Skip to main content
Annals of Clinical Microbiology and Antimicrobials logoLink to Annals of Clinical Microbiology and Antimicrobials
. 2023 Aug 7;22:68. doi: 10.1186/s12941-023-00621-y

Prevalence, antimicrobial resistance, and enterotoxin gene profiles of Staphylococcus aureus isolated from mobile phones of the food vendors in Phayao province, Thailand

Krissana Khoothiam 1, Watsawan Prapasawat 2, Atchariya Yosboonruang 1, Anchalee Rawangkan 1, Chorpaka Phuangsri 1, Kitwadee Rupprom 3, Parinya Kraivuttinun 4, Wimonrat Tanomsridachchai 2, Orasa Suthienkul 5, Achiraya Siriphap 1,
PMCID: PMC10408101  PMID: 37550710

Abstract

Background

Mobile phones are widely used and may cause bacterial pathogens to spread among various professionals. Staphylococcus aureus from the mobile phones can contaminate the hands of food vendors and food during the cooking or packaging process. This research aimed to determine the prevalence, enterotoxin genes, and antimicrobial resistance (AMR) profiles of S. aureus contaminating the vendors’ mobile phones.

Methods

In this study, 266 mobile phone samples were randomly collected from food vendors selling food on walking streets (n = 139) and in food centers (n = 127) in Phayao province. All samples were identified as S. aureus by the conventional culture method and confirmed species-specific gene by polymerase chain reaction (PCR). Then, all identified S. aureus isolates were tested for antimicrobial susceptibility by broth microdilution method and for the presence of staphylococcal enterotoxin (SE) genes by PCR.

Results

The results showed that 12.8% of the mobile phones collected were contaminated with S. aureus. Of 49 S. aureus isolates obtained, 30 (61.2%) were positive for SE genes. The most common SE gene was sea followed by sec, seb, sem, seq, and sel. Moreover, S. aureus was most frequently resistant to penicillin, followed by chloramphenicol and tetracycline, erythromycin, clindamycin, and gentamicin. Methicillin-resistant S. aureus (MRSA), vancomycin-resistant S. aureus (VRSA), and multidrug-resistant (MDR) strains were also detected.

Conclusions

This study showed that mobile phones were an intermediate surface for the transmission of S. aureus, including MDR variants. It indicates that hand hygiene and the decontamination of mobile phones are essential to prevent cross-contamination of S. aureus in food settings.

Keywords: Staphylococcus aureus, Mobile phone, Food vendor, Antimicrobial resistance, Staphylococcal enterotoxin

Introduction

Mobile phones have become one of the most important accessories in both professional and social life. Although they are handy and convenient for communication, mobile phones may pose a health risk due to the presence of thousands of microorganisms on their surface [1]. Many previous reports have revealed that mobile phones may be contaminated with pathogenic bacteria and nosocomial pathogens including Staphylococcus aureus and MRSA [2]. Pathogenic bacteria, including MDR strains, have been detected on the mobile phones of hospital personnel in many countries, with S. aureus being the most common, followed by MRSA, S. epidermidis, and other Gram-negative pathogens [2]. Antimicrobial-resistant S. aureus, including MRSA, has also been reported to contaminate the mobile phones of medical personnel in Thailand [3]. Previous studies indicated that S. aureus may play a significant role in causing food poisoning outbreaks [4, 22].

S. aureus is a pathogenic bacterium and major cause of food poisoning worldwide, including in Thailand [5, 22]. S. aureus present in food can multiply and produce enterotoxins. The consumption of foods containing staphylococcal enterotoxins (SEs) may cause food poisoning. Although S. aureus is killed by heat during cooking, SEs are heat-stable and not easily destroyed. There are 23 types of SEs and staphylococcal-like enterotoxins (SE-like toxins). Five important serological types are SEA, SEB, SEC, SED, and SEE [6]. SEA was the main enterotoxin causing food poisoning. Moreover, SEA coexisting with SEG was the most frequently found enterotoxin in retail ready-to-eat foods [6].

Various ready-to-eat foods sold on walking streets and in food centers have become increasingly popular in Thailand. At the same time, almost all food vendors increasingly use their mobile phones in the food business. Therefore, mobile phones may serve as the perfect surface for the transmission of microorganisms, especially those from the human surface membrane. S. aureus from nose or skin infections can be spread to and survive on the surface of mobile phones via the hands and eventually be transferred into food. This may become a health risk, causing food poisoning or other illnesses to consumers.

There are no current published reports on the presence of S. aureus carrying SEs on the mobile phones of food vendors. Generally, several antimicrobial agents are used to treat S. aureus and MRSA infections, except for food poisoning [7]. Antimicrobial-resistant strains, especially MRSA, VRSA, and MDR, have been reported to cause nosocomial infections [8]. However, to our knowledge, no studies have been published to date on the contamination of food through mobile handheld devices with foodborne pathogens like S. aureus in food vendors’ settings in Thailand and elsewhere. Therefore, this study aimed to determine the prevalence of S. aureus and to investigate MDR strain contamination on the mobile phones of food vendors. The enterotoxin gene profile of S. aureus was also examined.

Methods

Sample collection

A total of 266 mobile phone samples were randomly collected from each food vendors on walking streets and in food centers (wet markets, 24-h markets, and canteens) in Phayao province, Thailand, from January to March 2021. The samples were collected by rubbing sterile cotton swabs soaked with sterile phosphate-buffered saline (PBS) over the screens of the mobile phones and then placing them in peptone water (PW). All PW samples were incubated at 37 °C for 24 h after arrival at the laboratory.

Isolation and identification of S. aureus

A loopful of the inoculated PW culture was subsequently streaked on mannitol salt agar (MSA; HiMedia Laboratories Pvt. Ltd., Mumbai, India) and Baird Parker agar (BPA; HiMedia Laboratories Pvt. Ltd., Mumbai, India) supplemented with egg yolk tellurite emulsion. After incubating at 37 °C for 24–48 h, typical colonies of S. aureus were sub-cultured on tryptic soy agar (TSA; HiMedia Laboratories Pvt. Ltd., Mumbai, India) and blood agar (BA; HiMedia Laboratories Pvt. Ltd., Mumbai, India). The production of beta-hemolysis on BA indicated the presence of S. aureus [9]. The colonies from TSA showing Gram-positive reaction with grape-like clusters were further identified by biochemical tests (oxidase, catalase, and coagulase tests) and confirmed by species-specific gene (femA) detection using PCR [10].

Antimicrobial susceptibility test

Antimicrobial susceptibility to 19 antimicrobial agents, namely ampicillin (AMP), penicillin (PEN), oxacillin (OXA), vancomycin (VAN), teicoplanin (TEC), daptomycin (DAP), gentamicin (GEN), erythromycin (ERY), tetracycline (TET), levofloxacin (LVX), moxifloxacin (MXF), ciprofloxacin (CIP), clindamycin (CLI), trimethoprim/sulfamethoxazole (SXT), rifampin (RIF), chloramphenicol (CHL), cefotaxime (CTX), linezolid (LZD), and tigecycline (TGC), was tested by broth microdilution method with Sensititre THAPF following the Clinical and Laboratory Standards Institute (CLSI) guidelines. The antimicrobial susceptibility results were interpreted according to CLSI breakpoints (CLSI, 2021) except for tigecycline, for which the clinical breakpoint according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) recommendations was used. S. aureus ATCC 25923 was used as a reference strain. In this study, intermediate or resistance to more than three antimicrobial classes was defined as MDR [11].

DNA extraction

Genomic DNA (gDNA) of S. aureus was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) as described in the manufacturer’s instructions. The DNA was stored at − 20 °C until use.

PCR assay

The gDNA of the oxacillin-resistant S. aureus isolate (MIC ≥ 4 µg/ml) was used to determine the presence of methicillin resistance genes (mecA and mecC) by PCR to confirm the MRSA strain, as previously described by Stegger et al. [12]. Subsequently, all S. aureus isolates were subjected to the detection of nine SE genes (sea, seb, sec, sed, sej, ser, sem, sel, and seq) by PCR using specific primers [13, 14]. The oligonucleotide primers, PCR product size, and annealing temperature are described in Table 1 [15, 16]. PCR amplifications were performed in a total volume of 25 μl according to OnePCR™ Ultra (GeneDireX, Inc., Taiwan). Each reaction consisted of 12.5 μl of OnePCR™ Ultra (Taq buffer, MgCl2, dNTPs, and Taq polymerase; GeneDireX, Inc., Taiwan), 0.5 μl of each primer (10 μM), 10.5 µl of distilled water, and 1 μl of DNA template. The PCR protocol was slightly modified according to OnePCR™ Ultra (GeneDireX, Inc., Taiwan) and performed in a PTC-100 Thermocycler (MJ Research Inc., Watertown, MA, USA). Briefly, the amplification conditions were as follows: initial denaturation step at 94 °C for 5 min followed by 35 cycles of denaturation at 94 °C for 30 s, annealing for 1 min (temperatures are shown in Table 1), extension at 72 °C for 2 min, and final extension step at 72 °C for 5 min. The PCR products were analyzed by 1.5% (w/v) agarose gel electrophoresis. The desired PCR products were purified and commercially sequenced by Macrogen Inc. in South Korea. The DNA similarity was performed with GenBank. The sequences were submitted to GenBank, with accession numbers ON109381 to ON109386.

Table 1.

PCR primers used in this study

Gene Primer Oligonucleotide sequence (5'-3') Annealing
temperature (oC)
Amplicon size
(bp)
References
femA femA-F TACGCAGCATATACCGCACT 54 300 [10]
femA-R CCATTACTGGACCACGATTC
mecA mecA-1 AAAATCGATGGTAAAGGTTGGC 51 533 [15]
mecA-2 AGTTCTGCAGTACCGGATTTGC
mecC mecC-1 GCTCCTAATGCTAATGCA 51 304 [16]
mecC-2 TAAGCAATAATGACTACC
sea sea-1 ACGATCAATTTTTACAGC 44.5 544 [13]
sea-2 TGCATGTTTTCAGAGTTAATC
seb seb-1 ATTCTATTAAGGACACTAAGTTAGGGGA 44.5 404 [13]
seb-2 ATCCCGTTTCATAAGGCGAGT
sec sec-1 GACATAAAAGCTAGGAATTT 44.5 257 [13]
sec-2 AAATCGGATTAACATTATCCA
sed sed-1 CAAATATATTGATATAATGA 44.5 330 [13]
sed-2 AGTAAAAAAGAGTAATGCAA
sej sej-F CACCAGAACTGTTGTTCTGCTAG 55 114 [14]
sej-R CTGAATTTTACCATCAAAGGTAC
ser ser-F TCCCATTCCTTATTTAGAATACA 52 440 [14]
ser-R GGATATTCCAAACACATCTGAC
sem sem-F AGTTTGTGTAAGAAGTCAAGTGTAGA 52 178 [14]
sem-R ATCTTTAAATTCAGCAGATATTCCATCTAA
sel sei-F TGGACATAACGGCACTAAAA 52 145 [14]
sei-R TTGGTARCCCATCATCTCCT
seq seq-F ATACCTATTAATCTCTGGGTCAATG 52 222 [14]
seq-R AATGGAAAGTAATTTTTCCTTTG

Statistical analysis

Descriptive statistics were used to determine the prevalence and frequency of S. aureus carrying enterotoxin genes and resistant strains. Data were analyzed using the Chi-square or Fisher’s exact tests with the statistical package SPSS (Version 21.0) and Microsoft Excel 2013. The p-value < 0.05 was considered statistically significant.

Results

Prevalence of Staphylococcus aureus on mobile phones

In this study, a total of 266 mobile phones were swabbed for sample collection from food vendors in Phayao province. The prevalence of S. aureus detected on mobile phones was 12.8% (34/266). The contamination of S. aureus on the mobile phones of food vendors on walking streets (11.5%; 16/139) and in food centers (14.2%; 18/127) was not significantly different (p > 0.05).

Staphylococcal enterotoxin genes

All 49 S. aureus isolates obtained from the 34 positive samples were tested for nine SE genes by PCR. The results indicated that the detection rate of SE genes was 61.2% (30/49; Table 2). The most frequent SE gene was sea at 32.7% (16/49), followed by sec (20.4%; 10/49), seb (10.2%; 5/49), sem (8.2%; 4/49), seq (4.1%; 2/49), and sel at 2.0% (1/49). However, sed, sej, and ser were not detected. Additionally, S. aureus carrying two SE genes (sea, 43.5% and sec, 13.0%) was detected in the samples from walking streets, while six genes (sec, 26.9%; sea, 23.1%; seb, 19.2%; sem, 15.4%; seq, 7.7%; and sel, 3.8%) were detected in samples from food centers. However, the frequency of SE genes from food centers (65.4%; 17/26) was not significantly higher than that of SE genes from walking streets (56.5%; 13/23; p > 0.05).

Table 2.

Distribution of Staphylococcus aureus isolates carrying staphylococcal enterotoxin genes from mobile phones of food vendors

Place No. of isolate No. (%) of S. aureus carried se gene No. (%) of S. aureus carried
sea seb* sec sed sej sem sel seq ser
Walking street 23 13 (56.5) 10 (43.5) 0 3 (13.0) 0 0 0 0 0 0
Food center 26 17 (65.4) 6 (23.1) 5 (19.2) 7 (26.9) 0 0 4 (15.4) 1 (3.8) 2 (7.7) 0
Total 49 30 (61.2) 16 (32.7) 5 (10.2) 10 (20.4) 0 0 4 (8.2) 1 (2.0) 2 (4.1) 0

*p-value < 0.05

Additionally, 30 S. aureus isolates carried one to three SE genes that were grouped into eight SE gene profiles as follows: sea (40.0%; 12/30), seb (10.0%; 3/30), sec (23.3%; 7/30), seq (3.3%; 1/30), sea-sec (6.7%; 2/30), sea-sem (6.7%; 2/30), seb-sem (6.7%; 2/30), and sec-sel-seq (3.3%; 1/30; Table 3). Food centers were found to contain all eight SE gene profiles (sec [4/17], seb [3/17], sea [2/17], seq [1/17], sea-sec [2/17], sea-sem [2/17], seb-sem [2/17], and sec-sel-seq [1/17]), while walking streets had only two profiles (sea [10/13] and sec [3/13]).

Table 3.

Antimicrobial resistance and enterotoxin gene profiles of Staphylococcus aureus isolates

Antimicrobial resistance profiles* No. of isolates No. of isolates carried SE genes No. of isolates staphylococcal enterotoxin gene profiles
sea seb sec seq sea-sec sea-sem seb-sem sec-sel-seq
CHI 5 4 1 1 2
PEN 4 1 1
TET 1 0 -
ERY-CHL 2 1 1 -
PEN-CHL 2 1 1
PEN-DAP 1 1 1
PEN-TET 6 4 3 1
TET-CHL 1 1 1
PEN-CLI-CHL 1 1 1
PEN-ERY-CHL 1 1 1
PEN-TET-CHL 5 5 4 1 -
PEN-TET-ERY 3 0 -
PEN-DAP-TET-CLI 1 1 1 -
PEN-MXF-ERY-CHL 1 0 -
PEN-TET-SXT-CHI 1 1 1 -
PEN-TET-SXT-CIP 1 0 -
DAP-TET-GEN-ERY-CHL 1 1 - 1
PEN-MXF-ERY-CLI-CHL 1 0 -
PEN-OXA-GEN-ERY-CLI-CHL 1 1 1
PEN-OXA-GEN-ERY-RIF-CLI 1 1 1
PEN-OXA-TET-SXT-GEN-CLI 1 0
PEN-TET-SXT-ERY-CLI-CHI 1 0
PEN-OXA-TET-GEN-RIF-CLI-CHLa 1 1 1
PEN-OXA-DAP-TET-GEN-ERY-RIF-CLI 1 1 1
PEN-MXF-DAP-TET-GEN-CIP-LVX-CLI 1 1 1
PEN-OXA-DAP-GEN-RIF-LVX-RIF-CLI-CHL 1 1 1
VAN-PEN-OXA-DAP-LZD-ERY-TEC-RIF-CLI-CHLa 1 0
Susceptible 2 1 1
Total 49 30 12 3 7 1 2 2 2 1

*PEN Penicillin, CHL Chloramphenicol, TET Tetracycline, ERY Erythromycin, CLI Clindamycin, GEN Gentamicin, OXA Oxacillin, DAP Daptomycin, RIF Rifampin, SXT Trimethoprim/sulfamethoxazole, MXF Moxifloxacin, CIP Ciprofloxacin, LVX Levofloxacin, VAN Vancomycin, LZD Linezolid, TEC Teicoplanin, TGC Tigecycline

amecA gene positive by PCR

Antimicrobial resistance of Staphylococcus aureus

Antibiotic resistance profiles were determined for 17 antimicrobial agents belonging to 14 classes by the broth microdilution method. The AMR of S. aureus isolates is shown in Fig. 1. In this study, 95.9% (47/49) of all isolates were resistant to at least one antimicrobial agent. The frequency of AMR was as follows: PEN (75.5%), followed by CHL and TET (51.0% each), ERY (30.6%), CLI (24.5%), GEN (16.3%), OXA and DAF (14.3% each), RIF (10.2%), SXT (8.2%), MXF (6.1%), CIP (4.1%), and LVX, VAN, LZD, and TEC (2.0% each).

Fig. 1.

Fig. 1

Antimicrobial resistance of Staphylococcus aureus isolated from mobile phones of food vendors

In this study, only the frequency of TET resistance of S. aureus isolates detected on mobile phones from walking streets (69.6%; 16/23) and food centers (34.6%; 9/26) was significantly different (p < 0.05). All isolates were susceptible to TGC.

Furthermore, only one isolate (2.1%) from a food center (a wet market) exhibited vancomycin resistance (MIC > 32 µg/ml) and was defined as a VRSA strain. Additionally, 2/7 (28.6%) OXA-resistant (MIC > 4 µg/ml) isolates harboring mecA were defined as MRSA and found from a walking street and a food center. Furthermore, MDR was found in 25 isolates (51.0%; 25/49), 64.0% (16/25) from walking streets and 36.0% (9/25) from food centers. In this study, 27 AMR profiles of S. aureus isolates were found, as shown in Table 3. The common AMR profile in MDR isolates was PEN-TET-CHL (20%; 5/25); all such isolates were found on walking streets. Moreover, interestingly, an MRSA (mecA +) strain having the PEN-OXA-TET-GEN-RIF-CLI-CHL resistance profile carrying seb was found in a food shop at a food center. Additionally, another MRSA (mecA +) strain having the VAN-PEN-OXA-DAP-IZD-ERY-TET-RIF-CLI-CHL resistance profile but not carrying any SE genes was found at the food center. Conversely, 1/2 susceptible strains carrying sea-sec was detected at the food center.

Discussion

The use of mobile phones provides many advantages; however, it may be a source of pathogen contamination, such as with S. aureus [1]. S. aureus has emerged as a major pathogen for both hospital and community-acquired infections. It can contaminate food or material products during preparation and processing. S. aureus can survive in dry and stressful environments such as the nose, skin, clothing, and surfaces [17]. These characteristics support the growth of S. aureus in many food products [11]. In addition, S. aureus can remain viable on hands and environmental surfaces for a long time after contact [18]. Hands may contaminate mobile phones at the time of use, especially when it is hot and humid and the hands are sweaty [19]. For all these reasons, there is no doubt that S. aureus is possibly present on the mobile phones of people in various occupations, such as healthcare workers, hospital staff, medical students [20], university students [21], and the food vendors. However, no study has previously assessed the contamination of S. aureus on the mobile phones of food vendors. Our study showed that 12.8% of mobile phones were contaminated with S. aureus among the ready-to-eat food vendors; this is within the prevalence range reported for previously studied samples from phones belonging to those in other occupations. This result also agrees with a study where S. aureus was detected in ready-to-eat food samples in northeast Thailand [6], where the prevalence was 37.7%.

Accordingly, while mobile phones offer many of the advantages to food vendors, including (1) the better quality and flexibility of service offered to customers, (2) the ability to accept payments wirelessly, (3) increased ability to communicate in and out of the workplace, (4) greater access to modern apps and services, and (5) improved networking capabilities, it is of a concern that they may be a conduit for the transmission of potentially pathogenic organisms. When comparing mobile phone contamination by S. aureus among food vendors either on walking streets (11.5%) or in food centers (14.2%), the prevalence in these two settings was not significantly different (p > 0.05). It is concluded that the mobile phone is one of the potential vehicles for S. aureus dissemination into food during food preparation regardless of the size of the food shop.

S. aureus enterotoxin is the major cause of food poisoning and other public health problems in developing countries [22]. In Thailand, many episodes of foodborne disease outbreaks have occurred without investigation of the causative agents due to (1) not being able to immediately collect the relevant food samples and (2) a much higher incidence as sporadic cases of S. aureus infection are not adequately reported. It is only known that S. aureus is the third most common causative agent of foodborne illness in Thailand [23]. Conversely, several studies have assessed the detection rates of SEs in food samples such as ready-to-eat foods [24] and retail chicken meat [25]. In this study, SE genes were detected in 61.2% (30/49) of all isolates from samples collected from the mobile phones of food vendors. The sea gene was found at a higher frequency than others. The present results agreed with several previous studies reporting that sea was the most common gene in S. aureus isolated from food [2426]. However, sed, sej, and ser were not detected in our study, which did not agree with a previous study reporting the presence of these genes in food poisoning cases and food. Additionally, sed, sej, and ser are known to be located on plasmids. In our study, eight se genotypes were observed and 23.4% of isolates possessed more than one SE gene: sea-sec (6.7%), sea-sem (6.7%), seb-sem (6.7%), and sec-sel-seq (3.3%). However, the onset of S. aureus-mediated food poisoning is abrupt. Abdominal cramps, nausea, and vomiting are the most common symptoms but the infection is generally self-limiting and resolves within 24–48 h. The conclusive diagnostic criteria of S. aureus food poisoning are based on the detection of SEs in food or exposure to at least 105 cell/g from food [27]. Therefore, the toxigenic S. aureus detected on mobile phones should be further analyzed for the phenotypes of toxin production and also detected in the relevant food samples for food safety.

The growing problem of AMR is a major public health concern. Although most studies of AMR surveillance have focused on healthcare and agriculture settings, AMR in humans and environments has also been reported. Staphylococci are commonly found in built environments. Multiple studies have indicated that AMR bacteria, including S. aureus, can be transmitted to humans in public environments including on buses [28], at railway stations [29], and in classrooms [30]. Presently, much evidence of AMR S. aureus contaminating mobile phones has been derived from healthcare settings where it causes nosocomial infection; S. aureus resistant to ampicillin, oxacillin, ceftazidime, vancomycin, and amoxicillin has been isolated from the mobile devices of students in the health sector [31]. Additionally, S. aureus isolates resistant to ceftazidime (50%), gentamycin (40.9%), ciprofloxacin (40.9%), tetracycline (36.4%), chloramphenicol (31.8%), imipenem (27.3%), and azithromycin (27.3%) were isolated from the mobile phones of healthcare workers in Bangladesh [2]. However, there is no known surveillance of AMR S. aureus on the mobile phones of food vendors. Only S. aureus isolates resistant to erythromycin, ciprofloxacin, oxacillin, and cefoxitin were detected in processed raw meat/fish samples of ready-to-eat foods in other settings [32]. This study’s results regarding the AMR of S. aureus on the mobile phones of food vendors were similar to those of previous reports in other settings. It is remarkable that the frequency of penicillin resistance was high, at 75%, and that 28.6% of isolates harbored mecA. These variants detected on the mobile phones of food vendors on walking streets and in food centers, were therefore defined as MRSA.

Furthermore, our data agreed with those from ready-to-eat foods, humans, pork, and beef [32]. Conversely, the prevalence of MDR S. aureus was quite high (51.0%) in this study. Most of the MDR isolates were methicillin-sensitive S. aureus and diverse. Only MRSA and VRSA isolates having MDR profiles of PEN-OXA-TET-GEN-RIF-CLI-CHL and VAN-PEN-OXA-DAP-LZD-ERY-TEC-RIF-CLI-CHL were detected in this study. It seemed that the AMR profiles in this study were quite different from those in previous studies [31]. This may be due to the antimicrobial agents used in different settings and the different environments, times, or samples. Thus, the results of one study may not be comparable with those of other studies. Within the same study, the AMR of S. aureus from the mobile phones of food vendors on walking streets and in food centers was quite similar. Only the percent resistance to each drug was different but not so significantly. However, MRSA isolate having MDR profile and carrying seb was detected on a mobile phone from a food shop at a food center in this study. It is not known whether this isolate was derived from food vendors, food materials, or other related environments in the shop. Generally, food is also an important factor in the transfer of AMR. Recently, MRSA strains were isolated from several food-producing animals including pigs, cattle, chickens, and other animals [27]. Additionally, this strain could produce enterotoxin when exposed to optimal conditions, leading to food poisoning outbreaks. It is concluded that the diversity of the S. aureus population on the mobile phones of food vendors regarding their toxigenic potential and AMR sheds light on the quality and safety of ready-to-eat foods on walking streets and in food centers.

Conclusions

To our knowledge, this is the first report to study the mobile phones of food vendors both on walking streets and in food center shops for the presence of S. aureus. Contamination by MDR S. aureus strains, including MRSA carrying SE genes, was detected on the mobile phones of food vendors. Thus, the mobile phone of the food vendor might be carriers to spread the antimicrobial-resistant S. aureus strain producing SEs into the food that cause food poisoning when ingested in contaminated food. The possibility of mobile phone contamination occurring during business practices indicates the potential threat of mobile phones spreading infections, and the importance of both mobile phone hygiene and hand hygiene to prevent infection must be emphasized.

Acknowledgements

Not applicable.

Author contributions

KK and AS developed proposal. AS, KK, and CP collected the samples. KK, WP, AY, AR, CP, PK, and AS participated in methodology and experimental work. KK, AY, KR, WT, OS, and AS analyzed and interpreted of the result. KK and AS were major contributors in writing the manuscript. KK, WP, WT, OS, and AS read and edited the manuscript. All authors read and approved the published version of the manuscript.

Funding

This work was supported by the grant from University of Phayao, Thailand [Grant number: FF64-RIM038, 2021].

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Declarations

Ethics approval and consent to participate

This study was ethically exempted by the University of Phayao Human Ethics Committee, University of Phayao, Thailand, ethical approval no. 1.2/021/63.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Tambe NN, Pai C. A study of microbial flora and MRSA harboured by mobile phones of health care personnel. Int J Rec Tre Sci Tech. 2012;4:14–18. [Google Scholar]
  • 2.Debnath T, Bhowmik S, Islam T, Hassan Chowdhury MM. Presence of multidrug-resistant bacteria on mobile phones of healthcare workers accelerates the spread of nosocomial infection and regarded as a threat to public health in Bangladesh. J Microsc Ultrastruct. 2018;6:165–169. doi: 10.4103/JMAU.JMAU_30_18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Homthong S, Nilphan D, Wirathana W, Dechglar N. Preliminary study of distribution of total bacteria count and Staphylococcus aureus on public computer mice and keyboards and mobile phones in Burapha University. Chonburi Province BUSCIJ. 2014;19:28–38. [Google Scholar]
  • 4.Pal M, Ketchakmadze D, Durglishvili N, Ketchakmadze I. Staphylococcus aureus: A major pathogen of food poisoning. J Nutrition and Food Processing. 2022;5:1–3. doi: 10.31579/2637-8914/074. [DOI] [Google Scholar]
  • 5.Bureau of Epidemiology . Epidemiological surveillance and investigation report 506 of food poisoning. Nonthaburi: Bureau of epidemiology, department of disease control ministry of public health; 2020. [Google Scholar]
  • 6.Khaenda B, Namwat W, Kotimanusvanij D, Chomvarin C. Distribution of new Staphylococcal enterotoxin genes (seg, seh, sei, sej, and sel) in Staphylococcus aureus isolated from retail ready-to-eat foods in the Northeast Thailand. Srinagarind Med J. 2016;31:237–244. [Google Scholar]
  • 7.Centers for Disease Control and Prevention. Food safety Staphylococcal food poisoning, https://www.cdc.gov/foodsafety/diseases/staphylococcal.html; 2022. Accessed 20 September 2022.
  • 8.Pannewick B, Baier C, Schwab F, Vonberg RP. Infection control measures in nosocomial MRSA outbreaks-results of a systematic analysis. PLoS One. 2021;16:e0249837. doi: 10.1371/journal.pone.0249837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Forbes BA, Sahm DF, Weissfeld AS. Diagnostic microbiology. St Louis: Mosby; 2007. pp. 288–302. [Google Scholar]
  • 10.Tantavutt N, Lamjaiaktase P, Santanirand P. Development of multiplex PCR for detection of Staphylococcus aureus plus methicillin resistant and MLSB resistance genes. J Med Tech Assoc Thailand. 2016;44:1–8. [Google Scholar]
  • 11.Waters AE, Contente-Cuomo T, Buchhagen J, Liu CM, Watson L, Pearce K, et al. Multidrug-resistant Staphylococcus aureus in US meat and poultry. Clin Infect Dis. 2011;52:1227–1230. doi: 10.1093/cid/cir181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Stegger Á, Andersen PS, Kearns A, Pichon B, Holmes MA, Edwards G, et al. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecALGA251. Clin Microbiol Infect. 2012;18:395–400. doi: 10.1111/j.1469-0691.2011.03715.x. [DOI] [PubMed] [Google Scholar]
  • 13.de Lima MJ, Volcão LM, Funck GD, Kroning IS, da Silva WP, Fiorentini ÂM, et al. Antimicrobial activity of essential oils of Origanum vulgare L. and Origanum majorana L. against Staphylococcus aureus isolated from poultry meat. Ind Crops Prod. 2015;77:444–50. doi: 10.1016/j.indcrop.2015.09.013. [DOI] [Google Scholar]
  • 14.Hu WD. Distribution of food-borne Staphylococcus aureus enterotoxin genes. Genet Mol Res. 2016;15:10.4238. doi: 10.4238/gmr.15016084. [DOI] [PubMed] [Google Scholar]
  • 15.Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of methicillin-resistant strains of Staphylococci by polymerase chain reaction. J Clin Microbiol. 1991;29:2240–2244. doi: 10.1128/jcm.29.10.2240-2244.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Cuny C, Layer F, Strommenger B, Witte W. Rare occurrence of methicillin-resistant Staphylococcus aureus CC130 with a novel mec A homologue in humans in Germany. PloS One. 2011;6:e24360. doi: 10.1371/journal.pone.0024360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Chaibenjawong P, Foster SJ. Desiccation tolerance in Staphylococcus aureus. Arch Microbiol. 2011;193:125–135. doi: 10.1007/s00203-010-0653-x. [DOI] [PubMed] [Google Scholar]
  • 18.Kusumaningrum HD, Van Putten MM, Rombouts FM, Beumer RR. Effects of antibacterial dishwashing liquid on foodborne pathogens and competitive microorganisms in kitchen sponges. J Food Prot. 2002;65:61–65. doi: 10.4315/0362-028x-65.1.61. [DOI] [PubMed] [Google Scholar]
  • 19.Srikanth P, Rajaram E, Sudharsanam S, Lakshmanan A, Mariappan US, Jagannathan K. Mobile phones: emerging threat for infection control. J Infect Prev. 2010;11:87–90. doi: 10.1177/1757177410364866. [DOI] [Google Scholar]
  • 20.Adhikari S, Khadka S, Sapkota S, Shrestha P. Methicillin-resistant Staphylococcus aureus associated with mobile phones. SOJ Microbiol Infect Dis. 2018;6:1–6. doi: 10.15226/sojmid/6/1/00190. [DOI] [Google Scholar]
  • 21.Al-Momani AM, Mahmoud MA, Ahmad MS. Factors that influence the acceptance of internet of things services by customers of telecommunication companies in Jordan. J Organ End User Comput. 2018;30:51–63. doi: 10.4018/JOEUC.2018100104. [DOI] [Google Scholar]
  • 22.Fetsch A, Contzen M, Hartelt K, Kleiser A, Maassen S, Rau J, et al. Staphylococcus aureus food-poisoning outbreak associated with the consumption of ice-cream. Int J Food Microbiol. 2014;187:1–6. doi: 10.1016/j.ijfoodmicro.2014.06.017. [DOI] [PubMed] [Google Scholar]
  • 23.Department of Disease Control. Ministry of Public Health. Thailand, https://ddc.moph.go.th/; 2022. Accessed 2 May 2022.
  • 24.Wongboot W, Chomvarin C, Namwat W. Phenotypic and genotypic detection of enterotoxins, toxic shock syndrome toxin-1 and of methicillin resistance in Staphylococcus aureus isolated from retail ready-to-eat foods in Northeastern Thailand. Southeast Asian J Trop Med Public Health. 2015;46:97–104. [PubMed] [Google Scholar]
  • 25.Savariraj WR, Ravindran NB, Kannan P, Rao VA. Occurrence and enterotoxin gene profiles of Staphylococcus aureus isolated from retail chicken meat. Food Sci Technol Int. 2021;27:619–625. doi: 10.1177/1082013220980204. [DOI] [PubMed] [Google Scholar]
  • 26.Haghi F, Zeighami H, Hajiloo Z, Torabi N, Derakhshan S. High frequency of enterotoxin encoding genes of Staphylococcus aureus isolated from food and clinical samples. J Health Popul Nutr. 2021;40:1–6. doi: 10.1186/s41043-021-00246-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Hennekinne JA, De Buyser ML, Dragacci S. Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiol Rev. 2012;36:815–836. doi: 10.1111/j.1574-6976.2011.00311.x. [DOI] [PubMed] [Google Scholar]
  • 28.Conceicao T, Diamantino F, Coelho C, de Lencastre H, Aires-de-Sousa M. Contamination of public buses with MRSA in Lisbon, Portugal: a possible transmission route of major MRSA clones within the community. PLoS One. 2013;8:e77812. doi: 10.1371/journal.pone.0077812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lin JL, Peng Y, Ou QT, Lin DX, Li Y, Ye XH, et al. A molecular epidemiological study of methicillin-resistant Staphylococci environmental contamination in railway stations and coach stations in Guangzhou of China. Lett Appl Microbiol. 2017;64:131–137. doi: 10.2147/IDR.S178584. [DOI] [PubMed] [Google Scholar]
  • 30.Li L, Titsworth S. Student misbehaviors in online classrooms: scale development and validation. Am J Distance Educ. 2015;29:41–55. doi: 10.1080/08923647.2015.994360. [DOI] [Google Scholar]
  • 31.Shiluli C, Achok C, Nyaswa P, Ogwai S, Aroko A, Obila J, et al. Antimicrobial sensitivity patterns of Staphylococcus species isolated from mobile phones and implications in the health sector. BMC Res Notes. 2021;14:1–15. doi: 10.1186/s13104-020-05413-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Islam MA, Parveen S, Rahman M, Huq M, Nabi A, Khan ZU, et al. Occurrence and characterization of methicillin resistant Staphylococcus aureus in processed raw foods and ready-to-eat foods in an urban setting of a developing country. Front Microbiol. 2019;10:503. doi: 10.3389/fmicb.2019.00503. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in this published article.


Articles from Annals of Clinical Microbiology and Antimicrobials are provided here courtesy of BMC

RESOURCES