Streptococcus pneumoniae drives specific and lasting Natural Killer cell memory

Tiphaine M N Camarasa; Júlia Torné; Christine Chevalier; Orhan Rasid; Melanie A Hamon

doi:10.1371/journal.ppat.1011159

. 2023 Jul 24;19(7):e1011159. doi: 10.1371/journal.ppat.1011159

Streptococcus pneumoniae drives specific and lasting Natural Killer cell memory

Tiphaine M N Camarasa ^1,^2,^¤a,^#, Júlia Torné ^1,^#, Christine Chevalier ¹, Orhan Rasid ^1,^¤b, Melanie A Hamon ^1,^*

Editor: Rachel M McLoughlin³

PMCID: PMC10399893 PMID: 37486946

Abstract

NK cells are important mediators of innate immunity and play an essential role for host protection against infection, although their responses to bacteria are poorly understood. Recently NK cells were shown to display memory properties, as characterized by an epigenetic signature leading to a stronger secondary response. Although NK cell memory could be a promising mechanism to fight against infection, it has not been described upon bacterial infection. Using a mouse model, we reveal that NK cells develop specific and long-term memory following sub-lethal infection with the extracellular pathogen Streptococcus pneumoniae. Memory NK cells display intrinsic sensing and response to bacteria in vitro, in a manner that is enhanced post-bacterial infection. In addition, their transfer into naïve mice confers protection from lethal infection for at least 12 weeks. Interestingly, NK cells display enhanced cytotoxic molecule production upon secondary stimulation and their protective role is dependent on Perforin and independent of IFNγ. Thus, our study identifies a new role for NK cells during bacterial infection, opening the possibility to harness innate immune memory for therapeutic purposes.

Author summary

Natural Killer (NK) cells serve as crucial effectors of the innate immune system and play a vital role in safeguarding the host against infections. It has recently emerged that NK cells exhibit characteristics of immunological memory resulting in a heightened response upon a second encounter with the same pathogen. Although the potential of NK cell memory in combating infections holds promise, cellular responses and memory functions to bacterial infections have not yet been elucidated. Using Streptococcus pneumoniae as our model bacterium, we reveal that NK cells sense and respond to bacteria, as well as develop specific memory properties. Remarkably, transferring NK cells from previously infected mice to naïve ones provided protection against lethal infection for at least 12 weeks. Furthermore, we show that memory NK cells produced more cytotoxic molecules upon secondary stimulation. These findings unravel a novel role for NK cells in the context of bacterial infections, thereby opening avenues for harnessing the potential of innate immune memory for therapeutic applications.

Introduction

In the last decade, the discovery of memory responses mediated by innate immune cells has questioned the dogma that only adaptive immune cells retain memory of previous exposure. Monocytes and macrophages have been shown to acquire an innate immune memory described by a faster and greater response against a secondary challenge with homologous or even heterologous pathogens [1,2]. This capacity, termed trained immunity, is defined by a return to basal state of activation after removal of the primary stimulus, accompanied by the acquisition of persistent epigenetic changes and metabolic rewiring necessary for enhanced response to secondary challenge [3,4].

Natural Killer (NK) cells also display memory properties, which are different from those of macrophages and monocytes. Indeed, memory NK cells display high antigen-specificity and undergo clonal expansion of specific receptor-defined sub-populations [5–7]. NK cell memory has been well studied in the context of viral infections (CMV, Epstein-Barr virus, etc.) [8–12], however, evidence of memory following bacterial infection, especially extracellular bacteria, remains undefined. In fact, the role of NK cells during bacterial infections is controversial [13]. IFNγ produced by NK cells, contributes to bacterial clearance by activating immune cells, such as macrophages and neutrophils to enhance phagocytosis in the case of lung infections with L. pneumophila, K. pneumoniae or M. tuberculosis among others [14–17]. However, upon infection with bacillus Calmette-Guérin (BCG), S. pneumoniae or S. pyogenes, NK cells can be deleterious, leading to tissue damage associated with an excessive inflammatory response [18–21]. In addition, although some studies show that NK cells induce apoptosis of infected cells [22–24], others find that certain intracellular bacterial infections are not affected by NK cells [25,26].

Streptococcus pneumoniae (also known as pneumococcus) is a Gram-positive, extracellular bacterium and natural colonizer of the human upper respiratory tract but also an opportunistic pathogen [27]. Indeed, although S. pneumoniae resides asymptomatically in its natural reservoir, the nasopharynx, it can spread to the lungs or enter the bloodstream causing deadly invasive inflammatory diseases such as pneumonia, meningitis and sepsis [28–30]. Comparable to other bacterial infections, the role of NK cells during S. pneumoniae infection is poorly understood. NK cells contribute to infection clearance by IFNγ production in the lungs [31,32] however, NK cell production of IL-10 is detrimental to infected mice [33].

In this study, we used S. pneumoniae to explore NK cell responses to an extracellular bacterial infection. We show that NK cells directly sense and respond to S. pneumoniae, as well as acquire memory properties. Upon clearance of a primary infection, NK cells retain intrinsic heightened in vitro response to S. pneumoniae, and in vivo they acquire protective functions against lethal infection. Interestingly, we demonstrate that NK cell protection is mediated through higher levels of cytotoxic products (Granzyme B and Perforin), and not through IFNγ mediated responses or inflammatory cell recruitment, thereby revealing a novel role for NK cells in bacterial infection.

Results

NK cells acquire intrinsic memory features 21 days after in vivo infection

We set up model in which mice were infected intranasally with two consecutive sub-lethal doses of S. pneumoniae (SPN, 5x10⁵ CFU) or treated with PBS (Fig 1A). Infecting mice with two consecutive doses over two days improved reproducibility of our results compared with one dose, suggesting robust colonization is important. 21 days later, to test their intrinsic features, NK cells from the spleen were extracted, highly purified by negative selection (~98%, S1A Fig), and stimulated ex vivo. Naïve (D21PBS NKs) or previously exposed NK cells (D21SPN NKs) were incubated for 24 hours with different combinations of cytokines and/or formaldehyde inactivated SPN (Fig 1B). Upon incubation of NK cells with either medium alone, SPN alone, or IL-15+IL-18 (to ensure maintenance of cell viability), no production of IFNγ was detected. In contrast, IL-12+IL-18 (activating cytokines) activated both D21PBS and D21SPN NK cells to the same levels. These results show that under these in vitro conditions NK cells can be reproducibly activated. Strikingly, upon incubation with IL-15+IL-18+SPN, D21SPN NK cells displayed significantly higher signal per cell (Mean fluorescence intensity, MFI) and percentages of IFNγ⁺ cells compared with control D21PBS NK cells (Fig 1B). These results indicate that memory IFNγ⁺ NK cells are both more numerous and express IFNγ to higher levels upon secondary stimulation with S. pneumoniae. Since the higher response of these cells occurs only under condition where bacteria are present with IL-15+IL-18, we can rule out that D21SPN NK cells are hyperactivated under any condition and are specifically responding to SPN. Therefore, NK cells from infected mice acquire intrinsic memory features which are detected ex vivo and characterized by sensing S. pneumoniae and responding more strongly upon secondary stimulation compared to primo-stimulation.

Fig 1 — **(A)** Experimental scheme. C57BL/6 mice were intranasally injected with either PBS (black symbols) or sub-lethal dose of S. *pneumoniae* (SPN, red symbols, 5x10⁵ CFU) for two consecutive days. After 21 days, NK cells were highly purified from spleens of D21PBS or D21SPN mice (98% of purity) and stimulated *in vitro* with cytokines (IL-15 at 2 ng/ml, IL-18 at 1,5 ng/ml, IL-12 at 1,25 ng/ml) and formaldehyde inactivated S. *pneumoniae* (SPN, MOI 20) for 24 hours. **(B)** Intensity of IFNγ expression in NK cells (MFI, **left panel**), percentage of IFNγ⁺ NK cells (**middle panel**), representative overlay histogram upon IL-15+IL-18+SPN stimulation (**right panel**, gray represents isotype control). D21PBS NK cells and D21SPN NK cells are purified from spleen, pooled from n ≥ 4 mice/group and incubated in n ≥ 3 experimental replicates/group. Box plots where each dot represents an experimental replicate (black dots for D21PBS NK cells, red dots for D21SPN NKs cells), lines are median, error bars show min to max. Data are representative of at least three experiments. ns, not significant. **** p < 0.0001. 2way ANOVA test comparing D21PBS NKs and D21SPN NKs values in each condition.

Innate immune memory in macrophages, monocytes and NK cells has been described to correlate with chromatin modifications in various models [3,34]. In particular, we have previously shown in [35] that NK cell memory in a post-endotoxemia model relies on H3K4me1 histone modification at an ifng enhancer. To explore whether this might be the case for NK cell memory to S. pneumoniae, we assessed the histone mark H3K4me1 associated with upstream regulatory regions of ifng gene in D21PBS and D21SPN NK cells by chromatin immunoprecipitation followed by qPCR (ChIP-qPCR). Interestingly, although we did not reach statistical significance, we always observed the same consistent increase of H3K4me1 at the ifng enhancer located at -22 kb in memory NK cells compared to naïve cells (S1B Fig). By contrast, we did not observe a difference in H3K4me1 at the -55 kb enhancer, suggesting histone modifications are occurring at specific regulatory loci. In addition, the increase of H3K4me1 we observed in D21SPN NK cells was located at the same region (-22 kb) as post-endotoxemia memory NK cells. Together, these data suggest that NK cell memory is associated with epigenetic changes at upstream regulatory regions of ifng gene.

The Ly49H, NKG2C and NKG2A receptors have been shown to be implicated in NK cell recognition and memory responses to MCMV, HCMV and EBV respectively, leading to an expression increase upon infection [8–10]. We tested the expression levels of several NK cell receptors in post-SPN NK cells. As early as 12 days post-infection, we observe no difference in the percentage of NKG2D, Ly49D, Ly49H, or Ly49F positive cells between D12PBS and D12SPN NK cells. A small increase in the percentage of Ly49C/I⁺ NK cells is observed, which was no longer detectable 21 days post-infection (S1C and S1D Fig). Therefore, although NK cells acquire memory properties post-bacterial infection, none of the known NK cell receptors previously associated with memory NK cells to viruses seem to be involved.

Sub-lethal infection with S. pneumoniae induces a rapid and transient immune response that returns to basal state before 21 days

To understand the immune environment from which NK cells were extracted, we studied a primary infection. Mice were infected as described Fig 1A, and organs were collected at 24 hours, 72 hours and 21 days post-infection (Fig 2A). Using this infection protocol, mice displayed no weight loss and showed minimal clinical signs (S2A and S2B Fig). At 24 hours, bacteria were mostly located in the nasal cavity (Fig 2B) and spread into bronchio-alveolar lavage fluid (BALF) and lungs at 72 hours post-infection (Fig 2C). Importantly, no dissemination was observed following this dose of infection, as demonstrated by the undetectable levels of bacteria in the blood and spleen at both 24 and 72 hours (Fig 2B–2C).

Fig 2 — **(A)** Experimental scheme, showing that C57BL/6 mice were intranasally injected with either PBS (black symbols) or sub-lethal dose of S. *pneumoniae* (SPN, red symbols, 5x10⁵ CFU) for two consecutive days. Organs were collected at 24h, 72h and 21 days post-infection for CFU counts and cellular infiltrate determination by flow cytometry. **(B-D)** Organs were collected at 24h (B), 72h (C) and 21 days post-infection (D). CFU counts in the nasal lavage, BALF, lungs, spleen and blood of infected mice (**left panel**). Box plots where each dot represents an individual mouse, lines are the mean, error bars show min to max and dotted lines represent limit of detection. Percentage of neutrophils (CD11b⁺ Ly6G⁺) among CD45⁺ cells in the lungs and bronchio-alveolar lavage fluid (BALF), percentage of CD69⁺ neutrophils in the BALF (**middle panel**). Percentage of NK cells (NK1.1⁺ CD3^-) among CD45⁺ cells, percentage of IFNγ⁺, Perforin⁺, Granzyme B⁺ NK cells in the lungs and spleen (**right panel**). Box plots where each dot represents an individual mouse (black dots for uninfected mice, red dots for infected mice), lines are the median, error bar show min to max. Data are pooled from two or three repeats with n ≥ 3 mice/group. ns, not significant. * p < 0.05 and ** p <0.01, Mann-Whitney test for single comparisons and 2way ANOVA test for multiple comparisons.

The sub-lethal infection that we perform is accompanied by a low-level immune response. Indeed, at 24 hours, an increase in the percentage and number of neutrophils in the lungs and BALF was detectable, but rapidly decreased to basal levels at 72 hours (Fig 2B and 2C, numbers in S2C and S2D Fig). Furthermore, a small increase of CD69⁺ neutrophils was detected in the BALF at 24 and 72 hours, suggesting a low level of activation of these cells (Fig 2B and 2C). In contrast to neutrophils, we did not detect an increase in NK cell percentages or numbers in the lungs at any time point (Fig 2B and 2C, numbers in S2C and S2D Fig). In addition, we tested responsiveness of NK cells by measuring IFNγ, CD69, Perforin and Granzyme B expression. A small increase in CD69⁺ NK cells was observed in the lungs only at 24 hours and 72 hours (S2C and S2D Fig), but no increase of Perforin⁺ and Granzyme B⁺ cells was detected at both 24 and 72 hours post-infection (Figs 2B and 2C, MFI in S2C and S2D). Together these data indicate that sub-lethal infection with SPN induces a low, rapid and transient immune response characterized by the recruitment of neutrophils but no significant NK cell responses.

To study the inflammatory environment at 21 days post-infection, we harvested organs and performed bacterial enumeration. At this time point, no bacteria were recovered in the nasal lavage, BALF, lungs, or spleen (Fig 2D), demonstrating that bacteria had completely been cleared. Additionally, the immune parameters returned to pre-infection state as the percentage and number of neutrophils and NK cells detected in 21 days infected mice was the same as in control PBS mice (Fig 2D, numbers in S2E Fig). Similarly, both neutrophils and NK cells showed no sign of activation in the BALF, lungs and spleen respectively (Fig 2D and S2E Fig). Therefore 21 days after primary exposure, infection by S. pneumoniae is no longer detected and immune cells are similar to uninfected conditions, both in their number and level of activation.

Transferred memory NK cells protect mice from lethal S. pneumoniae infection for at least 12 weeks

As NK cells display intrinsic sensing and memory activities in vitro, we investigated the potential role of D21SPN NK cells during lethal S. pneumoniae challenge in vivo. We adoptively transferred purified D21PBS or D21SPN NK cells into naïve mice (2x10⁵ cells, intravenously, Fig 3A) and one day after the transfer, recipient mice were intranasally infected with a lethal dose of SPN (5x10⁶ CFU for survival study and 1x10⁷ CFU for bacterial counts comparison). At all times points, transferred congenic CD45.2⁺ NK cells were circulating and detectable at similar percentages in lungs and blood, suggesting there is no preferential trafficking between D21PBS and D21SPN NK cells (S3A and S3B Fig). Importantly, we observed a significant reduction in bacterial counts at 40 hours in all tested organs of mice having received D21SPN NK cells compared with those having received D21PBS NK cells, which is not observed at 24 hours (Fig 3B). Additionally, the transfer of D21SPN NK cells reduced mortality and clinical signs in recipient mice infected with S. pneumoniae (5x10⁶ CFU, Fig 3C and 3D). We observed a 75% survival rate for mice having received D21SPN NK cells compared to only 25% for those having received D21PBS NK cells. Interestingly, both groups of mice lost similar weight during the first days of infection (Fig 3E), but mice that received D21SPN NK cells fully recovered from the lethal infection by 7 days as displayed both by clinical scores and weight. We further tested the same experimental set up but purifying and transferring NK cells from lungs of naïve (D21PBS) or previously infected mice (D21SPN) (Fig 3F). Interestingly, we observed that D21SPN NK cells from lungs had a similar protective effect than those from spleen and contribute to reduce the numbers of CFU in recipient mice. Thus, our results demonstrate that the transfer of as few as 2x10⁵ D21SPN NK cells from either spleen or lungs confers significant protection during lethal S. pneumoniae infection compared to D21PBS NK cells.

To evaluate long term protection, we purified NK cells from spleen of naïve or previously infected mice 12 weeks after primary exposure (W12PBS NKs or W12SPN NKs) and transferred them prior to lethal infection with S. pneumoniae. Remarkably, we observed a similar significant reduction in bacterial counts in the lungs and spleen of mice having received W12SPN NK cells, as cells from 21 days post- primary exposure (Fig 3G). Therefore, NK cells retain memory of a primo S. pneumoniae infection, and maintain the ability to protect against lethal challenge, for at least 12 weeks.

To assess the specificity of the observed memory properties, we performed the same transfer model as described in Fig 3A, but infected recipient mice with a lethal dose of the heterologous bacterium Listeria monocytogenes (1x10⁶ CFU, intravenously). Organs were collected 40 hours post-infection for bacterial enumeration (Fig 3H). Our results showed no differences in bacterial counts in the spleen of infected mice between the two conditions. Surprisingly we counted higher numbers of bacteria in the liver of mice having received D21SPN NK cells than D21PBS NK cells. Thus, in vivo, S. pneumoniae memory NK cells are not able to protect recipient mice from L. monocytogenes infection, demonstrating a specificity in their response to S. pneumoniae. Together, these data show that memory NK cells protect mice upon secondary in vivo infection, with specific and long-term properties.

Protection of mice mediated by memory NK cells is IFNγ independent

Because D21SPN NK cells showed higher expression of IFNγ upon secondary stimulation in vitro (Fig 1B), we hypothesized that IFNγ production by memory NK cells in vivo could be an important factor for protecting mice against lethal infection. Using CD45.1 and CD45.2 congenic mice, we compared intracellular IFNγ expression between transferred and endogenous NK cells in both groups of mice receiving D21PBS or D21SPN NK cells (Fig 4A). Upon lethal infection with SPN, IFNγ expression by NK cells increased at 40 hours in the lungs at equal levels between endogenous and transferred cells in the same mouse. But surprisingly, both endogenous and transferred NK cells in mice receiving D21SPN NK cells expressed lower levels of IFNγ than those having received D21PBS NK cells. In addition, total lung IFNγ levels showed no difference between protected mice and control mice (Fig 4B). Therefore, memory NK cells are not producing more IFNγ upon secondary stimulation in vivo.

To further address the role of IFNγ in protection, we transferred WT naïve or WT memory NK cells into IFNγ receptor deficient mice (Ifngr KO, Fig 4C). One day after the transfer, we infected Ifngr KO recipient mice with the same lethal dose of SPN as in Fig 3B and collected organs at 40 hours post-infection. By comparing both WT and Ifngr KO mice having received naïve NK cells we did not detect significant differences in bacterial counts, recruitment of neutrophils or activation of NK cells in the lungs at 40 hours (Fig 4D). These results suggest that IFNγ signaling is not protective during early times of SPN infection. Importantly, we still found a significant reduction in bacterial numbers in the spleen, and a similar trend in lungs, of Ifngr KO recipient mice having received WT D21SPN NK cells compared to Ifngr KO recipient mice having received WT D21PBS NK cells (Fig 4C). Strikingly, these data suggest that IFNγ signaling is not necessary for the protection of mice having received memory NK cells.

Protection of mice is an intrinsic NK cell property

To assess the protective functions of memory NK cells, we analyzed the innate immune response in the lungs of recipient mice. Using the transfer model described in Fig 3A, we infected recipient mice with a lethal dose of S. pneumoniae (1x10⁷ CFU) and collected organs at 24 and 40 hours post-infection. With this infection protocol, bacteria are detectable in the BALF and lungs and disseminate to the bloodstream and spleen by 24 hours (Fig 3B). We first compared immune cell recruitment in the lungs and BALF of infected mice having received naïve or memory NK cells (Fig 5A and 5B, full gating strategy in S4A Fig). Although we observed a robust recruitment of neutrophils at 24 hours in the lungs and BALF of infected mice, we found similar percentages and numbers of neutrophils between the two groups of recipient mice. We observed the same reduction in the percentages and numbers of alveolar macrophages in the lungs and BALF of infected mice having received either naïve or memory NK cells. Surprisingly, we do not observe a significant recruitment or increase in other immune cell types (interstitial macrophages, eosinophils, dendritic cells, monocytes, T cells or NK cells) in the lungs of either group of infected mice compared to uninfected.

Fig 5 — Mouse infections are carried out as in the scheme in Fig 3A. Organs were collected at 24h and 40h post-infection for flow cytometry analysis, ELISA assays and CFU counts. **(A)** Cellular infiltrate analysis in the lungs at 24h post-infection. Percentage of respective cell types among CD45⁺ cells (**left panel**) and absolute number of cells for each cell type (**right panel**): neutrophils (Ly6G⁺ CD11b⁺), alveolar macrophages (AM) (Ly6G^- SiglecF⁺ CD64⁺ CD11b^-), interstitial macrophages (IM) (Ly6G^- SiglecF^- CD11b^high MHCII⁺ CD64⁺ CD24^-), monocytes (Ly6G^- SiglecF^- CD11b^high MHCII^-), eosinophils (Ly6G^- SiglecF⁺ CD11b⁺), dendritic cells (DCs) (CD103⁺ DCs: Ly6G^- SiglecF^- CD11b^low CD103⁺ CD24⁺ + CD11b⁺ DCs: Ly6G^- SiglecF^- CD11b^high MHCII⁺ CD64^- CD24⁺), NK cells (NK1.1⁺ CD3^-), T cells (NK1.1^- CD3⁺). Radar plots with each value representing the geometric mean of three repeats with n = 4 mice. The blue line for uninfected mice, black line for mice having received D21PBS NKs and red line for mice having received D21SPN NKs. **(B)** Cellular infiltrate analysis in the bronchio-alveolar lavage fluid (BALF) at 24h post-infection. Percentage of respective cell types among CD45⁺ cells (**left panel**) and absolute number of cells for each cell type (**right panel**): neutrophils (Ly6G⁺ CD11b⁺), alveolar macrophages (SiglecF⁺ CD64⁺ CD11b^-). Box plots where each dot represents an individual mouse (blue dots for uninfected mice, black dots for mice having received D21PBS NKs, red dots for mice having received D21SPN NKs), lines are the median, error bar show min to max. Date are pooled from at least two repeats with n ≥ 2 mice/group. **(C)** Cellular activation analysis in the lung at 40h post-infection. Percentages of CD69⁺ neutrophils, CD69⁺ NK cells and CD86⁺ interstitial macrophages. Box plots where each dot represents an individual mouse (the blue dots are for uninfected mice, black dots for mice having received D21PBS NKs, red dots for mice having received D21SPN NKs), lines are the median, error bar show min to max. Data are pooled from two repeats with n ≥ 1 mice/group. **(D)** ELISA assays of lung supernatants from infected mice at 40h post-infection. Bars are the mean of at least 3 experiments with n ≥ 3 mice/group, error bars are the standard error of the mean (SEM). **(E-F**) At 40h post-infection, lung supernatants of mice having received either D21PBS NKs (black) or D21SPN NKs (red) **(C)—**either We12PBS NKs (black) or We12SPN NKs (red) **(D)** were collected to perform Granzyme B ELISA assays. Bars are the mean of at least 3 experiments with n ≥ 3 mice/group, each dot represents an individual mouse and error bars are the standard error of the mean (SEM). ns, not significant. * p < 0.05, ** p < 0.01, *** p < 0.001. Kruskal-Wallis **(A,B,C)**, 2way ANOVA **(D)** and Mann-Whitney **(E,F)** tests for statistical significance.

We next evaluated innate immune cell activation in the lungs of recipient mice at 40 hours post-infection. Although neutrophils and NK cells upregulated CD69 compared to uninfected animals, we did not detect any difference between mice having received naïve or memory NK cells (Fig 5C). Additionally, in neutrophils, we did not observe an increase in the intensity of CD11b expression (MFI) or in the percentage of ROS⁺ cells compared to uninfected cells (S4B Fig). Furthermore, interstitial macrophages had the same values of CD86⁺ cells and intensity of MHCII expression between mice having received D21PBS or D21SPN NK cells (Figs 5C and S4B). Therefore, alongside no differential immune cell recruitment, we did not detect an increase in innate immune cell activation in the lungs of protected mice. These results suggest that the protection provided by memory NK cells is not through enhanced recruitment or activation of any of the inflammatory cells tested.

To further investigate the mechanisms of protection mediated by memory NK cells, we quantified selected cytokines and chemokines in lung supernatants by ELISA (Fig 5D at 40 hours, S4C Fig at 24 hours). Coherent with our observation that innate immune cells are not recruited and activated to higher levels by memory NK cells, we did not detect an increase of pro-inflammatory cytokines in the lungs of mice having received D21SPN NK cells. In fact, we showed a signification reduction of CXCL1 production in the lungs of protected mice (Fig 5D).

In addition to cytokines/chemokines signaling, we also studied release of cytotoxic molecules in vivo by comparing Granzyme B production in the lungs of infected mice having previously received D21PBS or D21SPN NK cells (scheme in Fig 3A). Importantly, ELISA on lung supernatants showed an increase of Granzyme B at 40 hours post-infection in mice having received D21SPN NK cells compared to control (Fig 5E), which was not observed at 24 hours post-infection (S4D Fig). Interestingly, the decrease in bacterial numbers in mice having received D21SPN NK cells is detectable at 40h, not at 24h (Fig 3B). Furthermore, we also found the same increase of Granzyme B production in the lungs of mice having received long term memory NK cells (We12SPN NKs, Fig 5F). Therefore, transferring memory NK cells induced a greater production of Granzyme B in the lungs of infected mice. Thus, our results open the possibility that cytotoxic functions of memory NK cells could be important for the protection of mice upon secondary lethal S. pneumoniae infection.

Cytotoxic proteins are upregulated by memory NK cells and important for protection of mice

To further investigate an upregulation of cytotoxic proteins by memory NK cells, we stimulated purified D21PBS and D21SPN NK cells in vitro with inactivated S. pneumoniae. Interestingly, cytokines alone did not induce Granzyme B or Perforin expression in either naïve or memory NK cells (Fig 6A and 6B). However, addition of S. pneumoniae stimulated Granzyme B and Perforin expression specifically in memory NK cells. Indeed, an increase in both percentage of positive cells and intensity of expression was detected under this condition (Fig 6A and 6B). Consistent with the literature, we have observed that responding NK cells (Gzmb⁺) tend to be more mature than non-responding cells (Gzmb^-), however, we did not observe differences between naïve or memory NK cells in maturation markers (S5A Fig). Interestingly, the incubation of memory NK cells with inactivated L. monocytogenes or Streptococcus agalactiae (GBS) did not induce an increase of Granzyme B and Perforin (Fig 6A and 6B), supporting once again the specificity of the response. Therefore, NK cells respond to and remember SPN in an intrinsic and specific manner, by releasing cytotoxic proteins. Such a result implies that NK cells are sensing and responding to bacteria. Therefore, we tested whether Toll like Receptors (TLRs) might play a role. To address this, we stimulated D21PBS and D21SPN NK cells in vitro with TLR agonists such as LPS (TLR4 agonist) or the Pam3CSK4 (TLR1/TLR2 agonist), in parallel to SPN. We hypothesized that if memory NK cells respond to bacterial stimulation in a TLR mediated manner, they would have an increased response when stimulated by LPS or Pam3CSK4. While memory NK cells had increased levels of Granzyme B following SPN stimulation, we did not observe differences in D21SPN compared to D21PBS NK cells stimulated by LPS or Pam3CSK4 (Fig 6C). As a control, we have followed NK cells response to LPS or the TLR agonist by measuring IFNγ positive cells (S5B Fig). These results suggest that memory NK cell responses are not mediated by TLR receptors sensing of bacteria. These data are in agreement with the specificity of the memory recall responses, and suggest some unknown receptor is involved.

Fig 6 — **(A-B-C)** C57BL/6 mice were intranasally injected with either PBS (black symbols) or sub-lethal dose of S. *pneumoniae* (SPN, red symbols, 5x10⁵ CFU) for two consecutive days. After 21 days, NK cells were highly purified from spleens of D21PBS or D21SPN mice (98% of purity) and stimulated *in vitro* with cytokines (IL-15 at 2 ng/ml, IL-18 at 1,5 ng/ml, IL-12 at 1,25 ng/ml) and either formaldehyde inactivated bacteria (MOI 20), Lipopolysaccharide (LPS) or the synthetic lipopeptide Pam3CSK4 (P3C) for 24 hours. SPN: S. *pneumoniae*, GBS: S. *agalactiae*, Listeria: L. *monocytogenes*. **(A)** Intensity of Granzyme B expression in NK cells (MFI, **left panel**), percentage of Granzyme B⁺ NK cells (**middle panel**), representative overlay histogram upon IL-15+IL-18+SPN stimulation (**right panel**, gray represents isotype control). D21PBS NK cells and D21SPN NK cells are purified and pooled from n ≥ 3 mice/group and incubated in n ≥ 2 experimental replicates/group. Box plots where each dot represents an experimental replicate (black dots for D21PBS NK cells, red dots for D21SPN NKs cells), lines are median, error bar show min to max. Data are representative of at least two experiments. **(B)** Intensity of Perforin expression in NK cells (MFI, **left panel**), percentage of Perforin⁺ NK cells (**middle panel**), representative overlay histogram upon IL-15+IL-18+SPN stimulation (**right panel**, gray represents isotype control). D21PBS NK cells and D21SPN NK cells are purified and pooled from n ≥ 3 mice/group and incubated in n ≥ 2 experimental replicates/group. Box plots where each dot represents an experimental replicate (black dots for D21PBS NK cells, red dots for D21SPN NKs cells), lines are median, error bar show min to max. Data are representative of at least two experiments. **(C)** NK cells were stimulated *in vitro* with cytokines, SPN, Lipopolysaccharide (LPS) and the synthetic lipopeptide Pam3CSK4 (P3C). Intensity of Granzyme B expression in NK cells (MFI, **left panel**), percentage of Granzyme B⁺ NK cells (**right panel**). D21PBS NK cells and D21SPN NK cells are purified and pooled from n ≥ 4 mice/group and incubated in n ≥ 3 experimental replicates/group. Box plots where each dot represents an experimental replicate (black dots for D21PBS NK cells, red dots for D21SPN NKs cells), lines are median, error bar show min to max. Data are representative of three experiments. **(D)** Mouse infections are carried out as in the scheme in Fig 3A, with the exception that Prf1 KO mice were used as both donor and recipient mice. Bacterial counts at 40h post-infection in the nasal lavage, bronchio-alveolar lavage fluid (BALF), lungs and spleen of Prf1 KO mice having received D21PBS Prf1 KO NK cells (black symbols) or D21SPN Prf1 KO NK cells (red symbols). Box plots where each dot represents an individual mouse, lines are the mean, error bars show min to max and dotted lines represent limit of detection. Data are pooled from two repeats with n ≥ 3 mice/group. ns, not significant. * p < 0.05, ** p < 0.01, *** p < 0.001. 2way ANOVA **(A,B,C)** and Mann-Whitney **(D)** tests for statistical significance.

To explore whether heightened cytotoxic function of memory NK cells is associated with epigenetic changes, we assessed the histone mark H3K4me1 associated with upstream regulatory regions of gzmb gene in D21PBS and D21SPN NK cells. Although we did not reach statistical significance, we showed a consistent increase of H3K4me1 at -34kb upstream gzmb gene in D21SPN NK cells compared to D21PBS NK cells (S5C Fig), which was not observed at the intergenic region (IG). Thus, our results suggest that memory NK cells are associated with a gain of H3K4me1 at specific regulatory loci of gzmb gene.

To analyze the role of cytotoxic proteins in the protection of mice, we used Perforin KO mice. First, we generated D21PBS or D21SPN Perforin KO NK cells as previously described in Fig 3A. To control that Perforin KO NK cells are still able to acquire memory properties upon S. pneumoniae infection, we stimulated them in vitro and showed that D21SPN Perforin KO NK cells produce more Granzyme B than D21PBS Perforin KO NK cells upon stimulation with IL-15+IL-18+SPN (S5D Fig). Next, we transferred highly purified D21PBS or D21SPN Perforin KO NK cells into naïve Perforin KO recipient mice and infected them with a lethal dose of S. pneumoniae (scheme in Fig 3A). Coherent with our in vitro results, we also observed an increased production of Granzyme B in the lungs of mice having received D21SPN Perforin KO NK cells compared to the control group (S5E Fig). In addition, we evaluated the percentages of neutrophils and NK cells in Perforin KO mice and observed a similar recruitment and activation of cells in both groups of recipient mice (S5F Fig). Importantly, by comparing bacterial counts in the organs of recipient mice we did not observe a reduction of CFU in mice having received D21SPN Perforin KO NK cells compared to control group (Fig 6D). Therefore, our data suggest that memory NK cell protection from lethal infection is abolished in the absence of Perforin production.

Discussion

In this study, we show that NK cells play an important role in extracellular bacterial infections, a property previously poorly described. Notably, NK cells retain an intrinsic memory of previous bacterial encounters and display heightened responses upon secondary exposure to the same bacterium and protect naïve mice from a lethal infection. Surprisingly, protection does not require IFNγ or recruitment of inflammatory cells, instead, an inherent property of NK cells and production of cytotoxic factors seem to be required.

Although NK cell memory has been described upon various viral infections, such response to bacterial infections remains poorly understood. Upon infection with Ehrlichia muris, an intracellular bacterial pathogen, NK cells develop memory-like responses [36]. Indeed, transferred memory-like NK cells from E. muris-primed donor mice conferred protection in Rag2^-/- IL2rg2^-/- recipient mice against a high dose E. muris challenge. However, these memory-like NK cells were not characterized and the mechanisms involved in the protection remain undefined. Also, several studies have investigated NK cell memory upon BCG vaccination but resulted in different conclusions. One study showed that purified splenic NK cells from BCG vaccinated mice do not produce more IFNγ or enhance macrophage phagocytosis in the presence of BCG in vitro [37]. However, it has been suggested that a subset of CD27⁺ KLRG1⁺ NK cells expand following BCG inoculation and confer protection against M. tuberculosis infection by reducing the CFU numbers in the lungs at 30 days post-infection [38]. Finally, it has been shown that BCG immunization may induce antigen-independent memory-like NK cells that can protect mice to heterologous challenge with Candida albicans [39]. Altogether, these studies, along with our work, indicate that NK cell memory could be a general feature of NK cells to all bacteria, and could have important functions during infection.

It remains undefined how NK cells sense and respond to bacteria. Activating receptors are engaged upon sensing of cells infected with intracellular bacteria [40], however, NK cell interactions with extracellular bacteria are poorly explored. One study on human NK cells reported an engagement between the inhibitory receptor Siglec-7 and the β-protein on the surface of group B Streptococcus [41]. However, neither Siglec-7, nor a homologue, is expressed in mice, and thus NK cell binding-interactions with extracellular bacteria are undefined. In our model, we have shown in vitro that purified NK cells can be directly activated upon incubation with only IL-15+IL-18 and S. pneumoniae. Therefore, our data strongly suggest that NK cells directly interact with bacteria in a TLR independent manner thereby inducing cell responses. Such interaction could occur through an unknown surface receptor recognizing some component of the pneumococcal capsule or membrane. It should be noted that although NK cells sense bacteria in vitro to initiate response, the mechanisms of memory acquisition could be different. We hypothesize that NK cells acquire memory by a direct interaction with pneumococcus, but we cannot rule out the possibility that other immune cells are involved in this process. As in other NK cell memory models [38,42–44], some pro-inflammatory cytokines and costimulatory molecules expressed by other cells might be required for generating S. pneumoniae memory NK cells.

Previous studies have shown that memory or memory-like NK cells to viruses and cytokines display increased IFNγ secretion upon re-stimulation [8,45]. Furthermore, endotoxemia-induced memory-like NK cells were also described to produce more IFNγ following in vivo secondary LPS injection [35]. Altogether, it suggests that IFNγ production is the main effector function of memory NK cells in these models. However, in our model, although we detected an increase of IFNγ⁺ NK cells in vitro, the protective effect of memory NK cells was not dependent on IFNγ. In fact, the absence of IFNγ signaling in recipient mice did not affect bacterial dissemination and neutrophils recruitment at early timepoints. Furthermore, we showed less IFNγ⁺ NK cells in the lungs of infected mice receiving memory NK cells. Interestingly, NK cells display a slight remodeling of chromatin at an IFNγ enhancer suggesting that at the epigenetic level, memory NK cells are ready to produce more IFNγ upon the proper stimulus, such as that provided in vitro. Surprisingly, we find no evidence that IFNγ is playing a role in our mouse model and the reduced production of cytokines in the lungs of protected mice could be the consequence of lower number of bacteria in those animals.

The function of NK cells in the recruitment of inflammatory cells is well defined, so is their role in cytotoxicity of infected cells. Indeed, the release of cytotoxic molecules into the immune synapse to induce apoptosis of infected cells is well described [23,46]. Granules secreted by NK cells contain the pore-forming protein Perforin which damages the target cell membrane allowing Granzymes to pass, resulting in the activation of the caspase pathway and reactive oxygen species (ROS) production. Interestingly, the release of Granulysin and Granzyme B into the cytosol of infected cells targets intracellular bacteria [47]. However, the importance of NK cell cytotoxicity in the context of extracellular bacterial infections is not well understood. A few intriguing in vitro studies report direct receptor-mediated recognition and killing of extracellular bacteria such as Mycobacterium tuberculosis, Burkholderia cenocepacia or Pseudomonas aeruginosa by NK cell degranulation [48–50]. Recognition of bacteria by NK cells has been suggested to be receptor mediated as soluble NKp44 binding to extracellular Mycobacterium tuberculosis was shown in vitro [51]. Our data suggest a similar finding as TLRs are not activated and responses are specifically directed towards the same bacteria as the primary stimulus. During an in vivo infection, neither bacterial recognition nor direct killing has been demonstrated, and the mechanisms at play are unknown. In our model of extracellular bacterial infection in vivo, we have shown that memory NK cells lead to more Granzyme B production in the lungs of protected mice, suggesting this effector protein could contribute to host protection against S. pneumoniae. Although the pneumococcus lifestyle is primarily extracellular, a few studies have reported occasional intracellular replication within splenic macrophages and lung epithelial cells [52,53]. In our in vivo studies, we therefore cannot exclude the possibility that memory NK cells are protecting the host by targeting cells infected with intracellular pneumococci.

NK cell-based therapies are the basis of a new generation of innovative immunotherapy for cancer, which yields encouraging results in clinical trials [54]. It is based on activation of NK cells ex vivo for heightened activity against tumor cells. Our work, along with the extensive knowledge on NK cell memory to viruses, could suggest similar ex vivo activation strategies against infections. Gaining a greater understanding of the mechanisms at play as well as the memory features will be paramount.

Materials and methods

Ethics statement

All protocols for animal experiments were reviewed and approved by the CETEA (Comité d’Ethique pour l’Expérimentation Animale—Ethics Committee for Animal Experimentation) of the Institut Pasteur under approval number dap170005 and were performed in accordance with national laws and institutional guidelines for animal care and use.

Animal model

Experiments were conducted using C57BL/6J females of 7 to 12 weeks of age. CD45.2 mice were purchased from Janvier Labs (France). CD45.1, Ifngr1^-/- (JAX stock #003288) and Prf1^-/- (JAX stock #002407) mice were maintained in house at the Institut Pasteur animal facility.

Bacterial inocula

All experiments that include infection with Streptococcus pneumoniae were conducted with the luminescent serotype 4 TIGR4 strain (Ci49) a commonly used pathogenic serotype (containing pAUL-A Tn4001 luxABCDE Km’, [55]), obtained from Thomas Kohler, Universität Greifswald. Experimental starters were prepared from frozen master stocks plated on 5% Columbia blood agar plates (Biomerieux ref no. 43041) and grown overnight at 37°C with 5% CO₂ prior to outgrowth in Todd-Hewitt (BD) broth supplemented with 50mM HEPES (TH+H) and kanamycin (50 μg/ml), as previously described in [56]. Inoculum were prepared from frozen experimental starters grown to midlog phase in TH+H broth supplement with kanamycin (50 μg/ml) at 37°C with 5% CO₂ in unclosed falcon tubes. Bacteria were pelleted at 1500xg for 10 min at room temperature, washed three times in DPBS and resuspended in DPBS at the desired CFU/ml. Bacterial CFU enumeration was determined by serial dilution plating on 5% Columbia blood agar plates.

Listeria monocytogenes EGD strain were grown overnight in brain heart infusion (BHI) liquid broth with shaking at 37°C. Overnight culture were then subcultured 1/10 into fresh BHI and grown to an OD600 of 1. Bacteria were washed three times and subsequently resuspended in DPBS. Experimental starters were then frozen at -80. For mouse infections, experimental starters were thawed on ice and diluted in fresh DPBS at the desired CFU/ml.

For bacteria killed with paraformaldehyde (PFA), the concentrated bacteria, prior to dilution, were incubated in 4% PFA for 30 minutes at room temperature, washed three times in DPBS and diluted to the desired CFU/ml.

Streptococcus agalactiae (GBS, NEM 316 strain) were grown in TH+H medium with shaking at 37°C to an OD600 of 1. Bacteria were pelleted at 1500xg for 10 minutes at room temperature, incubated in 4% PFA for 30 minutes at room temperature, washed three times in DPBS and resuspended in DPBS at the desired CFU/ml.

Mouse infection

Animals were anaesthetized with a ketamine and xylazine cocktail (intra-muscular injection) prior to infection. Mice were infected with Streptococcus pneumoniae by intranasal instillation of 20μl containing 5x10⁵ (sub-lethal dose), 5x10⁶ (survival study) or 1x10⁷ CFU (lethal dose). Control mice received intranasal injection of 20μl of DPBS. For Listeria monocytogenes infection, mice were injected with 100μl of 1x10⁶ CFU by retro-orbital injection. Animals were monitored daily for the first 5 days and then weekly for the duration of the experiment. Mouse sickness score from [57] was used to assess progression of mice throughout S. pneumoniae infection, representing the following scores: 0- Healthy; 1-transiently reduced response/slightly ruffled coat/transient ocular discharge/up to 10% weight loss; 2 and 3- (2-up to 2 signs, 3- up to 3 signs) clear piloerection/intermittent hunched posture/persistent oculo-nasal discharge/persistently reduced response/intermittent abnormal breathing/up to 15% weight loss; 4-death. Animals were euthanized by CO₂ asphyxiation at ≥ 20% loss of initial weight or at persistent clinical score 3.

Sampling

The nasal lavage was obtained by blocking the oropharynx to avoid leakage into the oral cavity and lower airway, and nares were flushed two times with 500μl DPBS. Bronchio-alveolar fluid (BALF) was collected by inserting catheter (18GA 1.16IN, 1.3x30 mm) into the trachea and washing the lungs with 2ml of DPBS. Blood was collected by cardiac puncture at left ventricle with 20G needle and immediately mixed with 100mM EDTA to prevent coagulation. Spleens were disrupted by mechanical dissociation using curved needles to obtain splenocytes suspension in DPBS supplemented with 0,5% FCS+0,4% EDTA. Lungs were mechanically dissociated with gentleMACS Dissociator (Miltenyi Biotec) in cTubes containing lung dissociation kit reagents (DNAse and collagenase ref no. 130-095-927, Miltenyi Biotec).

Lungs, BALF, nasal lavage, blood, spleen homogenates were plated in serial dilutions on 5% Columbia blood agar plates supplemented with gentamycin (5μg/ml) to determine bacterial counts.

NK cell purification and transfer

Splenocytes were passed successively through 100μm, 70μm and 30μm strainers (Miltenyi Biotec) in DPBS (+0,5% FCS+0,4% EDTA) and counted for downstream applications. NK cells were first enriched from splenocytes suspensions using negative enrichment kit (Invitrogen, ref no. 8804–6828) according to manufacturer’s protocol but combined with separation over magnetic columns (LS columns, Miltenyi Biotec). NK cells were then re-purified by negative selection using purification kit and magnetic columns according to manufacturer’s instructions to reach purities of approximately 98% (Miltenyi Biotec, MS columns and isolation kit ref no. 130-115-818). NK cells were purified from mechanically dissociated lungs (as described above) using the same purification protocol but incubating the cells with anti-CD31, anti-CD326 and antiTer119 microbeads beads (Milteny Biotec refs. 130-097-418, 130-1-5-958 and 130-049-901 respectively) for 5 minutes previous to the second purification protocol. Purified NK cells were transferred intravenously by retro-orbital injections into recipient mice (0,2-1x10⁶ cells/mouse) in 100μl of DPBS or cultured for in vitro experiments.

NK cell culture

Purified NK cells were cultured at 1x10⁶ cells/ml in 200μl RPMI 1640 (Gibco) supplemented with 10% FCS and 1 U/mL Penicillin-Streptomycin (10 000 U/mL, Gibco) in 96 well round-bottom plates. Cells were either left unstimulated or activated with paraformaldehyde inactivated bacteria at MOI 20 (S. pneumoniae, L. monocytogenes or S. agalactiae) and/or with various cytokine cocktails composed of IL-15 (2 ng/ml), IL-18 (1,5 ng/ml) and IL-12 (1,25 ng/ml) (Miltenyi Biotec). Cells were also stimulated with the TLR1/TLR2 agonist Pam3CSK4 (InvivoGen) or with LPS from E. coli O111:B4. After 20 hours of culture at 37°C, 1X Brefeldin-A (BFA solution 1000X, ref no. 420601, BioLegend) was added into each well to block secretion of IFNγ for 4 hours. After incubation at 37°C, cells were collected for intracellular cytokine and cytotoxic proteins by flow cytometry.

Cell preparation for cytometry staining

Following mechanical dissociation, lung and spleen homogenates were passed through 100μm strainers in DPBS supplemented with 0,5% FCS+0,4% EDTA, lysed in 1X red blood cell lysis buffer for 3 minutes (ref no. 420301, BioLegend), and passed successively through 70μm and 30μm strainers (Miltenyi Biotec). Single cell suspensions from BALF, lung and spleen were counted and prepared for surface staining in 96 well plates. Prior to IFNγ staining, single cell suspensions are incubated with 1X Brefeldin-A for 4 hours at 37°C to block secretion of cytokines (ref no. 420601, BioLegend). For all, cells were first stained with anti-mouse CD16/CD32 to block unspecific binding and a cocktail of surface labeling antibodies for 40 minutes in DPBS (+0,5% FCS+0,4% EDTA). Next, cells were stained for viability using fixable viability dye (eFluor780, ref no. 65-0865-14, Invitrogen) for 5 minutes at 4°C and then fixed using commercial fixation buffer for 3 minutes (ref no. 420801, BioLegend). For intracellular staining of Granzyme B and Perforin, cells were permeabilized with a Fixation/Permeabilization commercial kit for 30 minutes (Concentrate and Diluent, ref no. 00-5123-43, Invitrogen). After permeabilization and wash, cells were stained with respective antibodies in DPBS (+0,5% FCS+0,4% EDTA) overnight at 4°C. For intracellular staining of IFNγ, cells were permeabilized and stained in buffer from commercial kit (Inside Stain Kit, ref no. 130-090-477, Miltenyi Biotec) for 40 minutes at 4°C. After a final wash suspended in DPBS, sample acquisitions were performed on MACSQuant (Miltenyi Biotec) and LSRFortessa (BD Biosciences) flow-cytometers and analysis were done using FlowJo Software (TreeStar).

ELISA

Following mechanical dissociation, lung homogenates are centrifuged at 400xg for 7 minutes at 4°C. Supernatants are collected and frozen at -20°C for cytokine assays performed by ELISA according to manufacturer’s instructions (DuoSet, R&D Systems).

ChIP-qPCR assays

Around 4x10⁶-6x10⁶ NK cells were fixed in 1% formaldehyde (8 min, room temperature), and the reaction was stopped by the addition of glycine at the final concentration of 0,125 M. After two washes in PBS, cells were resuspended in 0.25% Triton X-100, 10 mM Tris-HCl (pH 8), 10 mM EDTA, 0.5 mM EGTA and proteases inhibitors; the soluble fraction was eliminated by centrifugation; and chromatin was extracted with 250 mM NaCl, 50 mM Tris-HCl (pH 8), 1 mM EDTA, 0.5 mM EGTA and proteases inhibitors cocktail for 30 min on ice. Chromatin was resuspended in 1% SDS, 10 mM Tris-HCl (pH 8), 1 mM EDTA, 0.5 mM EGTA and proteases inhibitors cocktail; and sonicated during 10 cycles using Diagenode Bioruptor Pico (30 sec on 30 sec off). DNA fragment size (<1 kb) was verified by agarose gel electrophoresis. ChIP was performed using H3K4me1 antibody and nonimmune IgG (negative control antibody), 10 μg chromatin per condition was used. Chromatin was diluted 10 times in 0.6% Triton X-100, 0.06% sodium deoxycholate (NaDOC), 150 mM NaCl, 12 mM Tris-HCl, 1 mM EDTA, 0.5 mM EGTA and proteases inhibitors cocktail. For 6 hours, the different antibodies were previously incubated at 4°C with protein G-coated magnetic beads (DiaMag, Diagenode), protease inhibitor cocktail and 0.1% BSA. Chromatin was incubated overnight at 4°C with each antibody/protein G-coated magnetic beads. Immunocomplexes were washed with 1 x buffer 1 (1% Triton X-100, 0.1% NaDOC, 150 mM NaCl, 10 mM Tris-HCl (pH 8)), 1 x buffer 2 (0.5% NP-40, 0.5% Triton X-100, 0.5 NaDOC, 150 mM NaCl, 10 mM Tris-HCl (pH 8)), 1 x buffer 3 (0.7% Triton X-100, 0.1% NaDOC, 250 mM NaCl, 10 mM Tris-HCl (pH 8)) 1 x buffer 4 (0.5% NP-40, 0.5% NaDOC, 250 mM LiCl, 20 mM Tris-HCl (pH 8), 1 mM EDTA) and 1 x buffer 5 (0,1% NP-40, 150 mM NaCl, 20 mM Tris-HCl (pH 8), 1 mM EDTA). Beads were eluted in water containing 10% Chelex and reverse cross-linked by boiling for 10 min, incubating with RNase for 10 min at room temperature, then with proteinase K for 20 min at 55°C and reboiling for 10 min. DNA fragment were purified by Phenol Chloroform extraction. Amplifications (40 cycles) were performed using quantitative real-time PCR using Universal Syber Green Supermix (BIORAD) on a CFX384 Touch Real-Time PCR system (BIORAD). qPCR efficiency (E) was determined for the ChIP primers with a dilution series of genomic mouse DNA. The threshold cycles (Ct values) were recorded from the exponential phase of the qPCR for IP and input DNA for each primer pair. The relative amount of immunoprecipitated DNA was compared to input DNA for the control regions (% of recovery) using the following formula:

% recovery = E^((Ct(1% input)—Log₂(input dilution))–Ct (IP)) x 100%

Primer sequences

-22kb enhancer of the IFNγ locus

5’CCAGGACAGAGGTGTTAAGCCA3’

5’GCAACTTCTTTCTTCTCAGGGTG3’

-55kb enhancer of the IFNγ locus

5’GGCTTCCTGTCATTGTTTCCA3’

5’CAGAGCCATGGGATGACTGA3’

-34kb enhancer of Granzyme B locus

5’CCCTCCCCTCTAATCACACA3’

5’ACGGTGTTGAGGGAGTTTCA3’

Intergenic Region (IG)

5’CCACACCTCTTCCTTCTGGA3’

5’ATTTGTGTCAGAGCCCAAGC3’

Quantification and statistical analysis

Statistical significance was tested using Prism 9 Software (GraphPad). Mann Whitney test was used for single comparisons, Kruskal-Wallis test for 3 groups- comparisons, 2way ANOVA for multiple comparisons and Log-rank (Mantel-Cox) test for survival curves.

Supporting information

S1 Fig. Receptor expression profile of NK cells following S. pneumoniae infection.

(A) Representative contour plots for NK cell purity of D21PBS (black symbols) and D21SPN (red symbols) samples based on NK1.1⁺ CD3^- or NK1.1⁺ DX5⁺ markers (left panel). Percentage of NK cells among live cells (purity of cells, right panel). Box plots where each dot represents a pool of mice from one experiment, lines are the median, error bars show min to max. Data are representative of more than three repeats with n ≥4 pooled mice/group and n ≥ 3 experimental replicates/group. (B) Mouse infections are carried out as in the scheme in Fig 1A. NK cells were isolated from spleens of mice previously infected with S. pneumoniae (red bars, D21SPN NKs) or not (black bars, D21PBS NKs). Highly purified NK cells were fixed, and chromatin was extracted and sheared. ChIP for H3K4me1 were performed and resulting positive fractions of the chromatin were amplified using PCR for the indicated targets. Enrichment percentage for H3K4me1 pull-down on regions upstream the ifng gene in NK cells from D21PBS and D21SPN mice. Data are representative of four experiments with n ≥ 4 mice/group. (C-D) Splenocytes were harvested from mice 12 days (C) or 21 days (D) after they were intranasally injected with either PBS (black symbols) or sub-lethal dose of S. pneumoniae (SPN, red symbols, 5x10⁵ CFU) for two consecutive days. NK cell expression of several NK cell receptors in percentages (left panel) and intensity of expression (MFI, right panel). Box plots where each dot represents an individual mouse, lines are the median, error bars show min to max. Data are pooled from one (C) or two (D) repeats with n ≥ 4 mice/group. ns, not significant. * p < 0.05 and ** p <0.01. Mann-Whitney (A,B) and 2way ANOVA (C,D) tests for statistical significance.

(TIFF)

Click here for additional data file.^{(27.9MB, tiff)}

S2 Fig. Extended characterization of NK cell response to primary S. pneumoniae infection.

Weight (A) and clinical score (B) following the infection scheme from Fig 2A. Dots represent the mean and error bars are the standard error of the mean (SEM). Data are pooled from two repeats with n = 4 mice/group. (C-E) Organs were collected at 24h (C), 72h (D) and 21 days post-infection (E). Absolute numbers of neutrophils (CD11b⁺ Ly6G⁺) in the lungs and bronchio-alveolar lavage fluid (BALF) (left panel). Absolute numbers of NK cells (NK1.1⁺ CD3^-), percentage of CD69⁺ NK cells, intensity of Granzyme B and Perforin expression (MFI) and representative overlay histogram of Granzyme B and Perforin staining in NK cells (right panel). Box plots where each dot represents an individual mouse (black dots for uninfected mice, red dots for infected mice), lines are the median, error bar show min to max. Grey histogram represents isotype control. Data are pooled from two or three repeats with n ≥ 3 mice/group. ns, not significant. * p < 0.05, ** p < 0.01. Mann-Whitney test for statistical significance.

(TIFF)

Click here for additional data file.^{(27.9MB, tiff)}

S3 Fig. Measure of transferred NK cell circulation.

(A-B) Mouse infections are carried out as in the scheme in Fig 3A. Congenic mice are used to distinguish donor NK cells (CD45.2⁺) from recipient NK cells (CD45.1⁺). (A) Representative gating strategy to measure purity of transferred D21PBS NKs (black symbols) or D21SPN NKs (red symbols) in the lungs of recipient mice at 24 hours post-infection. Purity represents the percentage of NK cells among CD45.2⁺ transferred cells. Box plots where each dot represents an individual recipient mouse, lines are the median, error bar show min to max. Data are representative of three repeats with n ≥ 4 mice/group. (B) Representative gating strategy to detect transferred NK cells. Percentages and numbers of CD45.2⁺ transferred NK cells in the lungs and blood of CD45.1⁺ recipient mice at 24h and 40h post-infection. Box plots where each dot represents an individual recipient mouse, lines are the median, error bar show min to max. Data are pooled from at least two repeats with n ≥ 3 mice/group. ns, not significant. Mann-Whitney test for statistical significance.

(TIFF)

Click here for additional data file.^{(27.9MB, tiff)}

S4 Fig. Impact of transferred memory NK cells in innate immune cell activation upon S. pneumoniae infection.

Mouse infections are carried out as in the scheme in Fig 3A. Organs were collected at 24h and 40h post-infection for flow cytometry analysis and ELISA assays. (A) Gating strategy used to identify myeloid-cell subsets in the lungs at 24h post-infection, adapted from [58]. After the exclusion of debris, doublets and dead cells, immune cells were identified by CD45 staining. Neutrophils, alveolar macrophages and eosinophils are defined with the following specific markers respectively: Ly6G⁺ CD11b⁺, SiglecF⁺ CD11b^-, SiglecF⁺ CD11b⁺. Gating on CD11b^high was used to distinguish myeloid cells from lymphoid cells with the exception of CD103⁺ dendritic cells that are defined as CD11b^low CD103⁺ CD24⁺ cells. In CD11b^high subset, gating on MHCII⁺ cells allow to identify interstitial macrophages as MHCII⁺ CD64⁺ CD24^- cells and CD11b⁺ dendritic cells as MHCII⁺ CD64^- CD24⁺ cells. On the contrary, CD11b^high MHCII^- cells are monocytes/immature macrophages that can have different maturation states based on Ly6C marker. (B) Cellular activation analysis in the lungs at 40h post-infection. Intensity of CD11b expression in neutrophils (MFI), percentage of ROS⁺ neutrophils and intensity of MHCII expression in interstitial macrophages (MFI). Box plots with each dot representing individual mice (blue dots for uninfected mice, black dots for mice having received D21PBS NKs, red dots for mice having received D21SPN NKs), lines are the median, error bar show min to max. Data are pooled from two repeats with n ≥ 1 mice/group. (C) ELISA assays of lung supernatants from infected mice having received either D21PBS NKs (black) or D21SPN NKs (red) at 24h post-infection. Bars are the mean of at least 3 experiments with n ≥ 3 mice/group, error bars are the standard error of the mean (SEM). (D) Granzyme B ELISA assays of lung supernatants from infected mice having received either D21PBS NKs (black) or D21SPN NKs (red) at 24h post-infection. Bars are the mean of at least 3 experiments with n ≥ 3 mice/group, error bars are the standard error of the mean (SEM). ns, not significant. Kruskal-Wallis (B), 2way ANOVA (C) and Mann-Whitney (D) tests for statistical significance.

(TIFF)

Click here for additional data file.^{(27.9MB, tiff)}

S5 Fig. Granzyme B expression in memory NK cells.

(A) NK cells were stimulated in vitro with cytokines and formaldehyde inactivated SPN (MOI 20) for 24 hours. Percentage and intensity (MFI) of CD11b in NK cells (left panel), percentage and intensity (MFI) of CD27 in NK cells (right panel) in both Granzyme B⁺ and Granzyme B^- cells. D21PBS NK cells and D21SPN NK cells are purified and pooled from n ≥ 4 mice/group and incubated in n ≥ 3 experimental replicates/group. Box plots where each dot represents an experimental replicate (black dots for D21PBS NK cells, red dots for D21SPN NKs cells), lines are median, error bar show min to max. Data are representative of three experiments. (B-C) C57BL/6 mice were intranasally injected with either PBS (black symbols) or sub-lethal dose of S. pneumoniae (SPN, red symbols, 5x10⁵ CFU) for two consecutive days. After 21 days, NK cells were highly purified from spleens of D21PBS or D21SPN mice (98% of purity) and stimulated in vitro with cytokines (IL-15 at 2 ng/ml, IL-18 at 1,5 ng/ml, IL-12 at 1,25 ng/ml) and either formaldehyde inactivated SPN (MOI 20), Lipopolysaccharide (LPS) or the synthetic lipopeptide Pam3CSK4 (P3C) for 24 hours. (B) NK cells were stimulated in vitro with cytokines, Lipopolysaccharide (LPS) and the synthetic lipopeptide Pam3CSK4 (P3C) for 24h. Percentage of IFNγ⁺ NK cells. D21PBS NK cells and D21SPN NK cells are purified and pooled from n ≥ 3 mice/group and incubated in n ≥ 2 experimental replicates/group. Box plots where each dot represents an experimental replicate (black dots for D21PBS NK cells, red dots for D21SPN NKs cells), lines are median, error bar show min to max. Data are representative of two experiments. (C) Mouse infections are carried out as in the scheme in Fig 1A. NK cells were isolated from spleens of mice previously infected with S. pneumoniae (red bars, D21SPN NKs) or not (black bars, D21PBS NKs). Highly purified NK cells were fixed, and chromatin was extracted and sheared. ChIP for H3K4me1 were performed and resulting positive fractions of the chromatin were amplified using PCR for the indicated targets. Enrichment percentage for H3K4me1 pull-down on -34kb upstream the gzmb gene and intergenic regions (IG) in NK cells from D21PBS and D21SPN mice. Data are representative of at least three experiments with n ≥ 4 mice/group. (D) Mouse infections and in vitro experiments are carried out as in the scheme in Fig 1A, with the exception that Prf1 KO mice were used. Purified D21PBS (black) or D21SPN (red) Prf1 KO NK cells were stimulated in vitro with cytokines (IL-15 at 2 ng/ml and IL-18 at 1,5 ng/ml) and formaldehyde inactivated S. pneumoniae (SPN, MOI 20) for 24 hours. Intensity of Granzyme B expression in NK cells (MFI, left panel) and percentage of Granzyme B⁺ NK cells (right panel) upon in vitro stimulation. Box plots where each dot represents a pool of mice from one experiment, lines are median, error bar show min to max. Data are representative of one experiment with n = 4 pooled mice/group and n ≥ 2 experimental replicates/group. (E-F) Mouse infections and in vivo transfers are carried out as in the scheme in Fig 3A, with the exception that Prf1 KO mice were used as both donor and recipient mice. (E) Granzyme B ELISA experiment of lung supernatants from infected mice at 40h post-infection, having received either D21PBS (black) or D21SPN (red) Prf1 KO NK cells. Dots represent individual mouse, bars are the mean and error bars are the standard error of the mean (SEM). Data are representative of one experiment with n ≥ 3 mice/group. (F) Percentages of neutrophils, CD69⁺ neutrophils and NK cells in the lungs of Prf1 KO recipient mice having received either D21PBS (black) or D21SPN (red) Prf1 KO NK cells. Box plots with each dot representing individual mouse, line are the median, error bar show min to max. Data are representative of one experiment with n ≥ 3 mice/group. ns, not significant. *** p < 0.001, *** p < 0.0001. Mann-Whitney (A,D,E,F) and 2way ANOVA (B-C) tests for statistical significance.

(TIFF)

Click here for additional data file.^{(27.9MB, tiff)}

Acknowledgments

We thank P. Bousso (Institut Pasteur) and M. Lecuit (Institut Pasteur) for their generous gifts of Ifngr1^-/- and Prf1^-/- mice. We thank C. Werts for her advice and for providing LPS and S. Dramsi for providing GBS. We are thankful to M. Ingersoll for her precious advice throughout the project and corrections of the manuscript. We would like to thank E. Gomez Perdiguero for her help with flow cytometry analysis. We thank P.H. Commere and S. Megharba (Cytometry and Biomarkers UTechS, Institut Pasteur) for their help with flow cytometry acquisition.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This study and M.A.H were supported by Institut Pasteur, the Agence Nationale de la Recherche (ANR-17-CE12-0007), the Fondation pour la Recherche Médicale (EQU202003010152), the Fondation iXCore-iXLife, the Don Prix CANETTI 2020, the EMBO Young Investigator Program. M.A.H is a member of the Laboratoire d’Excellence “Integrative Biology of Emerging Infectious Diseases” Agence Nationale de la Recherche (ANR): ANR-10-LABX- 62-EIBID). T.M.N.C received a salary from the Crédit Agricole d’Ile de France and Fondation pour la Recherche Médicale, grants no. PMJ201810007628 (Prix MARIANE JOSSO) and no. FDT202106012790 (Fin de thèse). J.T received a salary from the Fondation ARC, grant no. ARCPOST-DOC2021070004074. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Divangahi M, Aaby P, Khader SA, Barreiro LB, Bekkering S, Chavakis T, et al. Trained immunity, tolerance, priming and differentiation: distinct immunological processes. Nature Immunology. 2021;22:2–6. doi: 10.1038/s41590-020-00845-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Hamon MA, Quintin J. Innate immune memory in mammals. Seminars in Immunology. 2016;28:351–8. doi: 10.1016/j.smim.2016.05.003 [DOI] [PubMed] [Google Scholar]
3.Saeed S, Quintin J, Kerstens HHD, Rao NA, Aghajanirefah A, Matarese F, et al. Epigenetic programming of monocyte-to-macrophage differentiation and trained innate immunity. Science. 2014;345(6204):1251086–10. doi: 10.1126/science.1251086 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Quintin J, Cheng SC, van der Meer JWM, Netea MG. Innate immune memory: Towards a better understanding of host defense mechanisms. Current Opinion in Immunology. 2014;29:1–7. doi: 10.1016/j.coi.2014.02.006 [DOI] [PubMed] [Google Scholar]
5.Cerwenka A, Lanier LL. Natural killer cell memory in infection, inflammation and cancer. Nature Reviews Immunology. 2016;16:112–23. doi: 10.1038/nri.2015.9 [DOI] [PubMed] [Google Scholar]
6.Geary CD, Sun JC. Memory responses of natural killer cells. Seminars in Immunology. 2017;31:11–9. doi: 10.1016/j.smim.2017.08.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.O’Sullivan TE, Sun JC, Lanier LL. Natural Killer Cell Memory. Immunity. 2015;43:634–45. doi: 10.1016/j.immuni.2015.09.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Sun JC, Beilke JN, Lanier LL. Adaptive immune features of natural killer cells. Nature. 2009;457(7229):557–61. doi: 10.1038/nature07665 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Lopez-Vergès S, Milush JM, Schwartz BS, Pando MJ, Jarjoura J, York VA, et al. Expansion of a unique CD57 +NKG2C hi natural killer cell subset during acute human cytomegalovirus infection. PNAS. 2011;108(36):14725–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Azzi T, Lünemann A, Murer A, Ueda S, Béziat V, Malmberg KJ, et al. Role for early-differentiated natural killer cells in infectious mononucleosis. Blood. 2014;124(16):2533–43. doi: 10.1182/blood-2014-01-553024 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Littwitz-Salomon E, Nguyen T, Schimmer S, Dittmer U. Friend retrovirus infection induces the development of memory-like natural killer cells. Retrovirology. 2018;15(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Wijaya RS, Read SA, Truong NR, Han S, Chen D, Shahidipour H, et al. HBV vaccination and HBV infection induces HBV-specific natural killer cell memory. Gut. 2021;70(2):357–69. doi: 10.1136/gutjnl-2019-319252 [DOI] [PubMed] [Google Scholar]
13.Theresine M, Patil ND, Zimmer J. Airway Natural Killer Cells and Bacteria in Health and Disease. Frontiers in Immunology. 2020;11. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Spörri R, Joller N, Albers U, Hilbi H, Oxenius A. MyD88-Dependent IFN-γ Production by NK Cells Is Key for Control of Legionella pneumophila Infection. The Journal of Immunology. 2006;176(10):6162–71. [DOI] [PubMed] [Google Scholar]
15.Ivin M, Dumigan A, de Vasconcelos FN, Ebner F, Borroni M, Kavirayani A, et al. Natural killer cell-intrinsic type I IFN signaling controls Klebsiella pneumoniae growth during lung infection. PLoS Pathog. 2017;13(11). doi: 10.1371/journal.ppat.1006696 [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Feng CG, Kaviratne M, Rothfuchs AG, Cheever A, Hieny S, Young HA, et al. NK Cell-Derived IFN-γ Differentially Regulates Innate Resistance and Neutrophil Response in T Cell-Deficient Hosts Infected with Mycobacterium tuberculosis. The Journal of Immunology. 2006;177(10):7086–93. [DOI] [PubMed] [Google Scholar]
17.Lai HC, Chang CJ, Lin CS, Wu TR, Hsu YJ, Wu TS, et al. NK Cell–Derived IFN-γ Protects against Nontuberculous Mycobacterial Lung Infection. The Journal of Immunology. 2018;201(5):1478–90. [DOI] [PubMed] [Google Scholar]
18.Wang D, Gu X, Liu X, Wei S, Wang B, Fang M. NK cells inhibit anti-Mycobacterium bovis BCG T cell responses and aggravate pulmonary inflammation in a direct lung infection mouse model. Cell Microbiol. 2018;20(7). [DOI] [PubMed] [Google Scholar]
19.Kerr AR, Kirkham LAS, Kadioglu A, Andrew PW, Garside P, Thompson H, et al. Identification of a detrimental role for NK cells in pneumococcal pneumonia and sepsis in immunocompromised hosts. Microbes Infect. 2005. May;7(5–6):845–52. doi: 10.1016/j.micinf.2005.02.011 [DOI] [PubMed] [Google Scholar]
20.Christaki E, Diza E, Giamarellos-Bourboulis EJ, Papadopoulou N, Pistiki A, Droggiti DI, et al. NK and NKT cell depletion alters the outcome of experimental pneumococcal pneumonia: Relationship with regulation of interferon- γ production. J Immunol Res. 2015;2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Goldmann O, Chhatwal GS, Medina E. Contribution of Natural Killer Cells to the Pathogenesis of Septic Shock Induced by Streptococcus pyogenes in Mice. J Infect Dis. 2005;191:1280–6. doi: 10.1086/428501 [DOI] [PubMed] [Google Scholar]
22.Dornand J, Lafont V, Oliaro J, Terraza A, Castaneda-Roldan E, Liautard JP. Impairment of Intramacrophagic Brucella suis Multiplication by Human Natural Killer Cells Through A Contact-Dependent Mechanism. Infect Immun. 2004. Apr;72(4):2303–11. doi: 10.1128/IAI.72.4.2303-2311.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Voskoboinik I, Whisstock JC, Trapani JA. Perforin and granzymes: Function, dysfunction and human pathology. Nature Reviews Immunology. 2015;15:388–400. doi: 10.1038/nri3839 [DOI] [PubMed] [Google Scholar]
24.Gonzales CM, Williams CB, Calderon VE, Huante MB, Moen ST, Popov VL, et al. Antibacterial role for natural killer cells in host defense to Bacillus anthracis. Infect Immun. 2012. Jan;80(1):234–42. doi: 10.1128/IAI.05439-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Fernandes DM, Benson R, Baldwin CL. Lack of a Role for Natural Killer Cells in Early Control of Brucella abortus 2308 Infections in Mice. Infect Immun. 1995;63(10):4029–33. doi: 10.1128/iai.63.10.4029-4033.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Junqueira-Kipnis AP, Kipnis A, Jamieson A, Juarrero MG, Diefenbach A, Raulet DH, et al. NK Cells Respond to Pulmonary Infection with Mycobacterium tuberculosis, but Play a Minimal Role in Protection. The Journal of Immunology. 2003. Dec 1;171(11):6039–45. doi: 10.4049/jimmunol.171.11.6039 [DOI] [PubMed] [Google Scholar]
27.Weiser JN, Ferreira DM, Paton JC. Streptococcus pneumoniae: Transmission, colonization and invasion. Nature Reviews Microbiology. 2018;16:355–67. doi: 10.1038/s41579-018-0001-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Kadioglu A, Weiser JN, Paton JC, Andrew PW. The role of Streptococcus pneumoniae virulence factors in host respiratory colonization and disease. Nature Reviews Microbiology. 2008;6:288–301. doi: 10.1038/nrmicro1871 [DOI] [PubMed] [Google Scholar]
29.Bogaert D, de Groot R, Hermans PWM. Streptococcus pneumoniae colonisation: The key to pneumococcal disease. Lancet Infectious Diseases. 2004;4:144–54. doi: 10.1016/S1473-3099(04)00938-7 [DOI] [PubMed] [Google Scholar]
30.Gillespie SH, Balakrishnan I. Pathogenesis of pneumococcal infection. Journal of Medical Microbioly. 2000;49:1057–67. doi: 10.1099/0022-1317-49-12-1057 [DOI] [PubMed] [Google Scholar]
31.Baranek T, Morello E, Valayer A, Aimar RF, Bréa D, Henry C, et al. FHL2 regulates natural killer cell development and activation during Streptococcus pneumoniae infection. Front Immunol. 2017. Feb 13;8(123). doi: 10.3389/fimmu.2017.00123 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Elhaik-Goldman S, Kafka D, Yossef R, Hadad U, Elkabets M, Vallon-Eberhard A, et al. The natural cytotoxicity receptor 1 contribution to early clearance of Streptococcus pneumoniae and to natural killer-macrophage cross talk. PLoS One. 2011;6(8). doi: 10.1371/journal.pone.0023472 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Clark SE, Schmidt RL, Aguilera ER, Lenz LL. IL-10-producing NK cells exacerbate sublethal Streptococcus pneumoniae infection in the lung. Translational Research. 2020. Dec 1;226:70–82. doi: 10.1016/j.trsl.2020.07.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Lau CM, Wiedmann GM, Sun JC. Epigenetic regulation of natural killer cell memory. Immunol Rev. 2022;305:90–110. doi: 10.1111/imr.13031 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Rasid O, Chevalier C, Camarasa TMN, Fitting C, Cavaillon JM, Hamon MA. H3K4me1 Supports Memory-like NK Cells Induced by Systemic Inflammation. Cell Rep. 2019. Dec 17;29(12):3933–3945.e3. doi: 10.1016/j.celrep.2019.11.043 [DOI] [PubMed] [Google Scholar]
36.Habib S, El Andaloussi A, Hisham A, Ismail N. NK cell-mediated regulation of protective memory responses against intracellular ehrlichial pathogens. PLoS One. 2016. Apr 1;11(4). doi: 10.1371/journal.pone.0153223 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Kawahara M, Hasegawa N, Takaku H. Murine splenic natural killer cells do not develop immunological memory after re-encounter with Mycobacterium bovis BCG. PLoS One. 2016. Mar 1;11(3). [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Venkatasubramanian S, Cheekatla S, Paidipally P, Tripathi D, Welch E, Tvinnereim AR, et al. IL-21-dependent expansion of memory-like NK cells enhances protective immune responses against Mycobacterium tuberculosis. Mucosal Immunol. 2017. Jul 1;10(4):1031–42. doi: 10.1038/mi.2016.105 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Kleinnijenhuis J, Quintin J, Preijers F, Joosten LAB, Jacobs C, Xavier RJ, et al. BCG-induced trained immunity in NK cells: Role for non-specific protection to infection. Clinical Immunology. 2014. Dec 1;155(2):213–9. doi: 10.1016/j.clim.2014.10.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Mody CH, Ogbomo H, Xiang RF, Kyei SK, Feehan D, Islam A, et al. Microbial killing by NK cells. Journal of Leukocyte Biology. 2019;105:1285–96. doi: 10.1002/JLB.MR0718-298R [DOI] [PubMed] [Google Scholar]
41.Fong JJ, Tsai CM, Saha S, Nizet V, Varki A, Buif JD. Siglec-7 engagement by GBS β-protein suppresses pyroptotic cell death of natural killer cells. Proc Natl Acad Sci U S A. 2018. Oct 9;115(41):10410–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.van den Boorn JG, Jakobs C, Hagen C, Renn M, Luiten RM, Melief CJM, et al. Inflammasome-Dependent Induction of Adaptive NK Cell Memory. Immunity. 2016. Jun 21;44(6):1406–21. doi: 10.1016/j.immuni.2016.05.008 [DOI] [PubMed] [Google Scholar]
43.Sun JC, Madera S, Bezman NA, Beilke JN, Kaplan MH, Lanier LL. Proinflammatory cytokine signaling required for the generation of natural killer cell memory. Journal of Experimental Medicine. 2012. May 7;209(5):947–54. doi: 10.1084/jem.20111760 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Rölle A, Pollmann J, Ewen EM, Le VTK, Halenius A, Hengel H, et al. IL-12-producing monocytes and HLA-E control HCMV-driven NKG2C+ NK cell expansion. Journal of Clinical Investigation. 2014. Dec 1;124(12):5305–16. doi: 10.1172/JCI77440 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Cooper MA, Elliott JM, Keyel PA, Yang L, Carrero JA, Yokoyama WM. Cytokine-induced memory-like natural killer cells. PNAS. 2009;106(6):1915–9. doi: 10.1073/pnas.0813192106 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Chowdhury D, Lieberman J. Death by a thousand cuts: Granzyme pathways of programmed cell death. Annual Review of Immunology. 2008;26:389–420. doi: 10.1146/annurev.immunol.26.021607.090404 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Walch M, Dotiwala F, Mulik S, Thiery J, Kirchhausen T, Clayberger C, et al. Cytotoxic cells kill intracellular bacteria through granulysin-mediated delivery of granzymes. Cell. 2014. Jun 5;157(6):1309–23. doi: 10.1016/j.cell.2014.03.062 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Lu CC, Wu TS, Hsu YJ, Chang CJ, Lin CS, Chia JH, et al. NK cells kill mycobacteria directly by releasing perforin and granulysin. J Leukoc Biol. 2014. Dec;96(6):1119–29. doi: 10.1189/jlb.4A0713-363RR [DOI] [PubMed] [Google Scholar]
49.Li SS, Saleh M, Xiang RF, Ogbomo H, Stack D, Huston SH, et al. Natural killer cells kill Burkholderia cepacia complex via a contact-dependent and cytolytic mechanism. Int Immunol. 2019. Feb 19;31(6):385–96. doi: 10.1093/intimm/dxz016 [DOI] [PubMed] [Google Scholar]
50.Feehan DD, Jamil K, Polyak MJ, Ogbomo H, Hasell M, Li SS, et al. Natural killer cells kill extracellular Pseudomonas aeruginosa using contact-dependent release of granzymes B and H. PLoS Pathog. 2022. Feb 1;18(2). doi: 10.1371/journal.ppat.1010325 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Esin S, Batoni G, Counoupas C, Stringaro A, Brancatisano FL, Colone M, et al. Direct binding of human NK cell natural cytotoxicity receptor NKp44 to the surfaces of mycobacteria and other bacteria. Infect Immun. 2008. Apr;76(4):1719–27. doi: 10.1128/IAI.00870-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Ercoli G, Fernandes VE, Chung WY, Wanford JJ, Thomson S, Bayliss CD, et al. Intracellular replication of Streptococcus pneumoniae inside splenic macrophages serves as a reservoir for septicaemia. Nat Microbiol. 2018. May 1;3(5):600–10. doi: 10.1038/s41564-018-0147-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Badgujar DC, Anil A, Green AE, Surve MV, Madhavan S, Beckett A, et al. Structural insights into loss of function of a pore forming toxin and its role in pneumococcal adaptation to an intracellular lifestyle. PLoS Pathog. 2020. Nov 20;16(11). [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Shimasaki N, Jain A, Campana D. NK cells for cancer immunotherapy. Nature Reviews Drug Discovery. 2020;19:200–18. doi: 10.1038/s41573-019-0052-1 [DOI] [PubMed] [Google Scholar]
55.Saleh M, Abdullah MR, Schulz C, Kohler T, Pribyl T, Jensch I, et al. Following in real time the impact of pneumococcal virulence factors in an acute mouse pneumonia model using bioluminescent bacteria. Journal of Visualized Experiments. 2014. Feb 23;(84). [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Connor MG, Camarasa TMN, Patey E, Rasid O, Barrio L, Weight CM, et al. The histone demethylase KDM6B fine-tunes the host response to Streptococcus pneumoniae. Nat Microbiol. 2021. Feb 1;6(2):257–69. doi: 10.1038/s41564-020-00805-8 [DOI] [PubMed] [Google Scholar]
57.Stark AK, Okkenhaug K, Banham-Hall E. Acute Streptococcus pneumoniae lung infection: Mouse model and characterisation of the immune response. Protoc Exch. 2018. Sep 24; [Google Scholar]
58.Misharin A, Morales-Nebreda L, Mutlu G, Budinger G, Perlman H. Flow cytometric analysis of macrophages and dendritic cell subsets in the mouse lung. Am J Respir Cell Mol Biol. 2013;19(4)-503–510 doi: 10.1165/rcmb.2013-0086MA [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS Pathog. doi: 10.1371/journal.ppat.1011159.r001

Decision Letter 0

Marcel A Behr, Rachel M McLoughlin

28 Feb 2023

Dear Dr. Hamon,

Thank you very much for submitting your manuscript "Streptococcus pneumoniae drives specific and lasting Natural Killer cell memory" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments. Specifically there was concern over the robustness of some of the conclusions being drawn given the relatively low number of replicates in some of the in vivo studies. In addition it is suggested that more careful consideration be given to the phenotype of the particular NK subset that may be exerting these protective memory effects.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Rachel M McLoughlin, PhD

Academic Editor

PLOS Pathogens

Marcel Behr

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: This study presents new evidence for protective NK cell memory in the context of respiratory tract infection with S. pneumoniae. Their findings suggest that memory NK cells from the spleen improve protection against lethal S. pneumoniae infection, and this correlates with increased granzyme B production by lung NK cells. Despite the elevation in IFN-gamma production by spleen NK memory cells in response to S. pneumoniae exposure in vitro, IFN-gamma signaling was not required for NK cell memory protection, confirmed using IFNGR-/- mice. Instead, NK cell memory protection was lost in Prf1-/- mice, suggesting importance for NK cell cytotoxic capacity in memory-induced production. This unexpected finding indicates that a unique mechanism related to the expression of perforin and granzyme B is involved in protective NK cell memory against S. pneumoniae infection, in contrast to other examples of NK cell memory which are associated with NK cell IFN-gamma production. The requirement for lung vs spleen NK cell intrinsic changes could be further clarified, as all transfer experiments demonstrating memory NK cell protection use spleen NK cells rather than lung (see additional comments). The study falls short of demonstrating the mechanism by which memory NK cell cytotoxicity, or other cells affected by this response, lead to improved bacterial clearance. Regardless, these findings demonstrate a novel innate immune memory pathway of protection against S. pneumoniae. The data are clearly presented with appropriate controls, the authors have acknowledged relevant literature relating to this work, and conclusions are not over-stated.

Reviewer #2: Camarasa et al describe a form of innate NK cell memory that develops in mice following sub-lethal infection with the bacterial pathogen Streptococcus pneumoniae. The novelty of the study is in the clear demonstration of a memory phenotype in NK cells, subsequent to infection with a predominantly extracellular pathogen. This is interesting of itself, but the finding that the mechanism of NK cell-mediated protection against severe infection is perforin-dependent is perhaps the most eye catching part of the study and challenges a prevailing dogma. Although the authors do not define the mechanism(s) by which perforin production affords protection, they do show convincingly that NK cell production of cytotoxins contributes to immune defence against pneumococci.

The manuscript is well written throughout, follows a logical progression, and is largely experimentally sound. I have a few reservations about certain experiments and some of the discussion lacks depth, but I think the study is robust, has merit and will be of interest to a broad readership.

Reviewer #3: In their manuscript ”Steptococcus pneumoniae drives specific and lasting Natural Killer Cell memory, Camarasa et al. used a mouse model to identify NK cell memory following sublethal infection with extracellular bacteria. In detail, the authors demonstrate long-lasting functional priming of splenic NK cells that is dependent on perforin but not IFN-g. The authors also show that the NK cell recall response is specific to SPN and does not extend to other intracellular bacterial infections such as listeria monocytogenes.

This is a very interesting and relevant study as it sheds novel light on the definition of memory NK cell subsets. In general, the paper is clear and concise, however more interesting results may be observed by extrapolating the data to distinct NK subsets, rather than bulk NK (based on CD49b and CD27 expression). This may lead to the identification of a more specific NK cell subset within which the memory resides. However, some statements are over interpreted and should be reviewed and modified.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: 1. It is unclear whether lung NK cells from 21d post-infection respond similarly to in vitro stimulation as the spleen NK cells. For example, do they produce IFN-gamma and granzyme B upon stimulation with IL-15/IL-18/SPN?

2. Are there any transient NK cell responses (including IFN-gamma, granzyme B) in spleen NK cells at 24-72 hpi like there are in the lung (in Fig 2B-C)? This would relate to the infection-associated phenotype in spleen NK cells, which are used for the adoptive transfers demonstrating memory NK cell protection.

Reviewer #2: The study contains plenty of high quality data, derived from well-powered experimental analyses. However, a couple of important conclusions are reached based on data trends that don't reach statistical significance. The two sections where histone modification were assessed both suggest interesting (and potentially functionally important) changes that may be driven by infection. However, in both cases, the sample size for analysis is small (n=4 and n=5), which prevents firm conclusions from being drawn. I would suggest the authors attempt an extra few replicates, to pin down whether the mechanisms they describe are driven by epigenetic modifications in ifng and gzmb. Similarly, the differences in mouse survival described in Figure 3C are based on experiments with n=4 per group. This is a very small number for a survival experiment and I would have more confidence in the conclusions reached, if the results were reproduced in a larger sample size.

The adoptive transfer experiments performed with the ifngr KO mice are nicely conceived, demonstrating that IFNg is not the basis of the protective mechanism at play in NK cell memory of pneumococcal infection. I found the experiments with the perforin KO less convincing. Why were the prf1 KO mice used as recipients in these experiments? Transfer of prf1 KO NK cells with a memory phenotype into WT mice might have been used to demonstrate that perforin production by memory cells was the basis of protection. Transfer into the prf1 KO leaves open the possibility that perforin production by non-memory cells might contribute to protection against pneumococcal infection. What was the trajectory/outcome of infection in the prf1 KO animals? Do they experience worse outcomes or harbour higher bacterial burdens than WT?

Reviewer #3: 1. The infection with SPN is intranasal, and the target organ for SPN is the lung. However, the authors used splenic NK cells for adoptive transfer experiments. Could similar results be obtained with NK cells from other organs, in particular lung?

2. Fig. 1: Do NK cells also respond to SPN + IL-15 alone (no IL-18)? How important is an inflammatory environment, mimicked by IL-18, for the NK cell response in presence of SPN?

3. Fig. 1: Do NK cells respond with a similar response if treated with another formaldehyde-inactivated bacterium?

4. Fig. 1: How do NK cells respond to live, noninactivated SPN?

5. SPN-mediated activation of myeloid cells has been shown to be TLR2- and TLR4-mediated. The authors should identify whether this is also true for memory NK cells. Is the recall response by NK cells altered if the respective receptors are blocked or knocked out?

6. The authors suggest that the memory NK cell response is specific to the first pathogen the mice have been infected with (SPN). It would be highly relevant to identify the reason for this specificity. Do NK cells depend the on the same PRRs for responding to SPN and to L. monocytogenes? Furthermore, the main target organs for SPN and L. monocytogenes differ (lung vs liver). Can the same ‘specific’ NK cell memory response as e.g. in Fig. 1 be confirmed if mice were infected with L. monocytogenes instead of SPN and NK cells re-stimulated with the same pathogen? This would reveal important information and confirm the authors’ statements concerning ‘specificity’ of the memory NK response.

7. The authors should extend the phenotypic characterization of the responding NK cells (vs non-responding NK cells), e.g. NK cell differentiation/maturation, Ki67. Since only bulk NK cells are compared, it may be that the differences are hidden when looking at this level which may be revealed when gating further down on NK cell subsets based on expression of Ly6C+, CD27low/neg, CD11b+ for example (Sun et al., Nature. 2009., Schuster et al., Immunity. 2023)

8. Fig. S1C: A significant difference for the MFI of Ly49D is not visually clear from the data and difficult to believe – the authors should both increase the number of experiments and provide representative plots/histograms in order to confirm their statement.

9. Fig. S2: The percentage of CD69+ NK cells in the lung seems overall rather low, and after 72h, it decreases even further. The authors should provide representative stainings for CD69 as well as data for CD69 expression before infection – does the frequency increase after 24h compared to before (mock-)infection, or is CD69 expression rather decreased for some reason at 72h and 21d? Furthermore, since higher percentages of CD69+ NK cells at 24h are even present in the PBS-control mice, it seems unlikely that this is an effect due to the infection. These data are confusing, and the authors must be careful with their conclusion of a low-level immune response. In relation to this, the authors should also reveal why granzyme B seems to increase in the control group (see also comment below).

10. Fig. 2 and S2: From Fig. S2, no clear granzyme B signal is detectable in comparison to the isotype control (the few ‘positive’ events are rather likely an effect by spillover from other channels since I assume that this was not a FMO ctrl?). While it might be possible that lung NK cells express less granzyme B, splenic NK cells were found to also express granzyme B according to Fig. 2D, which is not supported by the representative data in Fig. S2D. In particular at 21d, Fig. 2D shows a clear percentage of granzyme B-positive cells in lung and spleen, which is not confirmed by the representative overlays in Fig. S2D. This is confusing, and the authors need to present more reliable data to support their statements concerning granzyme B expression. In relation to this, the authors also need to present representative data for perforin expression at the different timepoints and groups in order to support their statements.

11. It is unclear why only splenic NK cells have been analyzed in their phenotype (Fig. S2). The authors should add analyses on NK cells from other organs, in particular the lungs.

12. Fig. 4A: It would be interesting to see whether the percentage of IFN-g+ NK cells further increases e.g. at 72h, or whether the peak of the response of D21SPN NK cells is reached earlier.

13. The number of experiments should be increased for several datasets throughout the manuscript. In general, more than just one experiment should be performed for each figure. It is also not entirely clear why the authors sometimes show the data as pooled experiments, and in other plots each individual mouse. This is confusing, and the paper would benefit from a more consistent data presentation.

14. The authors state that ‘transferred congenic CD45.2+ NK cells were circulating and detectable at similar percentages in lungs and blood, suggesting there is no preferential trafficking between D21PBS and D21SPN NK cells’. As the lungs are perfused extensively with blood, any differences in NK cell number/percentages could be completely diluted and therefore missed. The lungs could be flushed to clear the blood and then stained to determine NK cell numbers/ percentages. Alternatively, fluorescently labelled anti-CD45 could be given IV before analysis to show what is actually circulating and what may be resident in the parenchyma instead. Again, subset specification may also pull out more interesting results

15. Fig. 5D: The reduction of CXCL1 in the D21SPN NK cells indicates that this chemokine was e.g. consumed by cells infiltrating the lung, hence, this is not a clear indicator for the lack of NK cell infiltration. The authors should combine this analysis with the expression patterns of the respective chemokine receptors on NK cells.

16. Fig. 6: The authors here show a population of granzyme B+ as well as perforin+ NK cells. Does the phenotype differ to the respective negative NK population?

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: 1. Fig 2B appears to be from x1 experiment. Are these data representative from at least 2 repeats? If not, they should be repeated.

2. In figure legends (ex, Fig 1) it is unclear what "each dot represents a pool of mice" refers to. Is this meant to be pool of cells from one mouse?

3. Why is there high baseline granzyme B detected for 21 day NK cells (Fig 2D) vs other panels?

4. Fig 3B update legend to include 24 h.

5. Discussion pg 9, Fig 4C results update to reflect that there are reduced burdens in IFNGR-/- mice (line 214), don't see significantly reduced lung bacteria (line 217).

6. Methods are missing for GBS growth.

Reviewer #2: Pneumococcus is referred to throughout the manuscript as an extracellular pathogen. This is surely its primary lifestyle, but many studies have shown the ability of pneumococci to access intracellular compartments and demonstrated that intracellularity, whilst rare, can make important contributions to infection outcomes (see https://pubmed.ncbi.nlm.nih.gov/29662129/, https://pubmed.ncbi.nlm.nih.gov/33216805/). Some discussion could be added, regarding the possibility that NK cell memory might be mediating protection via targeting intracellular subpopulations of bacteria.

The authors describe bacterial sensing by NK cells as the mechanism behind the memory phenotype they observe. Indeed, the data they present supports some contribution from direct sensing mechanisms, but the possibility remains that the original cue for memory NK cell responses to develop in vivo requires other immune cells. Previous studies have suggested that inflammasome-driven macrophage responses can promote NK cell memory (https://pubmed.ncbi.nlm.nih.gov/27287410/), whilst others have shown the pneumococcal infection drives inflammasome responses that ultimately lead to an NK cell IFNg response in the lung (https://pubmed.ncbi.nlm.nih.gov/21085613/). Some discussion of these points in the context of the authors' own findings would be welcome.

A little extra clarity on the murine models is needed in places. What is the rationale behind the consecutive dosing, over two days, when performing infections? Does NK cell memory require this double dose? In Figure 3, was the dose 1x10^7 (line 167) or 5x10^6 (line 174)?

Line 112: Replace 'than' with 'as'.

Reviewer #3: 1. The response of NK cells is dependent on the SPN-serotype. Why did the authors select serotype 4 for their study, and is NK cell memory function detectable with other SPN serotypes? The authors should discuss this.

2. The authors should mention that the results are derived from a mouse model in the abstract.

3. When the authors write e.g. 2.105, I assume they mean 2x105? Please revise throughout the manuscript.

4. In line 158 the authors state that after 21 days post infection that immune cells are similar to uninfected controls ‘both in their number and activity’. No activity was measured. The authors should modify this sentence.

5. The authors repeatedly state that they isolate or stimulate ‘highly purified memory NK cells’, which is not the case. They are purifying bulk NK cells which probably contain memory NK cells to differing degrees. Therefore, although the NK cell population may be highly pure (they state >98% purity), this does not mean they are purifying memory cells. Purifying memory cells suggests they are identifying a distinct NK population and they are not. The authors should revise these statements.

6. In Fig. 5C and S4B, only a handful of innate cells are described. This is not exhaustive and does not include any adaptive cells, therefore their conclusion stating ‘protection provided by memory NK cells is not through enhanced recruitment or activation of inflammatory cells’ is over-interpreted. This sentence should be modified. For example, NK cells are known to recruit CD8+ T cells which were not quantified, neither were inflammatory monocytes which are common inflammatory cells recruited upon infection.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Sarah E Clark

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

PLoS Pathog. 2023 Jul 24;19(7):e1011159. doi: 10.1371/journal.ppat.1011159.r002

Author response to Decision Letter 0

5 Jun 2023

Attachment

Submitted filename: Reviews PPathogens_NKcells_FINAL.pdf

Click here for additional data file.^{(479.8KB, pdf)}

PLoS Pathog. doi: 10.1371/journal.ppat.1011159.r003

Decision Letter 1

Marcel A Behr, Rachel M McLoughlin

27 Jun 2023

Dear Dr. Hamon,

We are pleased to inform you that your manuscript 'Streptococcus pneumoniae drives specific and lasting Natural Killer cell memory' has been provisionally accepted for publication in PLOS Pathogens.

Before your manuscript can be formally accepted you will need to complete some minor corrections as requested by the reviewers below and also complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of formatting requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Rachel M McLoughlin, PhD

Academic Editor

PLOS Pathogens

Marcel Behr

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************************************************

Reviewer Comments (if any, and for reference):

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: The revised manuscript addresses all major concerns regarding expanding the comparison of lung versus splenic NK cells for the model system of protective memory NK cells and has increased rigor by including additional experimental replicates for several figures.

Reviewer #2: The authors have addressed my comments in full. Not all suggested experiments have been performed, and I am still not entirely convinced by the ChIP-qPCR data, but I accept the authors' arguments that the experiments are not ethically justifiable, given the large number of animals needed. I agree, also, that the weak effect is likely because bulk NK cells were used for the assays, rather than the memory cell subset.

Reviewer #3: All questions have been answered by the authors in a satisfactory way.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Reviewer #1: (No Response)

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: Please define MFI (mean vs median) used.

Reviewer #2: The response of the authors to my question about the NK cell adoptive transfer experiments adds very useful context, which I think readers of the article would benefit from. I realise the manuscript is already lengthy, but if there is scope to include Figure R2 in the Supplementary Information file and to include some of the explanatory text in the manuscript then I would encourage the authors to do so.

Line 369 - The k in NK cells requires capitalising

Reviewer #3: (No Response)

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

PLoS Pathog. doi: 10.1371/journal.ppat.1011159.r004

Acceptance letter

Marcel A Behr, Rachel M McLoughlin

20 Jul 2023

Dear Dr. Hamon,

We are delighted to inform you that your manuscript, "Streptococcus pneumoniae drives specific and lasting Natural Killer cell memory," has been formally accepted for publication in PLOS Pathogens.

We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Receptor expression profile of NK cells following S. pneumoniae infection.

(TIFF)

Click here for additional data file.^{(27.9MB, tiff)}

S2 Fig. Extended characterization of NK cell response to primary S. pneumoniae infection.

(TIFF)

Click here for additional data file.^{(27.9MB, tiff)}

S3 Fig. Measure of transferred NK cell circulation.

(TIFF)

Click here for additional data file.^{(27.9MB, tiff)}

S4 Fig. Impact of transferred memory NK cells in innate immune cell activation upon S. pneumoniae infection.

(TIFF)

Click here for additional data file.^{(27.9MB, tiff)}

S5 Fig. Granzyme B expression in memory NK cells.

(TIFF)

Click here for additional data file.^{(27.9MB, tiff)}

Attachment

Submitted filename: Reviews PPathogens_NKcells_FINAL.pdf

Click here for additional data file.^{(479.8KB, pdf)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[ppat.1011159.ref001] 1.Divangahi M, Aaby P, Khader SA, Barreiro LB, Bekkering S, Chavakis T, et al. Trained immunity, tolerance, priming and differentiation: distinct immunological processes. Nature Immunology. 2021;22:2–6. doi: 10.1038/s41590-020-00845-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref002] 2.Hamon MA, Quintin J. Innate immune memory in mammals. Seminars in Immunology. 2016;28:351–8. doi: 10.1016/j.smim.2016.05.003 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref003] 3.Saeed S, Quintin J, Kerstens HHD, Rao NA, Aghajanirefah A, Matarese F, et al. Epigenetic programming of monocyte-to-macrophage differentiation and trained innate immunity. Science. 2014;345(6204):1251086–10. doi: 10.1126/science.1251086 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref004] 4.Quintin J, Cheng SC, van der Meer JWM, Netea MG. Innate immune memory: Towards a better understanding of host defense mechanisms. Current Opinion in Immunology. 2014;29:1–7. doi: 10.1016/j.coi.2014.02.006 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref005] 5.Cerwenka A, Lanier LL. Natural killer cell memory in infection, inflammation and cancer. Nature Reviews Immunology. 2016;16:112–23. doi: 10.1038/nri.2015.9 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref006] 6.Geary CD, Sun JC. Memory responses of natural killer cells. Seminars in Immunology. 2017;31:11–9. doi: 10.1016/j.smim.2017.08.012 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref007] 7.O’Sullivan TE, Sun JC, Lanier LL. Natural Killer Cell Memory. Immunity. 2015;43:634–45. doi: 10.1016/j.immuni.2015.09.013 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref008] 8.Sun JC, Beilke JN, Lanier LL. Adaptive immune features of natural killer cells. Nature. 2009;457(7229):557–61. doi: 10.1038/nature07665 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref009] 9.Lopez-Vergès S, Milush JM, Schwartz BS, Pando MJ, Jarjoura J, York VA, et al. Expansion of a unique CD57 +NKG2C hi natural killer cell subset during acute human cytomegalovirus infection. PNAS. 2011;108(36):14725–32. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref010] 10.Azzi T, Lünemann A, Murer A, Ueda S, Béziat V, Malmberg KJ, et al. Role for early-differentiated natural killer cells in infectious mononucleosis. Blood. 2014;124(16):2533–43. doi: 10.1182/blood-2014-01-553024 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref011] 11.Littwitz-Salomon E, Nguyen T, Schimmer S, Dittmer U. Friend retrovirus infection induces the development of memory-like natural killer cells. Retrovirology. 2018;15(1). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref012] 12.Wijaya RS, Read SA, Truong NR, Han S, Chen D, Shahidipour H, et al. HBV vaccination and HBV infection induces HBV-specific natural killer cell memory. Gut. 2021;70(2):357–69. doi: 10.1136/gutjnl-2019-319252 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref013] 13.Theresine M, Patil ND, Zimmer J. Airway Natural Killer Cells and Bacteria in Health and Disease. Frontiers in Immunology. 2020;11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref014] 14.Spörri R, Joller N, Albers U, Hilbi H, Oxenius A. MyD88-Dependent IFN-γ Production by NK Cells Is Key for Control of Legionella pneumophila Infection. The Journal of Immunology. 2006;176(10):6162–71. [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref015] 15.Ivin M, Dumigan A, de Vasconcelos FN, Ebner F, Borroni M, Kavirayani A, et al. Natural killer cell-intrinsic type I IFN signaling controls Klebsiella pneumoniae growth during lung infection. PLoS Pathog. 2017;13(11). doi: 10.1371/journal.ppat.1006696 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref016] 16.Feng CG, Kaviratne M, Rothfuchs AG, Cheever A, Hieny S, Young HA, et al. NK Cell-Derived IFN-γ Differentially Regulates Innate Resistance and Neutrophil Response in T Cell-Deficient Hosts Infected with Mycobacterium tuberculosis. The Journal of Immunology. 2006;177(10):7086–93. [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref017] 17.Lai HC, Chang CJ, Lin CS, Wu TR, Hsu YJ, Wu TS, et al. NK Cell–Derived IFN-γ Protects against Nontuberculous Mycobacterial Lung Infection. The Journal of Immunology. 2018;201(5):1478–90. [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref018] 18.Wang D, Gu X, Liu X, Wei S, Wang B, Fang M. NK cells inhibit anti-Mycobacterium bovis BCG T cell responses and aggravate pulmonary inflammation in a direct lung infection mouse model. Cell Microbiol. 2018;20(7). [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref019] 19.Kerr AR, Kirkham LAS, Kadioglu A, Andrew PW, Garside P, Thompson H, et al. Identification of a detrimental role for NK cells in pneumococcal pneumonia and sepsis in immunocompromised hosts. Microbes Infect. 2005. May;7(5–6):845–52. doi: 10.1016/j.micinf.2005.02.011 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref020] 20.Christaki E, Diza E, Giamarellos-Bourboulis EJ, Papadopoulou N, Pistiki A, Droggiti DI, et al. NK and NKT cell depletion alters the outcome of experimental pneumococcal pneumonia: Relationship with regulation of interferon- γ production. J Immunol Res. 2015;2015. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref021] 21.Goldmann O, Chhatwal GS, Medina E. Contribution of Natural Killer Cells to the Pathogenesis of Septic Shock Induced by Streptococcus pyogenes in Mice. J Infect Dis. 2005;191:1280–6. doi: 10.1086/428501 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref022] 22.Dornand J, Lafont V, Oliaro J, Terraza A, Castaneda-Roldan E, Liautard JP. Impairment of Intramacrophagic Brucella suis Multiplication by Human Natural Killer Cells Through A Contact-Dependent Mechanism. Infect Immun. 2004. Apr;72(4):2303–11. doi: 10.1128/IAI.72.4.2303-2311.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref023] 23.Voskoboinik I, Whisstock JC, Trapani JA. Perforin and granzymes: Function, dysfunction and human pathology. Nature Reviews Immunology. 2015;15:388–400. doi: 10.1038/nri3839 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref024] 24.Gonzales CM, Williams CB, Calderon VE, Huante MB, Moen ST, Popov VL, et al. Antibacterial role for natural killer cells in host defense to Bacillus anthracis. Infect Immun. 2012. Jan;80(1):234–42. doi: 10.1128/IAI.05439-11 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref025] 25.Fernandes DM, Benson R, Baldwin CL. Lack of a Role for Natural Killer Cells in Early Control of Brucella abortus 2308 Infections in Mice. Infect Immun. 1995;63(10):4029–33. doi: 10.1128/iai.63.10.4029-4033.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref026] 26.Junqueira-Kipnis AP, Kipnis A, Jamieson A, Juarrero MG, Diefenbach A, Raulet DH, et al. NK Cells Respond to Pulmonary Infection with Mycobacterium tuberculosis, but Play a Minimal Role in Protection. The Journal of Immunology. 2003. Dec 1;171(11):6039–45. doi: 10.4049/jimmunol.171.11.6039 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref027] 27.Weiser JN, Ferreira DM, Paton JC. Streptococcus pneumoniae: Transmission, colonization and invasion. Nature Reviews Microbiology. 2018;16:355–67. doi: 10.1038/s41579-018-0001-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref028] 28.Kadioglu A, Weiser JN, Paton JC, Andrew PW. The role of Streptococcus pneumoniae virulence factors in host respiratory colonization and disease. Nature Reviews Microbiology. 2008;6:288–301. doi: 10.1038/nrmicro1871 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref029] 29.Bogaert D, de Groot R, Hermans PWM. Streptococcus pneumoniae colonisation: The key to pneumococcal disease. Lancet Infectious Diseases. 2004;4:144–54. doi: 10.1016/S1473-3099(04)00938-7 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref030] 30.Gillespie SH, Balakrishnan I. Pathogenesis of pneumococcal infection. Journal of Medical Microbioly. 2000;49:1057–67. doi: 10.1099/0022-1317-49-12-1057 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref031] 31.Baranek T, Morello E, Valayer A, Aimar RF, Bréa D, Henry C, et al. FHL2 regulates natural killer cell development and activation during Streptococcus pneumoniae infection. Front Immunol. 2017. Feb 13;8(123). doi: 10.3389/fimmu.2017.00123 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref032] 32.Elhaik-Goldman S, Kafka D, Yossef R, Hadad U, Elkabets M, Vallon-Eberhard A, et al. The natural cytotoxicity receptor 1 contribution to early clearance of Streptococcus pneumoniae and to natural killer-macrophage cross talk. PLoS One. 2011;6(8). doi: 10.1371/journal.pone.0023472 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref033] 33.Clark SE, Schmidt RL, Aguilera ER, Lenz LL. IL-10-producing NK cells exacerbate sublethal Streptococcus pneumoniae infection in the lung. Translational Research. 2020. Dec 1;226:70–82. doi: 10.1016/j.trsl.2020.07.001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref034] 34.Lau CM, Wiedmann GM, Sun JC. Epigenetic regulation of natural killer cell memory. Immunol Rev. 2022;305:90–110. doi: 10.1111/imr.13031 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref035] 35.Rasid O, Chevalier C, Camarasa TMN, Fitting C, Cavaillon JM, Hamon MA. H3K4me1 Supports Memory-like NK Cells Induced by Systemic Inflammation. Cell Rep. 2019. Dec 17;29(12):3933–3945.e3. doi: 10.1016/j.celrep.2019.11.043 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref036] 36.Habib S, El Andaloussi A, Hisham A, Ismail N. NK cell-mediated regulation of protective memory responses against intracellular ehrlichial pathogens. PLoS One. 2016. Apr 1;11(4). doi: 10.1371/journal.pone.0153223 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref037] 37.Kawahara M, Hasegawa N, Takaku H. Murine splenic natural killer cells do not develop immunological memory after re-encounter with Mycobacterium bovis BCG. PLoS One. 2016. Mar 1;11(3). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref038] 38.Venkatasubramanian S, Cheekatla S, Paidipally P, Tripathi D, Welch E, Tvinnereim AR, et al. IL-21-dependent expansion of memory-like NK cells enhances protective immune responses against Mycobacterium tuberculosis. Mucosal Immunol. 2017. Jul 1;10(4):1031–42. doi: 10.1038/mi.2016.105 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref039] 39.Kleinnijenhuis J, Quintin J, Preijers F, Joosten LAB, Jacobs C, Xavier RJ, et al. BCG-induced trained immunity in NK cells: Role for non-specific protection to infection. Clinical Immunology. 2014. Dec 1;155(2):213–9. doi: 10.1016/j.clim.2014.10.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref040] 40.Mody CH, Ogbomo H, Xiang RF, Kyei SK, Feehan D, Islam A, et al. Microbial killing by NK cells. Journal of Leukocyte Biology. 2019;105:1285–96. doi: 10.1002/JLB.MR0718-298R [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref041] 41.Fong JJ, Tsai CM, Saha S, Nizet V, Varki A, Buif JD. Siglec-7 engagement by GBS β-protein suppresses pyroptotic cell death of natural killer cells. Proc Natl Acad Sci U S A. 2018. Oct 9;115(41):10410–5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref042] 42.van den Boorn JG, Jakobs C, Hagen C, Renn M, Luiten RM, Melief CJM, et al. Inflammasome-Dependent Induction of Adaptive NK Cell Memory. Immunity. 2016. Jun 21;44(6):1406–21. doi: 10.1016/j.immuni.2016.05.008 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref043] 43.Sun JC, Madera S, Bezman NA, Beilke JN, Kaplan MH, Lanier LL. Proinflammatory cytokine signaling required for the generation of natural killer cell memory. Journal of Experimental Medicine. 2012. May 7;209(5):947–54. doi: 10.1084/jem.20111760 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref044] 44.Rölle A, Pollmann J, Ewen EM, Le VTK, Halenius A, Hengel H, et al. IL-12-producing monocytes and HLA-E control HCMV-driven NKG2C+ NK cell expansion. Journal of Clinical Investigation. 2014. Dec 1;124(12):5305–16. doi: 10.1172/JCI77440 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref045] 45.Cooper MA, Elliott JM, Keyel PA, Yang L, Carrero JA, Yokoyama WM. Cytokine-induced memory-like natural killer cells. PNAS. 2009;106(6):1915–9. doi: 10.1073/pnas.0813192106 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref046] 46.Chowdhury D, Lieberman J. Death by a thousand cuts: Granzyme pathways of programmed cell death. Annual Review of Immunology. 2008;26:389–420. doi: 10.1146/annurev.immunol.26.021607.090404 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref047] 47.Walch M, Dotiwala F, Mulik S, Thiery J, Kirchhausen T, Clayberger C, et al. Cytotoxic cells kill intracellular bacteria through granulysin-mediated delivery of granzymes. Cell. 2014. Jun 5;157(6):1309–23. doi: 10.1016/j.cell.2014.03.062 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref048] 48.Lu CC, Wu TS, Hsu YJ, Chang CJ, Lin CS, Chia JH, et al. NK cells kill mycobacteria directly by releasing perforin and granulysin. J Leukoc Biol. 2014. Dec;96(6):1119–29. doi: 10.1189/jlb.4A0713-363RR [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref049] 49.Li SS, Saleh M, Xiang RF, Ogbomo H, Stack D, Huston SH, et al. Natural killer cells kill Burkholderia cepacia complex via a contact-dependent and cytolytic mechanism. Int Immunol. 2019. Feb 19;31(6):385–96. doi: 10.1093/intimm/dxz016 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref050] 50.Feehan DD, Jamil K, Polyak MJ, Ogbomo H, Hasell M, Li SS, et al. Natural killer cells kill extracellular Pseudomonas aeruginosa using contact-dependent release of granzymes B and H. PLoS Pathog. 2022. Feb 1;18(2). doi: 10.1371/journal.ppat.1010325 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref051] 51.Esin S, Batoni G, Counoupas C, Stringaro A, Brancatisano FL, Colone M, et al. Direct binding of human NK cell natural cytotoxicity receptor NKp44 to the surfaces of mycobacteria and other bacteria. Infect Immun. 2008. Apr;76(4):1719–27. doi: 10.1128/IAI.00870-07 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref052] 52.Ercoli G, Fernandes VE, Chung WY, Wanford JJ, Thomson S, Bayliss CD, et al. Intracellular replication of Streptococcus pneumoniae inside splenic macrophages serves as a reservoir for septicaemia. Nat Microbiol. 2018. May 1;3(5):600–10. doi: 10.1038/s41564-018-0147-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref053] 53.Badgujar DC, Anil A, Green AE, Surve MV, Madhavan S, Beckett A, et al. Structural insights into loss of function of a pore forming toxin and its role in pneumococcal adaptation to an intracellular lifestyle. PLoS Pathog. 2020. Nov 20;16(11). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref054] 54.Shimasaki N, Jain A, Campana D. NK cells for cancer immunotherapy. Nature Reviews Drug Discovery. 2020;19:200–18. doi: 10.1038/s41573-019-0052-1 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref055] 55.Saleh M, Abdullah MR, Schulz C, Kohler T, Pribyl T, Jensch I, et al. Following in real time the impact of pneumococcal virulence factors in an acute mouse pneumonia model using bioluminescent bacteria. Journal of Visualized Experiments. 2014. Feb 23;(84). [DOI] [PMC free article] [PubMed] [Google Scholar]

[ppat.1011159.ref056] 56.Connor MG, Camarasa TMN, Patey E, Rasid O, Barrio L, Weight CM, et al. The histone demethylase KDM6B fine-tunes the host response to Streptococcus pneumoniae. Nat Microbiol. 2021. Feb 1;6(2):257–69. doi: 10.1038/s41564-020-00805-8 [DOI] [PubMed] [Google Scholar]

[ppat.1011159.ref057] 57.Stark AK, Okkenhaug K, Banham-Hall E. Acute Streptococcus pneumoniae lung infection: Mouse model and characterisation of the immune response. Protoc Exch. 2018. Sep 24; [Google Scholar]

[ppat.1011159.ref058] 58.Misharin A, Morales-Nebreda L, Mutlu G, Budinger G, Perlman H. Flow cytometric analysis of macrophages and dendritic cell subsets in the mouse lung. Am J Respir Cell Mol Biol. 2013;19(4)-503–510 doi: 10.1165/rcmb.2013-0086MA [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Streptococcus pneumoniae drives specific and lasting Natural Killer cell memory

Tiphaine M N Camarasa

Júlia Torné

Christine Chevalier

Orhan Rasid

Melanie A Hamon

Roles

Abstract

Author summary

Introduction

Results

NK cells acquire intrinsic memory features 21 days after in vivo infection

Fig 1. NK cells acquire intrinsic memory features 21 days after in vivo infection.

Sub-lethal infection with S. pneumoniae induces a rapid and transient immune response that returns to basal state before 21 days

Fig 2. Sub-lethal infection with S. pneumoniae induces a rapid and transient immune response that returns to basal state before 21 days.

Transferred memory NK cells protect mice from lethal S. pneumoniae infection for at least 12 weeks

Fig 3. Transferred memory NK cells protect mice from lethal S. pneumoniae infection for at least 12 weeks.

Protection of mice mediated by memory NK cells is IFNγ independent

Fig 4. Protection of mice mediated by memory NK cells is IFNγ independent.

Protection of mice is an intrinsic NK cell property

Fig 5. Protection of mice appears to be an intrinsic NK cell property.

Cytotoxic proteins are upregulated by memory NK cells and important for protection of mice

Fig 6. Cytotoxic proteins are upregulated by memory NK cells and important for protection of mice.

Discussion

Materials and methods

Ethics statement

Animal model

Bacterial inocula

Mouse infection

Sampling

NK cell purification and transfer

NK cell culture

Cell preparation for cytometry staining

ELISA

ChIP-qPCR assays

Primer sequences

Quantification and statistical analysis

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Marcel A Behr

Rachel M McLoughlin

Roles

Author response to Decision Letter 0

Decision Letter 1

Marcel A Behr

Rachel M McLoughlin

Roles

Acceptance letter

Marcel A Behr

Rachel M McLoughlin

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases