prevention of Infectious Diseases and Medical Care for Patients with Infectious Diseases (Infectious Diseases Control Law). This Act requires that patients with smallpox be advised to stay in the hospital until they are no longer contagious and are exempt from paying for their medical expenses. Patients with monkeypox are not subject to advice on hospitalisation or a waiver of medical expenses. Therefore, financial burden may prevent patients from continuing hospitalisation before the efficacy and safety of tecovirimat can be fully evaluated. To avoid any disadvantages to patients, the duration of hospitalisation was incorporated into the inclusion criteria for patients with monkeypox, and admission fees are paid from this study so that patients could focus on their treatment without financial concerns.

Pregnant women were not included in the exclusion criteria for our study. Therefore, these patients may participate and receive oral tecovirimat if they understand the risks and benefits. Although the safety of oral tecovirimat for these eligible patients is not clearly guaranteed, they are known to have severe illnesses and unfavourable fetal outcomes with monkeypox infection.⁹ As no other potentially effective treatment was available in Japan other than participation in our study, we did not set exclusion criteria for these patients to avoid depriving them of treatment opportunities.

The primary endpoint of our study is the percentage of patients with a Ct value ≥40 on PCR at the site of the skin lesion 14 days after study entry. Although all-cause mortality and intensive care unit (ICU) admission rate would be desirable as the primary outcomes, the rate of severe disease in recent monkeypox outbreaks is very low.^{4 6 7} Therefore, setting these indicators as the primary outcome would require a huge sample size, reducing the feasibility of our study. Viral DNA detection is not directly related to patient management, but can be linked to the improvement of skin lesions. In addition, although viral DNA detection is not synonymous with its infectivity, if viral DNA is eliminated from skin lesions by tecovirimat at an early stage, a certain effect can be expected in preventing the spread of infection.

In our study, participants chose their group themselves without randomisation, which is a significant limitation. It is unclear whether comparability between the two groups can be ensured, and if there is a large imbalance, comparison may be difficult. Additionally, the open-label design of the study may have caused bias in the evaluation of efficacy and safety. However, as most of the primary and secondary outcomes are objectively ascertained, we believe that bias will be minimal. In addition, because hospital admission is required for participation in our study, withdrawal from the entire study consent will be necessary if participants wish to discharge earlier. If the number of such participants increases, long-term adverse events after tecovirimat therapy would be difficult.

This study was designed to evaluate the efficacy and safety of oral tecovirimat therapy as well as the preparedness and crisis management of smallpox and monkeypox in Japan. This study will allow patients with monkeypox to choose a treatment option for tecovirimat in Japan. In addition, if this study demonstrates efficacy and safety of tecovirimat, this can contribute to improving treatment outcomes and infection prevention and control.

Ethics statements

Patient consent for publication

Not applicable.