Irpex lacteus polysaccharide exhibits therapeutic potential for ovarian fibrosis in PCOS rats via the TGF-β1/smad pathway

Abstract

Polycystic ovarian syndrome (PCOS) is one of the commonest endocrinopathies in childbearing women. The research was conducted to assess the impact of Irpex lacteus polysaccharide (ILP, 1000 mg/kg) on the letrozole (1 mg/kg)-induced PCOS model in female rats. Metformin (Met, 265 mg/kg) as the positive control. The study suggested that ILP restored the estrous cycle in rats with PCOS as well as lowered relative ovarian weight and body weight, in comparison to normal. Rats with PCOS showed improvement in ovarian structure and fibrosis when given ILP. ILP decreased the testosterone (T), low-density lipoprotein cholesterol (LDL-C), triglyceride (TG), total cholesterol (TC), luteinizing hormone (LH), homeostasis model assessment-insulin resistance (HOMA-IR), fasting blood glucose (FBG), and insulin (INS) levels and elevated the follicle-stimulating hormone (FSH) and estrogen (E2) levels in PCOS rats. In addition, ILP increased the content of superoxide dismutase (SOD) in serum and the antioxidant enzymes (Prdx3, Sod1, Gsr, Gsta4, Mgst1, Gpx3, Sod2 and Cat) expression levels in the ovaries and decreased the serum expression of malondialdehyde (MDA). In addition, ILP treatment slowed down the process of the fibrosis-associated TGF-β1/Smad pathway and downregulated α-smooth muscle actin (α-SMA) and connective tissue growth factor (CTGF) levels in PCOS rats ovaries. According to these findings, ILP may be able to treat letrozole-induced PCOS in rats by ameliorating metabolic disturbances, sex hormone levels, oxidative stress, and ovarian fibrosis.

Graphical abstract

Highlights

• •Irpex lacteus polysaccharide regulates metabolic disorders in PCOS.
• •Monosaccharide composition and content of Irpex lacteus polysaccharide.
• •Antifibrotic effect of Irpex lacteus polysaccharide in PCOS.
• •Irpex lacteus polysaccharide has a good antioxidant capacity.

1. Introduction

Polycystic ovary syndrome (PCOS) is a prevalent gynecologic endocrine condition that is an important contributor to anovulatory infertility in women of fertile age. PCOS has a global incidence of 6%–10% [1], with China having a frequency of 5.6% [2]. Obesity, hirsutism, acne, diabetes, impaired glucose metabolism and insulin resistance (IR) are also in connection with PCOS [3]. Cardiovascular disease, endometrial cancer, and nonalcoholic fatty liver are more likely to occur [4,5], the precise causes of this complex of metabolic dysfunctions are still unknown. Published studies have suggested a possible association with abnormal hypothalamic-pituitary-ovarian axis (HPOA) function [6,7]. A decapeptide, gonadotrophin-releasing hormone (GnRH), plays an important role in controlling HPOA axis expression. The sub-hypothalamic nucleus releases GnRH in a pulsatile manner, which induces the release of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) from the anterior pituitary. FSH promotes the development of ovarian follicles, while LH controls ovulation and the production of luteal cells androgens. Boosted hypothalamic GnRH pulse frequency leads to the preferential secretion of LH by the pituitary gland, elevated levels of LH stimulate androgen synthesis in the ovary, and a relative FSH deficiency can result in follicular arrests, polycystic ovarian patterns, and oligoovulation or anovulation [8].

Fibrosis frequently takes place in the development of a chronic disease that has progressed to an advanced stage. In the absence of effective treatment, it may progress to severe scarring, which may exacerbate organic disease and potentially result in a functional decline or organ failure [9]. Fibrosis of the ovary is a major contributor to ovarian hypofunction and ovarian function decline. The ovaries of PCOS patients express abnormally high concentrations of transforming growth factor β1(TGF-β1). TGF-β1 has the ability to both promote the generation of extracellular matrix (ECM) proteins in mesenchymal cells and boost the creation of protease inhibitors which impede the enzymatic breakdown of the ECM. Finally, excessive ECM accumulation in PCOS patients' ovaries promotes ovarian interstitial fibrosis, endangering women's reproductive health and quality of life [10].

TGF-β1, one of the transforming growth factors, is the most important profibrotic factor, and the Smad protein is a primary intracellular effector of TGF-β1 signaling that causes fibrogenic effects [11]. TGF-β1 acts biologically by promoting downstream mediator activation such as Smad2 and Smad3, whereas Smad7 is the negative feedback regulator. TGF-β1 interacts with transforming growth factor β receptor II (TGF-βRII). TGF-βRII phosphoric transforming growth factor β receptor I (TGF-βRI), which phosphoric Smad2/Smad3 and forms a heterotrimeric complex with Smad4, translocated into the nucleus, acts on TGF-β1 target genes and regulates target gene transcription [4].

At present, PCOS is treated by adjusting the menstrual cycle, promoting conception, reducing the level of androgens in the body, increasing the sensitivity of the body to insulin, and in severe cases, surgical treatment and assisted reproduction techniques are used. Ovulation rates were significantly higher in patients treated with Western medicine alone, but some patients still experienced unavoidable miscarriages and reduced pregnancy rates [12], with side effects such as abdominal distention, visual disturbances, headache and nausea [13]. Metformin (Met) is one of the primary methods of ovulation induction for PCOS patients, which increases tissue cell sensitivity to insulin [14]. However, it can also cause diarrhea, and gastrointestinal disturbances, along with a multi-pregnancy and ovarian hyperstimulation risk, which may lead to an unsatisfactory outcome of the treatment [15,16].

In recent years, traditional Chinese medicinal and food plants have shown good therapeutic efficacy in the treatment of PCOS [17]. Dendrobium officinale polysaccharide [18], berberine [19], and puerarin [20] have performed well in the treatment of PCOS when it comes to the regulation of endocrine and metabolic disorders. Medicinal fungi are an important part of Chinese traditional medicine and they have various biological activities, such as antitumor, immunomodulatory, antioxidant, free radical scavenging, cardioprotective, and antiviral effects [21,22]. Polysaccharides are naturally occurring macromolecules found in plants, animals, algae, and microorganisms. Natural polysaccharides are abundant and have low toxicity and multiple bioactive like immunomodulatory, antioxidant, hypoglycaemic, anti-tumor and anti-fibrotic [23]. Irpex lacteus, a medicinal fungus, has polysaccharides as its significant bioactive components [24]. Irpex lacteus polysaccharide (ILP) has been shown to have an ameliorative effect on hepatic oxidative stress (OS) [25].

2. Materials and methods

2.1. Experimental materials

Irpex lacteus polysaccharide (ILP, purity >98%) was acquired by Xi'an Ruidi Biotechnology Co., Ltd. (Xi'an, China). Letrozole (CAS: 112809-51-5) was purchased from Shanghai Yuanye Biotechnology Co., Ltd. (Shanghai, China). Carboxymethyl cellulose (CMC, CAS:9004-32-4) was bought by Xilong Science Co., Ltd. (Shantou, China). Papanicolaou staining, Masson's trichrome reagents, and Hematoxylin and eosin (H&E) has been provided by Solarbio Technology Co., Ltd. (Beijing, China). Metformin (Met, CAS: 1115-70-4, purity >99%) has been acquired by Jiuding Chemical Technology Co., Ltd. (Shanghai, China). The bicinchoninic acid (BCA) assay kits, anti-TGF-β1 (AF0297), anti-CTGF (AF6582), anti-TGF-βRⅠ (AF8148), anti-p-Smad3 (AF1759), anti-Smad3 (AF1501), anti-p-Smad2 (AF2545), anti-Smad2 (AF1300), anti-Smad7 (AF8004), anti-Smad4 (AF1291) and were provided by Beyotime Biotechnology Co., Ltd. (Shanghai, China). Anti-α-SMA (GB11044) was provided by Servicebio Biotechnology Co., Ltd. (Wuhan, China). Anti-GAPDH (AF7021) has been purchased by Affinity Biological Research Center Co., Ltd. (Jiangsu, China). Low-density lipoprotein cholesterol (LDL-C, ADS-F-QT031), high-density lipoprotein cholesterol (HDL-C, ADS-F-QT033), total cholesterol (TC, ADS-W-ZF014), triglyceride (TG, ADS-W-ZF013), superoxide dismutase (SOD, ADS-W-KY011), and malondialdehyde (MDA, ADS-W-YH002) has been purchased by Aidisheng Biological Technology Co., Ltd. (Jiangsu, China). Testosterone (T, MM-0577R), insulin (INS, MM-0587R1), luteinizing hormone (LH, MM-0624R1), estrogen (E2, MM-0575R1), follicle-stimulating hormone (FSH, MM-70867R1) and ELISA kits have been provided by Jiangsu Meimian Industrial Co., Ltd. (Jiangsu, China).

2.2. The evaluation of ILP for fourier transform infrared spectroscopy (FTIR)

To verify the polysaccharide structure of ILP, it was assayed by FTIR. Weighed 150 mg of KBr and 4 mg of ILP into a mortar and mixed [26], ground to a smooth powder and pressed into thin slices using a tablet press. The IRPrestige–21 FTIR spectrometer (Shimadzu, Tokyo, Japan), was used to measure the absorbance in the 400 cm⁻¹ to 4000 cm⁻¹ range.

2.3. High-performance liquid chromatography (HPLC) for determining ILP

A sensitive Agilent 1260 HPLC system (Agilent Technologies Inc., Santa Clara, CA, USA) with Xbridge C18 Columns (Waters Corporation, Shanghai, China, 5 μm，4.6 × 150 mm) was employed to determine the monosaccharide composition by pre-column derivatization using 1-phenyl-3-methyl-5-pyrazolone (PMP) [27]. Standardization of monosaccharides with d-arabinose (Ara), fructose (Fru), d-xylose (Xyl), rhamnose (Rha), glucose (Glc), d-glucuronic acid (Glc-A), d-galacturonic acid (Gal-A), d-galactose (Gal), l-fucose (Fuc) and mannose (Man). Both ILP and the monosaccharides were derived from PMP. The mobile phase was a mixture of 83% phosphate-buffered saline (PBS, 0.02 M, pH 6.7) and 17% acetonitrile solution. The injection volume is 20 μL and the flow rate is regulated at 1 mL/min. At 30 °C, the separation outcome was measured at 245 nm.

2.4. Animal experimental design

Thirty-two female Sprague‒Dawley (SD) rats (6 weeks old, 180–220 g) were provided by Hunan Silaike Jingda Laboratory Animal Co., Ltd. (Changsha, China). An environment of standard conditions(25 ± 1 °C) was maintained for all rats with 12:12 h light/dark cycles. There was no restriction on access to water and food for any of the rats. Following 7 days of acclimating, the animals were randomized into 4 groups: Normal, PCOS, Met, and ILP groups. The gavage method was utilized for all animals, with the normal group receiving an equal volume of saline; the PCOS group receiving letrozole (1 mg/kg, dissolved in 1% CMC); the Met group were given both letrozole and Met (265 mg/kg) [28]; and the ILP group were given both letrozole and ILP (1000 mg/kg) [25]. Throughout the 21-day trial phase, rats were weighed every 3 days. Approval for this research was obtained from the Institutional Animal Care and Use Committee of Guilin Medical University (IACUC-GMU, approval number: GLMC-201803009).

2.5. Papanicolaou staining

All rats were examined for vaginal smears to assess their estrous cycle daily during the last 10 days. Rats were handled with a sterile cotton swab soaked in saline which was smeared clockwise on their vaginal walls. The swab was then smeared on a slide in the same direction. After drying at room temperature, they were fixed in 95% ethanol for 15 min and subsequently processed for Papanicolaou staining [29].

2.6. Serum and tissue sampling

The fasting blood glucose (FBG) level was measured after 12 h of overnight fasting. Blood, ovarian and periuterine adipocytes were collected after the rats were sacrificed. Following 30 min at room temperature, the blood was centrifuged for 15 min at 3000 rpm. Before analysis, serum and right ovaries were kept at −80 °C.

2.7. Histopathologic observation

Cleaned the left ovaries and periuterine adipocytes in saline and placed them in 10% formaldehyde for fixation. After embedding and sectioning (4 μm), take the tissue samples to H&E and Masson's reagents stained for histopathological examination. The morphological structure and degree of fibrosis of the ovaries were observed by a Leica DM4B microscope (Leica Microsystems Inc., Buffalo Grove, IL, USA). Adipocyte areas and the results of the Masson experiment were examined using the ImageJ software (NIH Image, Bethesda, MD, USA).

2.8. Biochemical assay for serum hormones

An enzyme-linked immunosorbent assay (ELISA) was used to measure the hormone levels of FSH, E2, LH, T and fasting INS in the serum. The ratio of LH/FSH and homeostasis model assessment-insulin resistance (HOMA-IR) level were calculated (HOMA-IR=FBG (mmol/L) × fasting INS (mU/L)/22.5) [30]. Serum levels of LDL-C, TC, TG, MDA, SOD and HDL-C were measured using biochemical kits.

2.9. Western blot analysis

The frozen ovaries were cut into 30 mg samples and washed with saline. They were blotted dry with filter paper and RIPA lysis solution was added, followed by homogenization in a tissue grinder. After 1 h on ice, the homogenate is centrifuged at 14,000 rpm for 15 min at 4 °C. After the aspiration of the upper clear layer, its protein concentration was measured by the BCA kit and adjusted to unity. Separate the protein with a 10%–12% SDS-PAGE and then transmitted it to PVDF membranes with a thickness of 0.45 μm. Blocking the membranes with 5% skimmed milk before being treated with an overnight period at 4 °C with the appropriate primary antibodies: TGF-β1 (1: 700), TGF-βRⅠ (1: 1000), Smad2 (1: 1500), p-Smad2 (1: 1500), Smad3 (1: 1500), p-Smad3 (1: 1000), Smad4 (1: 1500), Smad7 (1: 1000), CTGF (1: 1500), α-SMA (1: 7000), and GAPDH (1: 10,000). The next day, the PVDF membrane was conjugated for 1 h with horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG secondary antibody (1:20,000, EM35111-01, Beijing Emarbio Science & Technology Co. Ltd., Beijing, China) at room temperature. The blots were detected by the Fluor Chem system (Protein Simple, San Jose, CA, USA). Using ImageJ software (NIH Image, Bethesda, MD, USA) to analyze the optical density of the protein bands.

2.10. Immunohistochemical (IHC) staining

Sections (4 μm) [31] were subjected to an oven temperature of 65 °C for a duration of 30 min and then dewaxed in xylene. A solution of EDTA antigen retrieval(pH 9.0) was used to retrieve antigens for 20 min after rehydration (with alcohol) of the slides. The tissue sections were subjected to blocking using 10% goat serum at room temperature for a duration of 30 min, followed by incubation with primary antibodies for immunohistochemistry of Smad2, Smad3, Smad4, Smad7 and TGF-β1. HRP-conjugated goat anti-rabbit IgG secondary antibody was combined with the sections at a temperature of 37 °C for a duration of 30 min and then reacted with streptavidin. Next, DAB and hematoxylin staining, dehydrated in gradient alcohol and sealed with neutral resin was done. The expression of the above proteins was observed in the ovarian tissue by a Leica DM4B microscope (Leica Microsystems Inc., Buffalo Grove, IL, USA). Positive expression areas were analyzed with ImageJ software (NIH Image, Bethesda, MD, USA).

2.11. qRT‒PCR assay

TRIzol reagent (Tiangen Biotech Co., Ltd., Beijing, China) was used to obtain ovarian RNA. The mRNA levels of Sod1, Gpx3, Sod2, Gsta4, Cat, Prdx3, Gsr, and Mgst1 were measured by a Quant Studio 6 Flex Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) using an SYBR Green quantitative PCR kit (Tiangen Biotech Co., Ltd., Beijing, China). Based on the 2^-ΔΔCt method calculated relative mRNA content and regard GAPDH as a reference. Table 1 provides the primer sequences used in the reactions.

Table 1.

Primers sequences of Real-time PCR.

Gene	Sequence (5′–3′)	Sequence (3′–5′)
Sod1	CGGATAAGAGAGGATGTT	TAGTACGGCCAATGATGGAATG
Gpx3	GACATCCGCTGGAACTTTGA	CCATCTTGACGTTGCTGACT
Sod2	AGCGTGACTTTGGGTCTTT	AGCGACCTTGCTCCTTATTG
Gsta4	GCTGGAGTGGAGTTTGAAGA	GTCAGTAGCATCCCGTCTATTT
Cat	CAGAGGAAAGCGGTCAAGAA	CATTCTTAGGCTTCTGGGAGTT
Prdx3	GGATTCCCACTTCAGTCATCTT	AGTCTCGGGATATCTGCTTAGT
Gsr	ACCACGAGGAAGACGAAATG	ATCTCATCGCAGCCAATCC
Mgst1	CCACCTGAACGACCTTGAAA	CTGAAGTGAATGAGGGCTGTAG
GAPDH	GACATGCCGCCTGGAGAAAC	AGCCCAGGATGCCCTTTAGT

2.12. Statistical analysis

Statistics are processed with SPSS 26.0 software and shown as mean ± standard deviation (SD). One-way analysis of variance (ANOVA) and a Bonferroni test were applied to assay the statistical significance of the differences between groups. Statistically significant was defined as a p-value < 0.05. Graphs were plotted using GraphPad Prism 8.4.2. Positive expression area for Masson staining, adipocyte area, Western blot protein expression area and immunohistochemistry positive expression area were all measured using Image J.

3. Results

3.1. FTIR analyses of ILP

A stretching vibration of the O–H group at approximately 3375 cm⁻¹ and a stretching and bending vibration of the C–H group at approximately 2921 cm⁻¹ have been identified, respectively. The uronic acid-specific absorption peaks, which were seen at around 1643 cm⁻¹ and 1412 cm⁻¹, were in correspondence with carboxyl and carbonyl groups, respectively [32]. Peaks at 1361 cm⁻¹ and 1139 cm⁻¹ show that sulfate groups should be present [33]. The peaks at 1016 cm⁻¹ and 752 cm⁻¹ are characteristic bands from a galactose backbone. Moreover, there is an absorption peak between 1000 and 1200 cm⁻¹ resulting from the overlap of ring vibrations of C–O–C glycosidic band vibrations and C–OH side group stretching [34], indicating there is sugar in the form of pyranose [32]. There are α-type glycosidic bond types at 752 cm⁻¹ and 911 cm⁻¹ (Fig. 1A). The above results are consistent with those of Wang [26].

Fig. 1.

Structural analysis spectrum of ILP. (A) FTIR spectrum of ILP; (B) HPLC spectrum of ILP.

3.2. Monosaccharide composition analysis of ILP

The results of the monosaccharide composition of the ILP detected by HPLC are shown in Fig. 1B. The composition and proportions of ILP are shown in Table 2. These results indicate that the main monosaccharide component of ILP consists of Man, Glc-A, Glc, and Fuc, and Fuc was the most abundant. Small amounts of Ara, Gal, and Rha were detected.

Table 2.

The monosaccharide composition of ILP.

Composition (%)	Gal	Glc	D-GlcA	Rha	Man	Ara	Fuc
ILP	1.67	23.19	9.83	2.93	6.89	1.61	53.15

3.3. ILP treatment normalizes the estrous cycle of PCOS rats

The estrous cycle of rats was examined to establish the effectiveness of the PCOS model. Vaginal smears were performed and the cell morphology was observed by Papanicolaou staining to monitor the estrous cycle changes. Proestrus: mainly epithelial cells with a nucleus, and a few leukocytes and cornified cells; estrus: predominantly cornified cells with a few epithelial cells and leukocytes; metestrus: leukocytes, cornified cells, and nucleated epithelial cells were present; diestrus: mostly leukocytes (Fig. 2A). A disruption in the estrous cycle was observed in PCOS rats. In the PCOS group, rats spent a longer period in diestrus, but this disturbance was alleviated by ILP treatment (Fig. 2B).

Fig. 2.

Rats estrous cycle image. (A) Graph of Papanicolaou staining of cells ( × 100). (B) Estrous cycle recording curves.

3.4. Effect of ILP on body weight and ovarian weight in PCOS rats

The initial body weight of the groups did not differ significantly (Fig. 3A), but the PCOS rats put on weight rapidly during the modeling period (Fig. 3C). The PCOS rats' final body weighed 18.70% (p < 0.05) heavier than the normal rats (Fig. 3B), and the relative weight of the ovaries was 24.14% (p < 0.05) heavier than that of the normal group (Fig. 3D). ILP and Met reduced rats' body weight by 5.98% and 13.59%, respectively (p < 0.05). ILP also reduced the relative weight of the rat ovaries by 14.35% (p < 0.05); Met also decreased the relative weight of the rat ovaries, but not significantly.

Fig. 3.

Met and ILP effects on body weight and relative ovary weight. (A) Initial body weight; (B) final body weight; (C) body weight curves; (D) relative weight of ovary (n = 8). Versus the Normal group, ∗p < 0.05 and ∗∗p < 0.01; versus the PCOS group, #p < 0.05 and ##p < 0.01. Statistics are the mean ± SD.

3.5. ILP reverses histomorphological changes in PCOS rats ovaries

The pale color of ovaries was observed in the PCOS rats, while their size and weight also increased. And a pale uterus and insufficient blood supply were present. ILP effectively improved the blood supply to the ovaries and uterus (Fig. 4C). Light microscopic observation of the H&E staining revealed that normal rats had multiple corpus luteum and developing in different stages follicles. The PCOS rats showed polycystic-like changes in the ovaries, with an increased cystic follicle count and decreased corpus luteum (Fig. 4A). Furthermore, fibrosis was also found in the ovaries of PCOS rats according to Masson staining results. After treatment with Met and ILP, rats with PCOS experienced reduced ovarian fibrosis (Fig. 4B, D).

Fig. 4.

Morphological effects of ovary and uterus and ovarian fibrosis. (A) Ovarian H&E staining (scale bar = 400 μm; the amplified area is defined by the black rectangle, high magnification scale bar = 200 μm), CL: corpus luteum, CF: cystic follicle; (B) Ovarian tissue stained with Masson (scale bar = 400 μm; the amplified area is defined by the black rectangle, high magnification scale bar = 200 μm); (C) Image of the uterus and ovaries; (D) positive of ovarian fibrosis.

3.6. ILP treatment normalizes sex hormone levels in PCOS rats

Since letrozole is an aromatase inhibitor that raises androgens levels by inhibiting the activity of aromatase. The PCOS rats dramatically raised LH, LH/FSH and T levels by 23.55%, 31.02%, and 51.25% (p < 0.05), respectively, versus the normal rats (Fig. 5A, C, D). However, the E2 and FSH levels were markedly reduced by 23.14% and 34.64% (p < 0.05) (Fig. 5B, E). ILP significantly reduced the T levels by 21.44% and the LH levels by 18.66% (p < 0.05) and raised the E2 levels by 23.14% (p < 0.05). Met decreased the T and LH levels by 25.98% and 22.87% (p < 0.05), respectively, and raised the E2 levels by 21.52% (p < 0.05). Both ILP and Met had an insignificant effect on the FSH and LH/FSH levels.

Fig. 5.

The levels of (A) LH, (B) FSH, (C) LH/FSH, (D) T, and (E) E2 in the serum of rats (n = 8). Versus the Normal group, ∗p < 0.05 and ∗∗p < 0.01; versus the PCOS group, #p < 0.05 and ##p < 0.01. Statistics are the mean ± SD.

3.7. ILP improves glucolipid metabolism levels in PCOS rats

PCOS patients may also have insulin resistance (IR), impaired glucose metabolism, dyslipidemia and abdominal obesity. The FBG and INS levels of PCOS rats were 12.09% and 29.87% more than the normal rats respectively (p < 0.05), and the HOMA-IR was similarly increased by 34.09% (p < 0.05) (Fig. 6A–C). With ILP and Met treatments, FBG levels declined by 11.62% and 17.47% (p < 0.05), INS levels by 17.47% and 19.37% (p < 0.05), and HOMA-IR by 20.15% and 19.77% (p < 0.05), respectively. LDL-C, TC and TG, which reflect the level of lipid metabolism, were also significantly elevated in the PCOS rat versus the normal rat by 50%, 44.68%, and 1.82 times (p < 0.05), respectively. And the HDL-C levels were lessened by 39.24% (p < 0.05). The ILP and Met interventions both reduced TC levels by 17.84% (p < 0.05), TG levels by 23.53% and 16.18% (p < 0.05), and LDL-C levels by 42.99% and 30.84% (p < 0.05), respectively. At the same time, HDL-C levels increased by 29.17% and 47.92% (p < 0.05) (Fig. 7A–D). As determined by the H&E staining (Fig. 7E), PCOS rats have bigger peri-uterine adipocytes than ILP rats (Fig. 7F). All of the above indicates that ILP may be able to treat the problems of glucolipid metabolism in PCOS rats.

Fig. 6.

(A) FBG, (B) INS, (C) and HOMA-IR levels of rats (n = 8). Versus the Normal group, ∗p < 0.05 and ∗∗p < 0.01; versus the PCOS group, #p < 0.05 and ##p < 0.01. Statistics are the mean ± SD.

Fig. 7.

(A) HDL-C, (B) LDL-C, (C) TG, (D) TC levels in the serum of rats, (E) image of periuterine adipocytes, (F) and adipocyte area of rats (n = 8). Versus the Normal group, ∗p < 0.05 and ∗∗p < 0.01; versus the PCOS group, #p < 0.05 and ##p < 0.01. Statistics are the mean ± SD.

3.8. ILP reduces PCOS rat oxidative stress

OS affects PCOS etiology, contributing to IR, androgen excess, and chronic inflammation. There is a tendency for PCOS women to have abnormal OS biomarkers [35]. In our experiments, we measured rats' serum levels of SOD and MDA. The SOD levels were markedly lowered by 6.16% (p < 0.05) while MDA levels were raised by 78.32% (p < 0.01) in PCOS rats. ILP and Met increased SOD levels by 7.32% and 6.43% (p < 0.05) and decreased MDA levels by 32.16% and 37.65% (p < 0.01) in PCOS rats, respectively (Fig. 8A and B). For the purpose of further research on the impact on OS in PCOS of ILP, we also measured the levels of some antioxidant enzymes (Sod1, Gpx3, Cat, Prdx3, Gsta4, Sod2, Mgst1 and Gsr) in ovarian tissues. The results showed that the levels of Sod1, Gpx3, Sod2, Gsta4, Cat, Prdx3, Gsr and Mgst1 were dramatically decreased by 40%, 80%, 59%, 32%, 58%, 64%, 63% and 31% (p < 0.05) in PCOS group. The levels of Sod1, Gpx3, Sod2, Gsta4, Cat, Prdx3, Gsr and Mgst1 were increased by 48.33%, 1.15 times, 1 time, 1.51 times, 1.90 times, 88.89%, 1.73 times and 89.86% (p < 0.05) in ILP group, respectively. The Sod1, Gpx3, Sod2, Gsta4, Cat, Prdx3, Gsr and Mgst1 levels in the ovaries of Met group rats were elevated by 53.33%, 1.25 times, 80.49%, 53.62%, 1.43 times, 41.67%, 1.27 times and 53.62% (p < 0.01), respectively (Fig. 8C–J). Based on the above evidence, PCOS rats achieved a greater antioxidant capacity and experienced reduced OS with ILP and Met supplementation.

Fig. 8.

The levels of (A) SOD, (B) MDA, (C) Sod1, (D) Gpx3, (E) Sod2, (F) Gsta4, (G) Cat, (H) Prdx3, (I) Gsr, (J) and Mgst1 of rats (n = 8). Versus the Normal group, ∗p < 0.05 and ∗∗p < 0.01; versus the PCOS group, #p < 0.05 and ##p < 0.01. Statistics are the mean ± SD.

3.9. Affect of ILP on TGF-β1/smad pathway protein expression

PCOS patients often have interstitial ovarian fibrosis, which has been studied in association with an abnormal increase in TGF-β1 expression. In order to determine whether ILP has any effect on PCOS rats' ovarian fibrosis, we investigated the classical TGF-β1/Smad pathway. By analysis, the protein expression of p-Smad2, p-smad3, TGF-β1, TGF-βRⅠ, and Smad4 were higher than normal group by 48.99%, 33.26%, 1.54 times, 70.99%, and 63.03% (p < 0.01), respectively (Fig. 9A–F), while smad7 expression adjusted downwards by 27.38% (p < 0.05) (Fig. 9A, G). The expression of p-Smad2, p-Smad3, TGF-β1, TGF-βRI, and Smad4 in the ILP and Met groups were less than PCOS group by 37.05% and 23.90% (p < 0.01), 50.51% and 36.63% (p < 0.01), 64.09% and 24.80% (p < 0.01), 38.10% and 23.60% (p < 0.01), and 22.26% and 33.96% (p < 0.01), respectively. The smad7 protein expression was upregulated by 69.84% (p < 0.01) and 49.15% (p < 0.05) in the Met and ILP rats, respectively, in comparison with the PCOS rats. Moreover, α-smooth muscle actin (α-SMA) and connective tissue growth factor (CTGF) expression in the ovaries of PCOS rats were also greatly more positive than normal rats by 4.37 times (p < 0.01) and 25.19% (p < 0.05), respectively. In the ILP and Met groups, CTGF and α-SMA expression levels were reduced by 56.32% and 75.27% (p < 0.01) and 42.88% and 22.03% (p < 0.01) respectively (Fig. 9A, H–I).

Fig. 9.

Protein expressions in the rats' ovarian. Western blot of (A) TGF-β1, TGF-βRI, p-Smad2, p-Smad3, Smad4, Smad7, CTGF, α-SMA, and GAPDH. Quantitative analysis of (B) TGF-β1, (C) TGF-βRI, (D) p-Smad2, (E) p-Smad3, (F) Smad4, (G) Smad7, (H) CTGF, and (I) α-SMA in the ovary (n = 3). Versus the Normal group, ∗p < 0.05 and ∗∗p < 0.01; versus the PCOS group, #p < 0.05 and ##p < 0.01. Statistics are the mean ± SD.

3.10. IHC staining for ILP treatment in rat ovarian fibrosis

Immunocytochemistry (IHC) staining of ovarian tissue sections showed the same results as the western blots. The area of positive expression of Smad4, Smad3, Smad2 and TGF-β1 in PCOS rats was increased by 85.63%, 69.32%, 87.32% and 1.86 times, respectively (p < 0.01), comparison with the normal rats, while Smad7 was declined by 53.48% (p < 0.01) (Fig. 10A–J). Smad4, Smad3, Smad2, and TGF-β1 positive expression areas in the ILP and Met groups decreased by 50.45% and 54.12% (p < 0.01), 55.79% and 48.03% (p < 0.01), 37.03% and 31.27% (p < 0.01), 52.04% and 54.16% (p < 0.01), whereas the Smad7 area elevated by 73.06% and 63.69% (p < 0.01), respectively.

Fig. 10.

Area of positive TGF-β1, Smad2, Smad3, Smad4, and Smad7 expression in the rats ovaries. The figures illustrate the immunohistochemistry profiles of (A) TGF-β1, (B) Smad2, (C) Smad3, (D) Smad4, (E) and Smad7 proteins in the ovary. (scale bar = 100 μm; the amplified area is defined by the black rectangle, high magnification scale bar = 50 μm). The positive of (F) TGF-β1, (G) Smad2, (H) Smad3, (I) Smad4, (J) and Smad7 in the ovary (n = 3). Versus the Normal group, ∗p < 0.05 and ∗∗p < 0.01; versus the PCOS group, #p < 0.05 and ##p < 0.01. Statistics are the mean ± SD.

4. Discussion

The imbalance of the hypothalamic-pituitary-ovarian axis (HPOA) is an important pathophysiological basis of PCOS. And in the development of PCOS, hyperactivity of GnRH neurons in the hypothalamus plays a critical role [36]. In PCOS patients, excessive androgens in the ovaries make the GnRH pulse generator insensitive to negative feedback inhibition, causing a sustained increase in pulse frequency, which increases LH excretion and restricts FSH excretion. An increased frequency of GnRH pulses promotes LH synthesis, contributing to the abnormal production of sex hormones and the dysfunction of the ovary [37]. High pulse release of LH causes follicular membrane cells to enhance the expression of the cytochrome P450c17 (CYP17), steroidogenic acute regulatory protein (StAR) and 3β-hydroxysteroid dehydrogenase (3β-HSD), which increases the steroidogenic activity of follicular membrane cells, leading to androstenedione production [38]. Then, under the influence of FSH in the pituitary gland, the aromatase in granulosa cells converts androstenedione into estrogen. However, the relative lack of FSH secretion impairs and hinders follicular development, leading to hyperandrogenemia among PCOS women [39]. In our experiments, we found that PCOS rats had abnormal levels of sex hormones. The LH, T and LH/FSH levels were raised, and FSH and E2 levels were declined in PCOS rats. This is because the letrozole used in our modeling is an aromatase inhibitor. Aromatase is the final rate-limiting enzyme in the transformation from androgens to estrogens. A decline in its activity can cause a hyperandrogenic environment in the body, which leads to elevated levels of T in PCOS rats [40]. There is increasing evidence that high levels of T may lead to an abnormal frequency of GnRH release, resulting in more LH production by the hypophysis [41], thus increasing the LH/FSH [42]. LH/FSH is an important marker for assessing the function of the ovaries and aiding in the diagnosis of PCOS [43]. A rise in LH/FSH ratio is more often due to the development of LH levels rather than a decline in the levels of FSH [44]. In addition, GnRH also affects the secretion of FSH, which stimulates follicular growth and E2 synthesis [45]. The increased frequency of GnRH stimulation favors LH production to the detriment of FSH [46]. This explains the elevation of T caused by letrozole inhibiting the transformation of androgens into estrogens in our experiments. This contributes to an abnormally high frequency of GnRH pulses, which drives more LH secretion and inhibits FSH synthesis. Moreover, it also prevents normal follicle growth and reduces E2 synthesis, which ultimately leads to ovulation disorders. In our study, ILP and Met normalized the sex hormone levels, reduced LH and T secretion, and decreased the LH/FSH in PCOS rats. They also promoted the FSH and E2 synthesis (Fig. 5A–E), contributing to follicles in different developmental stages with multiple corpus luteum while restoring the histological morphology of the ovary (Fig. 4A).

Previous studies have also revealed that androgen excess is often strongly associated with metabolic disorders, especially for PCOS [47]. Chronic androgen excess may cause patients with PCOS to develop abdominal obesity. Abdominal obesity is related to impaired androgen homeostasis and the overactivity of the hypothalamic-pituitary-adrenal (HPA) axis [48]. In the initial phase, the initial body weight of the groups did not differ significantly. The PCOS rats gained weight significantly, both ILP and Met were effective in slowing down their rate of weight gain (Fig. 3A, B, D). In this study, the significant weight gain in PCOS rats was related to their abnormally elevated levels of T. In addition, their increase in relative ovarian weight was due to ovarian lipid accumulation and follicular fluid accumulation in cystic follicles [49] (Fig. 3C). The LDL-C, TC, and TG levels were raised, while the HDL-C levels were lessened in PCOS rats. Both ILP and Met treatments improved these parameters, and it can be seen that ILP had a superior treatment effect compared to Met (Fig. 7A–D). It was further observed that PCOS rats had a larger adipocyte area, which was reduced after treatment with ILP and Met (Fig. 7E). There is increasing evidence that excessive androgen secretion can contribute to adipogenesis and that lipid metabolism is disturbed in PCOS, contributing to obesity. The above results indicate that ILP can effectively inhibit fat formation and it has good lipid-lowering potential.

Furthermore, androgen excess is often related to IR in obese women, especially those with PCOS [50]. Excess androgens have a positive correlation between HOMA-IR and insulin levels [51,52]. It is common for PCOS patients to experience IR, leading to an overproduction of androgens, which reduces the release of sex hormone-binding globulin (SHBG) [53]. Insulin is a crucial hormone involved in glucose metabolism, and its sensitivity is closely related to the normal uptake and metabolism of glucose [54]. IR is regarded as a deficiency in regulating glucose metabolism in tissues mediated by insulin (mainly liver, fat and muscle). Recent research has revealed that adipose tissue contributes to developing IR, possibly through the delivery of lipids and other circulating factors that promote IR [55]. This evidence suggests that both androgens and obesity are tightly linked to IR, and our study confirms this. PCOS rats had higher FBG and INS because IR makes insulin less efficient in promoting glucose uptake and utilization, and the body compensates by secreting too much insulin. Their HOMA-IR values, an index for assessing IR levels, were also significantly higher (Fig. 6A–C), which may be caused by weight gain in PCOS rats. There was a marked downward trend in FBG, INS, and HOMA-IR levels with ILP and Met, and we infer that the reduced T levels in the above two treatment groups of rats may be related to the improvement of IR.

A further feature of PCOS is an increase in OS, such as intracellular reactive oxygen species (ROS), which is an essential pathway contributing to the disease's onset and progression [56]. Metabolic disturbances in PCOS produce more free radicals, leading to OS [57]. OS is the result of ROS and antioxidants are out of balance [58,59]. Some features of PCOS, such as an excess of androgens, IR, and obesity, may promote the progress of OS [60]. Adipose tissue expansion, such as obesity, is caused by adipocyte hypertrophy and subsequent hypoxic conditions that lead to OS and increased autophagy [61]. The abnormal metabolism of PCOS is partly because of the reaction of free radicals with lipids and peroxides generated during mitochondrial oxidation to produce MDA [62]. MDA is a lipid peroxidation product, it reflects the degree of oxidative damage in the body. SOD is a major antioxidant enzyme that has a significant impact on retaining the dynamic balance of oxidation-antioxidation and its level is an indicator of antioxidant capacity. Wang [25] demonstrated that ILP increased liver SOD levels and reduced MDA levels, indicating that it has some antioxidant activity. The study revealed that SOD levels were obviously lower in the serum of PCOS rats, while MDA levels presented much higher than normal (Fig. 8A and B). This indicates rats with PCOS exhibit an increased level of OS. As mentioned earlier, PCOS rats were heavier and had a larger adipocyte area, which is also due to the more severe OS. The above results showed that ILP was able to reduce the damage caused by OS in PCOS rats. To further investigate the antioxidant capacity of ILP, we examined the levels of some antioxidant enzymes (Sod1, Gpx3, Gsta4, Sod2, Cat, Prdx3, Mgst1and Gsr) in rat ovaries. According to this study, ILP was found to enhance these antioxidant enzyme expressions (Fig. 8C–J). These results indicate that ILP has a good antioxidant capacity and can ameliorate OS in PCOS rats.

There has been evidence in recent research that ovarian fibrosis has been observed in rats with androgen-induced PCOS, which may impair ovarian function [63]. The overproduction of androgens may disrupt the balance of matrix metalloproteinases-9 (MMP-9), MMP-2, and tissue inhibitors of metalloproteinase-1 (TIMP-1), TIMP-2 in the ovary, resulting in ovarian fibrosis in PCOS women [9]. According to research, obesity and IR are significantly and positively associated with cystic follicles, ovarian function, OS, and fibrosis [64]. In this experiment, Masson's staining revealed a notable growth in the percentage of collagen fiber area in PCOS rats' ovaries, indicating a higher deposition of fibrous tissue (Fig. 4B, D). Ovarian fibrosis may be due to the granulosa cells degenerate which leads to the proliferation of mesenchymal fibroblasts as well as the deposition of fibrin and collagen. Abnormal expression of ECM, CTGF, and profibrotic proteins TGF-β1 may be a contributor to fibrosis [65]. A downstream mediator like Smad2 and Smad3 is revitalized by TGF-β1 to exert its biological effects, while Smad7 exerts a negative regulatory effect on the pathways activated by TGF-β1. TGF-β1 interacts with TGF-βRⅡ to activate TGF-βRⅠ and then it phosphoric Smad2/Smad3, which generates a trimeric complex with Smad4 [66,67]. Subsequently, TGF-β1/Smad complex may promote CTGF and α-SMA, transcription in the nucleus [63]. According to prior research, the TGF-β1/Smad mechanism is a critical part of the pathogenesis in organ fibrosis [[68], [69], [70]]. Fig. 9A–G illustrates the manifestation in PCOS rat ovaries of TGF-β1, TGF-βRⅠ, p-Smad2/Smad2, p-Smad3/Smad3, and Smad4 were increased clearly, and the Smad7 expression level was noticeably reduced, compared to normal rats. This revealed the TGF-β1/Smad is activated and involved in the development of fibrosis. According to IHC, there was more substantial growth than normal rats in the area of positive TGF-β1, Smad2, Smad3, and Smad4 in ovarian sections from PCOS rats, while the area of positive Smad7 noticeably declined (Fig. 10A–J).

CTGF is a downstream factor induced by TGF-β1. It is involved in mediating some of the profibrotic effects of TGF-β1, such as increasing the synthesis and accumulation of ECM [71]. TGF-β1 enhances the ability of lymphocytes, neutrophils, and monocytes to secrete CTGF. CTGF, which is induced by TGF-β1, acts paracrine on mesenchymal fibroblasts, thereby stimulating the production of TGF-β1 [63]. These two factors interact with each other to accelerate the development of fibrosis. A marker of myofibroblasts, α-SMA is a critical part of the development of fibrosis and has been considered a marker of tissue fibrogenic activity [72]. Meanwhile, the activation of CTGF and α-SMA was also observed in our experiments (Fig. 9A, H, I). ILP and Met both inhibited the induction of the TGF-β1/Smad path and attenuated ovarian tissue fibrosis.

5. Conclusion

Overall, we found that ILP improved the histological changes, sex hormone homeostasis, disorders of glucolipid metabolism, and OS in PCOS rats. It reversed the symptoms of PCOS by modulating TGF-β1/Smad pathway to ameliorate the fibrosis in rats' ovaries. These findings could serve as a foundation for clinical studies of ILP for treating PCOS, that is, ILP may provide an alternative treatment to PCOS by acting as an antioxidant. If the combination of ILP and metformin might show a better therapeutic effect, the interaction between the combination of Chinese and Western drugs deserves further consideration.

Author contribution statement

Yan-Yuan Zhou: Conceived and designed the experiments; Wrote the paper.

Ya-Qi Wu: Performed the experiments; Analyzed and interpreted the data; Wrote the paper.

Chao-Jie Chong: Performed the experiments; Analyzed and interpreted the data.

Shu-Mei Zhong; Zi-Xian Wang; Xiao-Hui Qin; Zhi-Qiang Liu; Jun-Yang Liu: Performed the experiments.

Jia-Le Song: Conceived and designed the experiments; Contributed reagents, materials, analysis tools or data.

Data availability statement

Data will be made available on request.

Funding

The authors gratefully acknowledge the financial support by the National Natural Science Foundation of China (81560530, 81760589, 81860767, 81960590, 82273630), the Special Funds for Guiding Local Scientific and Technological Development by the Central Government (Guike ZY22096025), the Guangxi Natural Science Foundation of China (2020GXNSFAA159160, 2022GXNSFAA035603), the Foundation for University Key Teachers by the Department of Education of Guangxi Zhuang Autonomous Region (Guirengjiao[2018]18), the Funding Scheme for High-level Overseas Chinese Students’ Return of Ministry of Human Resources and Social Security (Renshetinghan[2019]160), Guangxi Medical and Health Key Cultivation Discipline Construction Project(Guiweikejiaofa[2022]4) and the Start-up Fund for the introduction of talents and scientific research of Guilin Medical University(04010150001).

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A. Supplementary data

The following is the Supplementary data to this article.