Skip to main content
PMC home page
The Plant Pathology Journal logoLink to The Plant Pathology Journal
. 2023 Aug 1;39(4):384–396. doi: 10.5423/PPJ.OA.05.2023.0078

Re-identification of Colletotrichum acutatum Species Complex in Korea and Their Host Plants

Le Dinh Thao 1,2, Hyorim Choi 1, Yunhee Choi 1, Anbazhagan Mageswari 1, Daseul Lee 1, Seung-Beom Hong 1,*
PMCID: PMC10412970  PMID: 37550984

Abstract

Colletotrichum acutatum species complex is one of the most important groups in the genus Colletotrichum with a high species diversity and a wide range of host plants. C. acutatum and related species have been collected from different plants and locations in Korea and deposited into the Korean Agricultural Culture Collection (KACC), National Institute of Agricultural Sciences since the 1990s. These fungal isolates were previously identified based mainly on morphological characteristics, and a limitation of molecular data was provided. To confirm the identification of species, 64 C. acutatum species complex isolates in KACC were used in this study for DNA sequence analyses of six loci: nuclear ribosomal internal transcribed spacers (ITS), beta-tubulin 2 (TUB2), histone-3 (HIS3), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), chitin synthase 1 (CHS-1), and actin (ACT). The molecular analysis revealed that they were identified in six different species of C. fioriniae (24 isolates), C. nymphaeae (21 isolates), C. scovillei (12 isolates), C. chrysanthemi (three isolates), C. lupini (two isolates), and C. godetiae (one isolate), and a novel species candidate. We compared the hosts of KACC isolates with “The List of Plant Diseases in Korea”, previous reports in Korea and global reports and found that 23 combinations between hosts and pathogens could be newly reported in Korea after pathogenicity tests, and 12 of these have not been recorded in the world.

Keywords: Colletotrichum acutatum species complex, host plant, identification

The fungal family Glomerellaceae contains only one genus Colletotrichum which consists of many phytopathogenic species with a wide range of hosts. Colletotrichum species were commonly reported as causal agents of anthracnose diseases and infected economically important crops such as apple, strawberry, pepper, citrus, peach, mango, avocado, banana, coffee and cereals (Cannon et al., 2012; Crouch and Beirn, 2009; González et al., 2006; Kim et al., 2008; Lenné, 2002; Nguyen et al., 2010; Oo et al., 2018; Peres et al., 2008; Sanders and Korsten, 2003; Tan et al., 2022).

The identification of Colletotrichum species was primarily based on morphological characteristics with 11 species recognized by von Arx (1957), 22 species by Sutton (1980), and 39 species by Sutton (1992). Later, 66 species were accepted by Hyde et al. (2009) based on the morphology and/or molecular analysis. However, morphological characteristics and the lack of molecular data cannot be used to identify Colletotrichum species accurately (Cai et al., 2011; Sato and Moriwaki, 2013). Therefore, Jayawardena et al. (2016) divided the genus Colletotrichum (189 species) into 11 species complexes and 23 single species, then Liu et al. (2022) updated to 280 accepted species with 16 species complexes and 15 singleton species, based on multi-locus phylogeny. The nuclear ribosomal internal transcribed spacer (ITS) region was used to determine Colletotrichum species complexes (Cannon et al., 2012). While, most members of the C. acutatum, C. dematium, C. destructivum, C. orchidearum, C. spaethianum, C. dracaenophilum, C. magnum, and C. truncatum species complexes were identified at species level by the combination of six loci: ITS, beta-tubulin 2 (TUB2), histone-3 (HIS3), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), chitin synthase 1 (CHS-1), and actin (ACT) (Damm et al., 2009, 2012, 2014, 2019; Jayawardena et al., 2016; Liu et al., 2022).

Species in the C. acutatum species complex are known as destructive plant pathogens worldwide, including Korea (Baroncelli et al., 2015; Cho et al., 2021; Garrido et al., 2009; Kim et al., 2022; Kwon and Kim, 2011; Lee et al., 2007; Oh, 1995; Peres et al., 2008; Talhinhas et al., 2011). To date, this complex was one of the biggest groups in the genus Colletotrichum with 43 accepted species and contained species with a wide or narrow range of host plants (Jayawardena et al., 2021; Liu et al., 2022). The variation in the conidial shape of many species in the complex often led to incorrectly identify based on morphology. For example, 39 Colletotrichum isolates, morphologically identified as C. gloeosporioides or Glomerella cingulata, were re-identified as 14 species in or closely related to the C. acutatum species complex based on the multi-locus analysis (Damm et al., 2012).

Isolates of C. acutatum and related species have been deposited into the Korean Agricultural Culture Collection (KACC), National Institute of Agricultural Sciences since the 1990s. These species were originally identified mainly based on morphological characteristics. In earlier studies, several KACC isolates in the C. acutatum species complex were re-identified using a single locus or the multi-locus combination. Nevertheless, some of these were ambiguous species because of insufficient molecular data (Han et al., 2014; Kim and Kim, 2020; Kim et al., 2006, 2008, 2020; Noh et al., 2014; Park et al., 2020; Xu et al., 2018). Accurate species identification within C. acutatum species complex plays an important role to understand species diversity and the host plants of this complex in Korea. Hence, this study aims to: (1) re-identify the isolates of C. acutatum species complex in KACC using the combined analysis of six loci (ITS, TUB2, HIS3, GAPDH, CHS-1, and ACT); (2) rearrange combination between host plants and re-identified species under C. acutatum species complex in Korea.

Materials and Methods

Fungal isolates

Sixty-four cultures of Colletotrichum from many host plants and different locations in Korea have been deposited and preserved in liquid nitrogen at the KACC. Details of these isolates such as sources, locations, collected date and previous re-identifications were documented. Fresh cultures were recovered on potato dextrose agar (PDA) and used in this study.

DNA extraction, polymerase chain reaction amplification, and sequencing

Fungal mycelia were scraped from 7-day-old cultures on PDA plates. Around 50 mg of fresh mycelia was used for DNA extraction using the DNeasy plant mini kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. DNA templates were checked by a NanoDrop Spectrophotometer (Thermo Scientific, Waltham, MA, USA).

The primer pairs, including ITS1/ITS4 (White et al., 1990), T1/BT2b (Glass and Donaldson, 1995; O’Donnell and Cigelnik, 1997), GDF1/GDR1 (Guerber et al., 2003), CYLH3F/CYLH3R (Crous et al., 2004), CHS-79F/CHS-345R (Carbone and Kohn, 1999), and ACT-512F/ACT-783R (Carbone and Kohn, 1999), were used for the amplification of ITS, TUB2, GAPDH, HIS3, CHS-1, and ACT, respectively (Table 1). Each polymerase chain reaction (PCR) volume (25 μl) consisted of 12.5 μl MyTaq HS Mix, 1 μl (4.5 pMol) of each primer, 8.5 μl nuclease-free water and 2 μl DNA template (100 ng/μl). PCR reactions were performed in a MJ Research PTC-200 Thermal Cycler (MJ Research, Ramsey, MN, USA) with an initial denaturation step at 94°C for 5 min, followed by 30 cycles: denaturation at 94°C for 30 s; annealing at 58°C (ITS), 61°C (TUB2 and GAPDH) and 61.5°C (HIS3, CHS-1, and ACT) for 30 s, extension at 72°C for 1 min and final extension at 72°C for 10 min. PCR products were checked by gel electrophoresis before sending to the Macrogen (Seoul, Korea) for sequencing with the amplifying primer pairs.

Table 1.

Primer pairs used for PCR amplification and sequencing in this study

Locus Primer Direction Sequence (5′-3′) Reference
ITS ITS1 Forward TCCGTAGGTGAACCTGCGG White et al. (1990)
ITS4 Reverse TCCTCCGCTTATTGATATGC
TUB2 T1 Forward AACATGCGTGAGATTGTAAGT O’Donnell and Cigelnik (1997)
Bt2b Reverse ACCCTCAGTGTAGTGACCCTTGGC Glass and Donaldson (1995)
GAPDH GDF1 Forward GCCGTCAACGACCCCTTCATTGA Guerber et al. (2003)
GDR1 Reverse GGGTGGAGTCGTACTTGAGCATGT
HIS3 CYLH3F Forward AGGTCCACTGGTGGCAAG Crous et al. (2004)
CYLH3R Reverse AGCTGGATGTCCTTGGACTG
CHS-1 CHS-79F Forward TGGGGCAAGGATGCTTGGAAGAAG Carbone and Kohn (1999)
CHS-345R Reverse TGGAAGAACCATCTGTGAGAGTTG
ACT ACT-512F Forward ATGTGCAAGGCCGGTTTCGC Carbone and Kohn (1999)
ACT-783R Reverse TACGAGTCCTTCTGGCCCAT
Open in a new tab

PCR, polymerase chain reaction; ITS, internal transcribed spacer; TUB2, β-tubulin 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HIS3, histone3; CHS-1, chitin synthase; ACT, actin.

Phylogenetic analysis

Raw sequences obtained in this study were assembled by MEGA 11 (Tamura et al., 2021) and deposited to RDA-GeneBank (http://genebank.rda.go.kr) with accession numbers in Table 2. The sequence datasets contained sequences of 64 KACC isolates, 43 reference species (Supplementary Table 1) in the C. acutatum species complex, and C. orchidophilum (outgroup) (Liu et al., 2022). The multiple sequence alignment of each locus was separately performed using the ClustalW program in MEGA 11 and concatenated afterward. A maximum likelihood (ML) phylogenetic tree of six loci was inferred using IQ-TREE with the best-fit model “TIM2+F+I+G4”, and 1,000 ultrafast bootstrap replicates. The phylogenetic tree was viewed in MEGA11 and depicted in Adobe Illustrator.

Table 2.

KACC isolates under Colletotrichum acutatum species complex used in this study

Re-identified species Isolate no. Location Collected date Host Species name by depositor Previous identification RDA-GeneBank accession no.
ITS TUB2 GAPDH HIS3 CHS-1 ACT
C. chrysan-themi KACC 40700 Jecheon 1998 Jun Carthamus tinctorius C. acutatum C. acutatum (Kim et al., 2006; 2008) RDA0061920 RDA0062143 RDA0062355 RDA0065775 RDA0065725 RDA0065685
KACC 40801 Uiseong 1998 Jun Carthamus tinctorius C. acutatum C. acutatum (Kim et al., 2006) RDA0061919 RDA0062144 RDA0062356 RDA0065780 RDA0065720 RDA0065684
KACC 47036 Eumseong 2012 Sep Coriandrum sativum C. chrysan-themi RDA0061949 RDA0062247 RDA0062452 RDA0065759 RDA0065741 RDA0065631
C. fioriniae KACC 47032 Cheongyang 2012 Sep - C. fioriniae RDA0061948 RDA0062243 RDA0062448 RDA0065763 RDA0065737 RDA0065635
KACC 48716 Gangneung 2013 Nov - C. fioriniae RDA0061964 RDA0062307 RDA0062501 RDA0065766 RDA0065734 RDA0065638
KACC 48280 Jeju 2015 Sep Actinidia chinensis C. acutatum RDA0061958 RDA0062281 RDA0062476 RDA0065799 RDA0065700 RDA0065665
KACC 43128 Boseong 2006 Aug Camellia sinensis C. acutatum RDA0061938 - RDA0062418 RDA0065812 RDA0065687 RDA0065677
KACC 43122 Jeungpyeong 2004 Jan Capsicum annuum C. acutatum RDA0061932 RDA0062207 RDA0062412 RDA0065811 RDA0065688 RDA0065676
KACC 48693 Jeju 2018 Oct Cayratia japonica C. fioriniae RDA0061963 RDA0062299 RDA0062494 RDA0065768 RDA0065732 RDA0065639
KACC 43129 Cheongju 2007 Mar Chaenomeles sinensis C. acutatum RDA0061939 RDA0062214 RDA0062419 RDA0065777 RDA0065723 RDA0065646
KACC 47696 Gangneung 2013 Nov Cucurbita sp. C. acutatum C. fioriniae (Kim and Kim, 2020) RDA0061955 RDA0062268 RDA0062462 RDA0065785 RDA0065715 RDA0065651
KACC 49919 Cheongyang - Lycium chinense C. acutatum RDA0061969 RDA0062321 RDA0062517 RDA0065808 RDA0065691 RDA0065673
KACC 49920 Cheongyang - Lycium chinense C. acutatum RDA0061970 RDA0062322 RDA0062518 RDA0065805 RDA0065694 RDA0065670
KACC 49921 Cheongyang - Lycium chinense C. acutatum RDA0061971 RDA0062323 RDA0062519 RDA0065794 RDA0065705 RDA0065660
KACC 49922 Cheongyang - Lycium chinense C. acutatum RDA0061972 RDA0062324 RDA0062520 RDA0065752 RDA0065748 RDA0065667
KACC 48684 Busan 2017 Aug Machilus thunbergii C. fioriniae RDA0061961 RDA0062296 RDA0062490 RDA0065804 RDA0065695 RDA0065637
KACC 42495 Bonghwa 2006 Sep Malus domestica C. acutatum RDA0061910 RDA0062184 RDA0062389 RDA0065781 RDA0065719 RDA0065648
KACC 42500 Yongin 2006 Aug Malus domestica C. acutatum RDA0061908 RDA0062189 RDA0062394 RDA0065788 RDA0065712 RDA0065654
KACC 42504 Jangsu 2006 Aug Malus domestica C. acutatum RDA0061907 RDA0062193 RDA0062398 RDA0065776 RDA0065724 RDA0065645
KACC 49925 Yeongdon - Malus pumila C. acutatum RDA0061973 RDA0062327 RDA0062523 RDA0065797 RDA0065702 RDA0065663
KACC 48794 Gangjin 2019 Jul Paeonia lactiflora C. fioriniae RDA0061965 RDA0062308 RDA0062503 RDA0065798 RDA0065701 RDA0065664
KACC 43012 Daejeon 2006 May Pinus koraiensis C. acutatum RDA0061931 RDA0062201 RDA0062407 RDA0065813 RDA0065710 RDA0065655
KACC 47031 Eumseong 2012 Jul Schizonepeta tenuifolia var. japonica C. fioriniae RDA0061947 RDA0062242 RDA0062447 RDA0065770 RDA0065730 RDA0065641
KACC 47694 Gangneung 2011 Nov Solanum melongena C. acutatum C. fioriniae (Xu et al., 2018) RDA0061953 RDA0062266 RDA0062460 RDA0065795 RDA0065704 RDA0065661
C. fioriniae KACC 41932 Geoje 2002 May Spiraea prunifolia var. simpliciflora C. gloeosporioides C. acutatum (Kim et al., 2006) RDA0061913 RDA0062171 RDA0062375 RDA0065772 RDA0065728 RDA0065643
C. fioriniae KACC 48562 Seogwipo 2018 Apr Xylosma congesta C. fioriniae RDA0061960 RDA0062287 RDA0062481 RDA0065790 RDA0065709 RDA0065656
KACC 49676 Jeju - Machilus thunbergii C. fioriniae RDA0061967 RDA0065814 - RDA0065796 RDA0065703 RDA0065662
C. godetiae KACC 42911 Hongcheon 2007 Jun Symplocarpus renifolius Colletotrichum sp. RDA0061930 RDA0062200 RDA0062406 RDA0065787 RDA0065713 RDA0065653
C. lupini KACC 47254 Seoul 2009 May Lupinus luteus C. gloeosporioides C. lupini (Han et al., 2014) RDA0061950 RDA0062249 RDA0065816 RDA0065782 RDA0065718 RDA0065649
KACC 47255 Yongin 2013 Apr Lupinus luteus C. gloeosporioides RDA0061951 RDA0062250 RDA0062454 RDA0065760 RDA0065740 RDA0065632
C. nymphaeae KACC 46962 Mungyeong 2012 Sep - C. acutatum RDA0061946 RDA0062237 RDA0062442 RDA0065771 RDA0065729 RDA0065642
KACC 47824 Cheongdo 2014 Aug Prunus persica C. acutatum RDA0061956 RDA0062270 RDA0062464 RDA0065784 RDA0065716 RDA0065650
KACC 48897 Tongyong - Abies holophylla C. nymphaeae RDA0061966 RDA0062310 RDA0062505 RDA0065806 RDA0065693 RDA0065671
KACC 43123 Chungbuk 2002 Jan Capsicum annuum C. acutatum RDA0061933 RDA0062208 RDA0062413 RDA0065778 RDA0065722 RDA0065647
KACC 43124 Boeun 2004 Jan Capsicum annuum C. acutatum RDA0061934 RDA0062209 RDA0062414 RDA0065758 RDA0065742 RDA0065629
KACC 43125 Cheongju 2004 Jan Capsicum annuum C. acutatum RDA0061935 RDA0062210 RDA0062415 RDA0065761 RDA0065739 RDA0065633
KACC 45234 Changwon 2008 Oct Diospyros kaki C. acutatum RDA0061943 RDA0062226 RDA0062433 RDA0065765 RDA0065735 RDA0065636
KACC 47695 Gangneung 2013 Jun Lycopersicon esculentum C. gloeosporioides RDA0061954 RDA0062267 RDA0062461 RDA0065773 RDA0065727 RDA0065644
KACC 42403 Andong 2006 Sep Malus domestica C. acutatum C. nymphaeae (Kim et al., 2020) RDA0061911 RDA0062178 RDA0062383 RDA0065792 RDA0065707 RDA0065658
KACC 42496 Gunwi 2006 Sep Malus domestica C. acutatum RDA0061909 RDA0062185 RDA0062390 RDA0065810 RDA0065689 RDA0065675
KACC 42505 Gunwi 2004 Aug Malus domestica C. acutatum RDA0061927 RDA0062194 RDA0062399 RDA0065786 RDA0065714 RDA0065652
KACC 40847 Andong 1999 Oct Malus pumila var. dulcissima C. gloeosporioides C. acutatum (Kim et al., 2006) C. nymphaeae (Kim et al., 2020) RDA0061916 RDA0062147 RDA0062365 RDA0065756 RDA0065744 RDA0065627
KACC 40848 Yeongju 1999 Oct Malus pumila var. dulcissima C. gloeosporioides C. acutatum (Kim et al., 2006) C. nymphaeae (Kim et al., 2020) RDA0061915 RDA0062148 RDA0062366 RDA0065753 RDA0065747 RDA0065624
KACC 49896 Jeonju 2021 Oct Prunus persica C. nymphaeae RDA0061968 RDA0062320 RDA0062516 RDA0065762 RDA0065738 RDA0065634
KACC 49926 Sejong - Prunus persica C. acutatum RDA0061974 RDA0062328 RDA0062524 RDA0065802 RDA0065697 RDA0065668
C. nymphaeae KACC 42089 Hapcheon 2004 Aug Punica granatum C. gloeosporioides C. acutatum (Kim et al., 2006) RDA0061912 RDA0062172 RDA0062376 RDA0065751 RDA0065750 RDA0065623
KACC 40898 Naju 2000 Oct Pyrus serotina C. acutatum RDA0061914 RDA0062167 RDA0062371 RDA0065809 RDA0065690 RDA0065674
KACC 43130 Cheongju 2006 Jun Vitis sp. C. acutatum RDA0061940 RDA0062215 RDA0062420 RDA0065807 RDA0065692 RDA0065672
C. nymphaeae KACC 46931 Yeongdong 2011 Nov Vitis labrusca C. acutatum C. acutatum (Noh et al., 2014) RDA0061945 RDA0062235 RDA0065817 RDA0065793 RDA0065706 RDA0065659
KACC 43023 Hongcheon 2007 Jul Humulus japonicus Colletotrichum sp. RDA0061979 RDA0062203 RDA0062409 RDA0065764 RDA0065736 RDA0065622
KACC 49927 Sejong Prunus persica C. acutatum RDA0061975 - RDA0065815 - RDA0065749 -
C. scovillei KACC 40004 Daejeon - Capsicum annuum C. gloeosporioides C. acutatum (Kim et al., 2006) RDA0060929 RDA0062124 RDA0062331 RDA0065800 RDA0065699 RDA0065686
KACC 40007 Daejeon - Capsicum annuum C. gloeosporioides C. acutatum (Kim et al., 2006) RDA0060924 RDA0062126 RDA0062334 RDA0065755 RDA0065745 RDA0065626
KACC 40008 Daejeon - Capsicum annuum C. coccodes RDA0060925 RDA0062127 RDA0062335 RDA0065791 RDA0065708 RDA0065657
KACC 40691 Hoengseong 1998 Aug Capsicum annuum C. gloeosporioides C. acutatum (Kim et al., 2006) RDA0060937 RDA0062140 RDA0062348 RDA0065757 RDA0065743 RDA0065628
KACC 42509 Gunwi 2005 Jul Capsicum annuum C. acutatum RDA0061929 RDA0062198 RDA0062403 RDA0065767 RDA0065733 RDA0065682
KACC 43127 Jeonbuk 2002 Jan Capsicum annuum C. acutatum RDA0061937 RDA0062212 RDA0062417 RDA0065779 RDA0065721 RDA0065680
KACC 44886 Daejeon 2008 May Capsicum annuum C. acutatum RDA0061941 RDA0062224 RDA0062431 RDA0065754 RDA0065746 RDA0065679
KACC 45723 Hwaseong 2008 Feb Capsicum annuum C. acutatum RDA0061944 RDA0062229 RDA0062436 RDA0065769 RDA0065731 RDA0065640
KACC 47693 Pyeongchang 2012 Sep Capsicum annuum C. acutatum RDA0061952 RDA0062265 RDA0062459 RDA0065783 RDA0065717 RDA0065678
KACC 48686 Gimje 2018 Sep Capsicum annuum C. scovillei RDA0061962 RDA0062297 RDA0062492 RDA0065803 RDA0065696 RDA0065669
KACC 40805 Yangpyeong 1996 Sep Lycopersicon esculentum C. gloeosporioides C. acutatum (Kim et al., 2006) RDA0061917 RDA0062146 RDA0065818 RDA0065774 RDA0065726 RDA0065683
KACC 42537 Chuncheon 2006 Sep Capsicum annuum Colletotrichum sp. RDA0061978 RDA0062199 RDA0062404 RDA0065789 RDA0065711 RDA0065681
Colletotri-chum sp. KACC 40014 Daejeon - Capsicum annuum Colletotrichum sp. RDA0061976 RDA0062132 RDA0062340 RDA0065801 RDA0065698 RDA0065666
Open in a new tab

ITS, internal transcribed spacer; TUB2, β-tubulin 2; GAPDH, glyceraldehyde-3-phosphate ehydrogenase; HIS3, histone3; CHS-1, chitin synthase; ACT, actin; RDA, Rural Development Administration; KACC, Korean Agricultural Culture Collection.

Results

Multi-locus phylogeny

The ITS, TUB2, GAPDH, HIS3, CHS-1, and ACT alignments contained 545, 497, 247, 378, 251, and 234 characters including gaps, respectively. Concatenated alignment of six loci included the members in the C. acutatum species complex in this study and references (43 accepted species, and C. orchidophilum as an outgroup). A combined phylogenetic tree (Fig. 1) showed that 64 KACC isolates were composed of six different species and a novel species candidate. Of these, 24 KACC isolates were grouped with the ex-type strain of C. fioriniae (CBS 128517), supported by a 100% ML bootstrap value. Twenty-one KACC isolates were clustered together with the ex-type strain of C. nymphaeae (CBS 515.78) with a 100% ML bootstrap value. Twelve KACC isolates and the ex-type strain of C. scovillei (CBS 126529) formed a single clade with a 99% ML bootstrap value. Three KACC isolates (KACC 40700, KACC 40801, and KACC 47036) were segregated into a separate group with C. chrysanthemi (IMI 364540, authentic strain), well supported by a 100% ML bootstrap value. KACC 47255 and KACC 47254 were in a group with the ex-type strain of C. lupini (CBS 109225) with a 97% ML bootstrap value. A single clade was generated by KACC 42911 and the ex-type strain of C. godetiae (CBS 133.44), well supported with a bootstrap value of 98%. The isolate KACC 40014 formed a single clade and had a distant genetic relationship with others. The GAPDH sequence of KACC 40014 had highest similarities with C. sloanei (IMI 364297, ex-type strain, 97.37%), C. paxtonii (IMI 165753, ex-type strain, 96.93%) and had 93.86% similarity with C. simmondsii (CBS 122122, ex-type strain). The loci of KACC 40014 were lower than 99% similarity with the closely related species such as ACT (98.7% with C. simmondsii and C. paxtonii), HIS3 (98.66% with C. simmondsii and C. sloanei), TUB2 (98.98% with C. paxtonii and 98.57% with C. sloanei), and ITS (98.9% with C. simmondsii). The data suggested that Colletotrichum sp. (KACC 40014) could be considered as a novel species candidate of the genus Colletotrichum.

Fig. 1.

Fig. 1

Open in a new tab

A maximum likelihood tree was generated based on the analysis of multi-locus sequences of internal transcribed spacers (ITS), beta-tubulin 2 (TUB2), histone-3 (HIS3), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), chitin synthase 1 (CHS-1), and actin (ACT). Species names are followed by isolate numbers and their hosts (green). Isolates in this study are in bold (original species names and isolate numbers). Ex-type strains are noted by *. Colletotrichum orchidophilum was used as the outgroup.

Host plants of C. acutatum species complex in this study

C. fioriniae (24 KACC isolates) were collected from 15 different plant species belonging to 15 genera and 11 families with an abundance of Rosaceae (six isolates) and Solanaceae (six isolates). Ten host species (Actinidia chinensis, Capsicum annuum, Camellia sinensis, Cayratia japonica, Chaenomeles sinensis, Machilus thunbergii, Pinus koraiensis, Schizonepeta tenuifolia var. japonica, Spiraea prunifolia var. simpliciflora, and Xylosma congesta) have not been reported in Korea and six of which, including C. japonica, C. sinensis, P. koraiensis, S. tenuifolia var. japonica, S. prunifolia var. simpliciflora and X. congesta, have not been reported in the world. Five species (Cucurbita sp., Lycium chinense, Malus domestica, Paeonia lactiflora, and Solanum melongena) were previously reported in Korea. C. nymphaeae (21 KACC isolates) were isolated from 10 different host species, from nine genera and seven families. Most of them are from the family Rosaceae (10 isolates) and Solanaceae (four isolates). Eight host species (Abies holophylla, Capsicum annuum, Humulus japonicas, Lycopersicon esculentum, Prunus persica, Punica granatum, Pyrus serotina, and Vitis labrusca) have not been reported in Korea, of which two species (A. holophylla and H. japonicus) have not been recorded in the world. Two other species (Diospyros kaki and Malus domestica) were previously reported in Korea. C. scovillei (12 KACC isolates) were obtained from only the family Solanaceae, including 11 isolates from Capsicum annuum (reported in Korea) and one isolate from Lycopersicon esculentum (unreported in the world). C. chrysanthemi (three KACC isolates) was isolated from Coriandrum sativum (unreported in the world) and Carthamus tinctorius (unreported in Korea). C. lupini (two KACC isolates) was found on Lupinus luteus (reported in Korea). C. godetiae (one KACC isolate) was from Symplocarpus renifolius (unreported in the world). A novel species candidate (KACC 40014) was collected from Capsicum annuum (Tables 2 and 3).

Table 3.

Comparison of host plants between KACC isolates and previous reports

Species Host
KACC The List of Plant Diseases Previous reports in Korea Global reports References
C. chrysanthemi Carthamus tinctorius - - Carthamus tinctorius Baroncelli et al. (2015)
Coriandrum sativum * - - - -
- Chrysanthemum coronarium Chrysanthemum coronarium Chrysanthemum coronarium Sato and Moriwaki (2013)
(Continued)
C. fioriniae Actinidia chinensis - - Actinidia chinensis Shivas and Tan (2009)
Capsicum annuum - - Capsicum annuum Noor and Zakaria (2018)
Camellia sinensis - - Camellia sinensis Wang et al. (2016)
Cayratia japonica* - - - -
Chaenomeles sinensis* - - - -
Cucurbita sp. Cucurbita moschata Cucurbita moschata Cucurbita moschata Kim and Kim (2020)
Lycium chinense Lycium chinense Lycium chinense Lycium chinense Oo et al. (2016)
Machilus thunbergii - - Machilus thunbergii Sato et al. (2013)
Malus domestica - Malus domestica Malus domestica Oo et al. (2018)
Paeonia lactiflora Paeonia lactiflora Paeonia lactiflora Paeonia lactiflora Park et al. (2020)
Pinus koraiensis* - - - -
Schizonepeta tenuifolia var. japonica* - - - -
Solanum melongena Solanum melongena Solanum melongena Solanum melongena Xu et al. (2018)
Spiraea prunifolia var. simpliciflora* - - - -
Xylosma congesta* - - -
- Ilex integra Ilex integra Ilex integra Woo et al. (2021)
- Prunus persica Prunus persica Prunus persica Lee et al. (2020)
- - Prunus salicina Prunus salicina Hassan et al. (2019b)
- - Schisandra chinensis Schisandra chinensis Kim et al. (2022)
- - Vaccinium sect. Cyanococcus Vaccinium sect. Cyanococcus Cho et al. (2021)
(Continued)
C. godetiae Symplocarpus renifolius* - - - -
(Continued)
C. lupini Lupinus luteus Lupinus luteus Lupinus luteus - Han et al. (2014)
(Continued)
C. nymphaeae Abies holophylla* - - - -
Capsicum annuum - - Capsicum annuum Nasehi et al. (2016)
Diospyros kaki Diospyros kaki Diospyros kaki Diospyros kaki Hassan et al. (2019a)
Humulus japonicus* - - - -
Lycopersicon esculentum (syn. Solanum lycopersicum ) - - Solanum lycopersicum Santos et al. (2018)
Malus domestica (syn. Malus pumila) - Malus domestica Malus domestica Oo et al. (2018)
C. nymphaeae Prunus persica - - Prunus persica Tan et al. (2022)
Punica granatum - - Punica granatum Xavier et al. (2019)
Pyrus serotina ( syn. P. pyrifolia ) - - Pyrus pyrifolia Moreira et al. (2019)
Vitis labrusca - - Vitis labrusca Chechi et al. (2019)
- Actinidia argute Actinidia argute Actinidia argute Kim et al. (2018)
- Prunus salicina Prunus salicina Prunus salicina Chang et al. (2018)
- - Vaccinium sect. Cyanococcus Vaccinium sect. Cyanococcus Cho el al. (2021)
- - Ziziphus jujube Ziziphus jujube Kang et al. (2023)
(Continued)
C. scovillei Capsicum annuum Capsicum annuum Capsicum annuum Capsicum annuum Oo et al. (2017)
Lycopersicon esculentum* - - - -
(Continued)
Colletotrichum sp. (novel species candidate) Capsicum annuum* - - - -
Open in a new tab

Hosts in “bold” and followed by “*” are unreported in Korea and in the world, respectively.

Discussion

Sixty-four Korean isolates in C. acutatum species complex were accurately identified into six different species (C. fioriniae, C. nymphaeae C. scovillei, C. chrysanthemi, C. lupini, and C. godetiae) and a novel species candidate, based on the combination of multi-locus sequences of ITS, TUB2, HIS3, GAPDH, CHS-1, and ACT. Forty-eight isolates changed their species names from the original names given by depositors. The present results also demonstrated that the identifications of the species in the C. acutatum species complex using a single ITS region and/or TUB2 gene in the previous publications (Han et al., 2014; Kim et al., 2006, 2008; Noh et al., 2014) were insufficient.

C. fioriniae has been reported as an entomopathogenic, endophytic and phytopathogenic fungus (Damm et al., 2012; Marcelino et al., 2008). This species has been reported as the causal agent of anthracnose diseases on Cucurbita moschata, Lycium chinense, Malus domestica, Paeonia lactiflora, Solana melongena, Ilex integra, Prunus persica, Prunus salicina, Schisandra chinensis, and Vaccinium sect. Cyanococcus in Korea. Six of them (M. domestica, P. salicina, S. chinensis, and V. sect. Cyanococcus) were not listed in The List of Plant Diseases in Korea (http://genebank.rda.go.kr/english/plntDissInfo.do), and five species (I. integra, P. persica, P. salicina, S. chinensis, and V. sect. Cyanococcus) were not found in this work. Meanwhile, ten host species of C. fioriniae in this study have not been recorded in Korea or in the world. C. nymphaeae was associated with serious anthracnose diseases in a wide range of host plants, especially strawberries (Fragaria × ananassa) (Damm et al., 2012; Jayawardena et al., 2016). In the previous research, six host species of C. nymphaeae (Diospyros kaki, Malus domestica, Actinidia argute, Prunus salicina, Vaccinium sect. Cyanococcus, and Ziziphus jujube) were reported in Korea, three of that plant (M. domestica, V. sect. Cyanococcus, and Z. jujube) have not been updated in The List of Plant Diseases in Korea, and four species (A. argute, P. salicina, V. sect. Cyanococcus, and Z. jujube) were not recorded in this study. However, eight host species in the present study were not introduced in relationship with this fungal species before in Korea or in the world. C. scovillei has a narrow host range and was commonly reported as one of the highly aggressive diseases of Capsicum spp. in many countries such as Brazil (Giacomin et al., 2021), Korea (Oo et al., 2017) and Asia (de Silva et al., 2019). C. scovillei also infected Clausena lansium (Lin et al., 2020), Mangifera indica (Qin et al., 2019), Musa sp. (Zhou et al., 2017), and Pseudodracontium lacourii (Liu et al., 2022). In our findings, C. scovillei was isolated from Lycopersicon esculentum and this has not been reported in the world.

C. chrysanthemi was only reported in the family Asteraceae, including Carthamus tinctorius in Italy (Baroncelli et al., 2015), Glebionis carinata (vascular discoloration) in the Netherlands, Glebionis coronaria (leaf spot) in China (Damm et al., 2012), Chrysanthemum coronarium in Korea and Calendula officinalis in Japan (Sato and Moriwaki, 2013). In this study, C. chrysanthemi was not only collected from the Asteraceae (Carthamus tinctorius) but also obtained from an unrecorded family Apiaceae (Coriandrum sativum).

C. lupini was first reported to cause anthracnose on yellow lupin (Lupinus luteus) in Korea and Asia in 2013 (Han et al., 2014). This species has a narrow range of host plants, but it showed high virulence and globally widespread disease on some host species of the genus Lupinus (Alkemade et al., 2021). This fungal species was also found on Camellia sp., Cinnamomum verum, Manihot utilissima, and Olea europaea (Alkemade et al., 2021; Damm et al., 2012). C. godetiae was infected economically important crops and had a wide host range and global distribution (Alizadeh et al., 2015; Liu et al., 2022; Shivas et al., 2016; Tan et al., 2022; Tóth et al., 2017). However, this species was not commonly associated with valuable crops in Korea. In our study, this fungal species could be a new finding on Asian skunk cabbage (Symplocarpus renifolius).

On the other hand, considering species under C. acutatum species complex according to economic host plants in this study, C. scovillei (n = 11) was dominant on Capsicum annuum (pepper) and C. nymphaeae (n = 3), C. fioriniae (n = 1) followed. Five C. nymphaeae and four C. fioriniae isolates were identified from Malus spp. including apple. Only four and two isolates of C. nymphaeae were isolated from peach (Prunus persica) and grape (Vitis labrusca), respectively.

The most important finding in this study is that 23 new combinations could be suggested in Korea and 12 of these have not been reported in the world. Of which, C. fioriniae on pepper (Capsicum annuum) and kiwi (Actinidia chinensis), C. nymphaeae on peach (Prunus persica), pear (Pyrus serotina) and grape (Vitis labrusca), and C. scovillei on tomato (Lycopersicon esculentum), are meaningful information in the agricultural field of Korea. However, the pathogenicity of KACC isolates on hosts is not clear. KACC did not confirm the pathogenicity of deposited Colletotrichum isolates on host plants, but depended on only the depositor’s information. Therefore, new combinations suggested in this study need to be clarified via the pathogenicity tests in further studies.

Acknowledgments

This study was supported by a grant (PJ017286) from the National Institute of Agricultural Sciences and was a part of the “2023 KoRAA Long-term Training Program”, Rural Development Administration, Republic of Korea.

Footnotes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Electronic Supplementary Material

Supplementary materials are available at The Plant Pathology Journal website (http://www.ppjonline.org/).

References

  1. Alizadeh A., Javan-Nikkhah M., Zare R., Fotouhifar K. B., Damm U., Stukenbrock E. H. New records of Colletotrichum species for the mycobiota of Iran. Mycol. Iran. 2015;2:95–109. [Google Scholar]
  2. Alkemade J. A., Messmer M. M., Voegele R. T., Finckh M. R., Hohmann P. Genetic diversity of Colletotrichum lupini and its virulence on white and Andean lupin. Sci. Rep. 2021;11:13547. doi: 10.1038/s41598-021-92953-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Baroncelli R., Sarrocco S., Zapparata A., Tavarini S., Angelini L. G., Vannacci G. Characterization and epidemiology of Colletotrichum acutatum sensu lato (C. chrysanthemi) causing Carthamus tinctorius anthracnose. Plant Pathol. 2015;64:375–384. [Google Scholar]
  4. Cai L., Giraud T., Zhang N., Begerow D., Cai G., Shivas R. G. The evolution of species concepts and species recognition criteria in plant pathogenic fungi. Fungal Divers. 2011;50:121–133. [Google Scholar]
  5. Cannon P. F., Damm U., Johnston P. R., Weir B. S. Colletotrichum - current status and future directions. Stud. Mycol. 2012;73:181–213. doi: 10.3114/sim0014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Carbone I., Kohn L. M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia. 1999;91:553–556. [Google Scholar]
  7. Chang T. H., Hassan O., Lee Y. S. First report of anthracnose of Japanese plum (Prunus salicina) caused by Colletotrichum nymphaeae in Korea. Plant Dis. 2018;102:1461. [Google Scholar]
  8. Chechi A., Stahlecker J., Zhang M., Luo C. X., Schnabel G. First report of Colletotrichum fioriniae and C. nymphaeae causing anthracnose on cherry tomatoes in South Carolina. Plant Dis. 2019;103:1042. [Google Scholar]
  9. Cho B.-J., Choi H.-W., Kim D., Lee J. Colletotrichum spp. agents of anthracnose on blueberry leaves in Gangwon province, Korea. J. For. Environ. Sci. 2021;37:154–162. [Google Scholar]
  10. Crouch J. A., Beirn L. A. Anthracnose of cereals and grasses. Fungal Divers. 2009;39:19–44. [Google Scholar]
  11. Crous P. W., Groenewald J. Z., Risède J.-M., Simoneau P., Hywel-Jones N. L. Calonectria species and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Stud. Mycol. 2004;50:415–430. doi: 10.3114/sim.55.1.213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Damm U., Cannon P. F., Woudenberg J. H. C., Crous P. W. The Colletotrichum acutatum species complex. Stud. Mycol. 2012;73:37–113. doi: 10.3114/sim0010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Damm U., O’Connell R. J., Groenewald J. Z., Crous P. W. The Colletotrichum destructivum species complex - hemibiotrophic pathogens of forage and field crops. Stud. Mycol. 2014;79:49–84. doi: 10.1016/j.simyco.2014.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Damm U., Sato T., Alizadeh A., Groenewald J. Z., Crous P. W. The Colletotrichum dracaenophilum, C. magnum and C. orchidearum species complexes. Stud. Mycol. 2019;92:1–46. doi: 10.1016/j.simyco.2018.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Damm U., Woudenberg J. H. C., Cannon P. F., Crous P. W. Colletotrichum species with curved conidia from herbaceous hosts. Fungal Divers. 2009;39:45–87. [Google Scholar]
  16. de Silva D. D., Groenewald J. Z., Crous P. W., Ades P. K., Nasruddin A., Mongkolporn O., Taylor P. W. J. Identification, prevalence and pathogenicity of Colletotrichum species causing anthracnose of Capsicum annuum in Asia. IMA Fungus. 2019;10:8. doi: 10.1186/s43008-019-0001-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Garrido C., Carbú M., Fernández-Acero F. J., Vallejo I., Cantoral J. M. Phylogenetic relationships and genome organisation of Colletotrichum acutatum causing anthracnose in strawberry. Eur. J. Plant Pathol. 2009;125:397–411. [Google Scholar]
  18. Giacomin R. M., de Fátima Ruas C., Baba V. Y., De Godoy S. M., Sudré C. P., dos Santos Bento C., Da Cunha M., Da Costa Geronimo I. G., Rodrigues R., Gonçalves L. S. Phenotypic, molecular and pathogenic characterization of Colletotrichum scovillei infecting Capsicum species in Rio de Janeiro, Brazil. PeerJ. 2021;9:e10782. doi: 10.7717/peerj.10782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Glass N. L., Donaldson G. C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microbiol. 1995;61:1323–1330. doi: 10.1128/aem.61.4.1323-1330.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. González E., Sutton T. B., Correll J. C. Clarification of the etiology of Glomerella leaf spot and bitter rot of apple caused by Colletotrichum spp. based on morphology and genetic, molecular and pathogenicity tests. Phytopathology. 2006;96:982–992. doi: 10.1094/PHYTO-96-0982. [DOI] [PubMed] [Google Scholar]
  21. Guerber J. C., Liu B., Correll J. C., Johnston P. R. Characterization of diversity in Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, mtDNA and intron RFLPs, and mating compatibility. Mycologia. 2003;95:872–895. [PubMed] [Google Scholar]
  22. Han K. S., Kim B. S., Choi I. Y., Park J. H., Shin H. D. First report of anthracnose caused by Colletotrichum lupini on yellow lupin in Korea. Plant Dis. 2014;98:1158. doi: 10.1094/PDIS-02-14-0175-PDN. [DOI] [PubMed] [Google Scholar]
  23. Hassan O., Lee D. W., Chang T. First report of anthracnose of persimmon caused by Colletotrichum nymphaeae in Korea. Plant Dis. 2019a;103:1772. [Google Scholar]
  24. Hassan O., Lee Y. S., Chang T. Colletotrichum species associated with Japanese plum (Prunus salicina) anthracnose in South Korea. Sci. Rep. 2019b;9:12089. doi: 10.1038/s41598-019-48108-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hyde K. D., Cai L., Cannon P. F., Crouch J. A., Crous P. W., Damm U., Goodwin P. H., Chen H., Johnston P. R., Jones E. B. G., Liu Z. Y., McKenzie E. H. C., Moriwaki J., Noireung P., Pennycook S. R., Pfenning L. H., Prihastuti H., Sato T., Shivas R. G., Tan Y. P., Taylor P. W. J., Weir B. S., Yang Y. L., Zhang J. Z. Colletotrichum – names in current use. Fungal Divers. 2009;39:147–182. [Google Scholar]
  26. Jayawardena R. S., Bhunjun C. S., Hyde K. D., Gentekaki E., Itthayakorn P. Colletotrichum: lifestyles, biology, morpho-species, species complexes and accepted species. Mycosphere. 2021;12:519–669. [Google Scholar]
  27. Jayawardena R. S., Hyde K. D., Damm U., Cai L., Liu M., Li X. H., Zhang W., Zhao W. S., Yan J. Y. Notes on currently accepted species of Colletotrichum. Mycosphere. 2016;7:1192–1260. [Google Scholar]
  28. Kang E. C., Hassan O., Kim K.-M., Chang T. Molecular characterization and fungicide sensitivity of jujube pathogens Colletotrichum gloeosporioides sensu stricto and Colletotrichum nymphaeae in South Korea. Plant Dis. 2023;107:861–869. doi: 10.1094/PDIS-04-22-0942-RE. [DOI] [PubMed] [Google Scholar]
  29. Kim C. H., Hassan O., Chang T. Diversity, pathogenicity, and fungicide sensitivity of Colletotrichum species associated with apple anthracnose in South Korea. Plant Dis. 2020;104:2866–2874. doi: 10.1094/PDIS-01-20-0050-RE. [DOI] [PubMed] [Google Scholar]
  30. Kim D.-H., Jeon Y.-A., Go S.-J., Lee J.-K., Hong S.-B. Reidentification of Colletotrichum gloeosporioides and C. acutatum isolates stored in Korean Agricultural Culture Collection (KACC) Res. Plant Dis. 2006;12:168–177. (in Korean) [Google Scholar]
  31. Kim G. H., Choi D. H., Park S. Y., Koh Y. J. First report of anthracnose caused by Colletotrichum nymphaeae on kiwiberry in Korea. Plant Dis. 2018;102:1455. [Google Scholar]
  32. Kim J., Hassan O., Kim K.-M., Chang T. First report of Colletotrichum fioriniae causing anthracnose on the fruit of omija (schisandra) in South Korea. Plant Dis. 2022;106:2991. doi: 10.1094/PDIS-03-22-0471-PDN. [DOI] [PubMed] [Google Scholar]
  33. Kim J. T., Park S.-Y., Choi W., Lee Y.-H., Kim H. T. Characterization of Colletotrichum isolates causing anthracnose of pepper in Korea. Plant Pathol. J. 2008;24:17–23. [Google Scholar]
  34. Kim J.-Y., Kim B.-S. First report of Colletotrichum fioriniae causing anthracnose on fruit of pumpkin (Cucurbita moschata) in Korea. Res. Plant Dis. 2020;26:190–193. (in Korean) [Google Scholar]
  35. Kwon J.-H., Kim J. First report of fruit black spot of Diospyros kaki caused by Colletotrichum acutatum in Korea. Plant Pathol. J. 2011;27:100. [Google Scholar]
  36. Lee D. H., Kim D.-H., Jeon Y.-A., Uhm J. Y., Hong S.-B. Molecular and cultural characterization of Colletotrichum spp. causing bitter rot of apples in Korea. Plant Pathol. J. 2007;23:37–44. [Google Scholar]
  37. Lee D. M., Hassan O., Chang T. Identification, characterization, and pathogenicity of Colletotrichum species causing anthracnose of peach in Korea. Mycobiology. 2020;48:210–218. doi: 10.1080/12298093.2020.1763116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lenné J. M. Some major plant diseases. In: Waller J. M., Lenné J. M., Waller S. J., editors. Plant pathologist’s pocketbook. 3rd ed. CAB International; Wallingford, UK: 2002. pp. 4–18. [Google Scholar]
  39. Lin C.-H., Long X.-P., Li Z.-P., Zhang Y., He J.-J., Liu W.-B., Miao W.-G. First report of anthracnose of Clausena lansium caused by Colletotrichum scovillei in China. Plant Dis. 2020;104:1557. [Google Scholar]
  40. Liu F., Ma Z. Y., Hou L. W., Diao Y. Z., Wu W. P., Damm U., Song S., Cai L. Updating species diversity of Colletotrichum, with a phylogenomic overview. Stud. Mycol. 2022;101:1–56. doi: 10.3114/sim.2022.101.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Marcelino J., Giordano R., Gouli S., Gouli V., Parker B. L., Skinner M., TeBeest D., Cesnik R. Colletotrichum acutatum var. fioriniae (teleomorph: Glomerella acutata var. fioriniae var. nov.) infection of a scale insect. Mycologia. 2008;100:353–374. doi: 10.3852/07-174r. [DOI] [PubMed] [Google Scholar]
  42. Moreira R. R., Peres N. A., May De Mio L. L. Colletotrichum acutatum and C. gloeosporioides species complexes associated with apple in Brazil. Plant Dis. 2019;103:268–275. doi: 10.1094/PDIS-07-18-1187-RE. [DOI] [PubMed] [Google Scholar]
  43. Nasehi A., Kadir J., Rashid T. S., Awla H. K., Golkhandan E., Mahmodi F. Occurrence of anthracnose fruit rot caused by Colletotrichum nymphaeae on pepper (Capsicum annuum) in Malaysia. Plant Dis. 2016;100:1244. [Google Scholar]
  44. Nguyen P. T. H., Vinnere Pettersson O., Olsson P., Liljeroth E. Identification of Colletotrichum species associated with anthracnose disease of coffee in Vietnam. Eur. J. Plant Pathol. 2010;127:73–87. [Google Scholar]
  45. Noh Y.-H., Kim Y.-E., Song M.-J., An J.-H., Jeong M.-J., Hong S.-B., Kim S.-H., Lee H.-I., Cha J.-S. Post-harvest decay of ‘Campbell early’ grape. Res. Plant Dis. 2014;20:275–282. (in Korean) [Google Scholar]
  46. Noor N. M., Zakaria L. Identification and characterization of Colletotrichum spp. associated with chili anthracnose in peninsular Malaysia. Eur. J. Plant Pathol. 2018;151:961–973. [Google Scholar]
  47. O’Donnell K., Cigelnik E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol. 1997;7:103–116. doi: 10.1006/mpev.1996.0376. [DOI] [PubMed] [Google Scholar]
  48. Oh I.-S. Ph.D. thesis. Chungnam National University; Daejeon, Korea: 1995. Taxonomy and pathogenicity of Colletotrichum spp. from red pepper (Capsicum annuum) [Google Scholar]
  49. Oo M. M., Lim G., Jang H. A., Oh S.-K. Characterization and pathogenicity of new record of anthracnose on various chili varieties caused by Colletotrichum scovillei in Korea. Mycobiology. 2017;45:184–191. doi: 10.5941/MYCO.2017.45.3.184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Oo M. M., Tweneboah S., Oh S.-K. First report of anthracnose caused by Colletotrichum fioriniae on Chinese matrimony vine in Korea. Mycobiology. 2016;44:325–329. doi: 10.5941/MYCO.2016.44.4.325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Oo M. M., Yoon H.-Y., Jang H. A., Oh S.-K. Identification and characterization of Colletotrichum species associated with bitter rot disease of apple in South Korea. Plant Pathol. J. 2018;34:480–489. doi: 10.5423/PPJ.FT.10.2018.0201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Park M.-J., Lee J.-H., Back C.-G., Park J.-H. First report of Colletotrichum fioriniae causing anthracnose on Paeonia lactiflora in Korea. Plant Dis. 2020;104:3259. [Google Scholar]
  53. Peres N. A., Mackenzie S. J., Peever T. L., Timmer L. W. Postbloom fruit drop of citrus and key lime anthracnose are caused by distinct phylogenetic lineages of Colletotrichum acutatum. Phytopathology. 2008;98:345–352. doi: 10.1094/PHYTO-98-3-0345. [DOI] [PubMed] [Google Scholar]
  54. Qin L. P., Zhang Y., Su Q., Chen Y. L., Nong Q., Xie L., Yu G. M., Huang S. L. First report of anthracnose of Mangifera indica caused by Colletotrichum scovillei in China. Plant Dis. 2019;103:1043. [Google Scholar]
  55. Sanders G. M., Korsten L. Comparison of cross inoculation potential of South African avocado and mango isolates of Colletotrichum gloeosporioides. Microbiol. Res. 2003;158:143–150. doi: 10.1078/0944-5013-00186. [DOI] [PubMed] [Google Scholar]
  56. Santos R. F., Ciampi-Guillardi M., Amorim L., Massola N. S., Júnior, Spósito M. B. Aetiology of anthracnose on grapevine shoots in Brazil. Plant Pathol. 2018;67:692–706. [Google Scholar]
  57. Sato T., Moriwaki J. Molecular re-identification of strains in NIAS Genebank belonging to phylogenetic groups A2 and A4 of the Colletotrichum acutatum species complex. Microbiol. Cult. Coll. 2013;29:13–23. [Google Scholar]
  58. Sato T., Moriwaki J., Misawa T. Molecular re-identification of strains of the Colletotrichum acutatum species complex deposited in the NIAS Genebank and morphological characteristics of its member species. Jpn. Agric. Res. Q. 2013;47:295–305. [Google Scholar]
  59. Shivas R. G., Tan Y. P. A taxonomic re-assessment of Colletotrichum acutatum, introducing C. fioriniae comb. et stat. nov. and C. simmondsii sp. nov. Fungal Divers. 2009;39:111–122. [Google Scholar]
  60. Shivas R. G., Tan Y. P., Edwards J., Dinh Q., Maxwell A., Andjic V., Liberato J. R., Anderson C., Beasley D. R., Bransgrove K., Coates L. M., Cowan K., Daniel R., Dean J. R., Lomavatu M. F., Mercado-Escueta D., Mitchell R. W., Thangavel R., Tran-Nguyen L. T. T., Weir B. S. Colletotrichum species in Australia. Australas. Plant Pathol. 2016;45:447–464. [Google Scholar]
  61. Sutton B. C. The Coelomycetes. Fungi imperfecti with pycnidia, acervuli and stromata. Commonwealth Mycological Institute; Kew, UK: 1980. p. 696. [Google Scholar]
  62. Sutton B. C. The genus Glomerella and its anamorph Colletotrichum. In: Bailey J. A., Jeger M. J., editors. Colletotrichum: biology, pathology and control. CAB International; Wallingford, UK: 1992. pp. 1–26. [Google Scholar]
  63. Talhinhas P., Mota-Capitão C., Martins S., Ramos A. P., Neves-Martins J., Guerra Guimarães L., Várzea V., Silva M. C., Sreenivasaprasad S., Oliveira H. Epidemiology, histopathology and aetiology of olive anthracnose caused by Colletotrichum acutatum and C. gloeosporioides in Portugal. Plant Pathol. 2011;60:483–495. [Google Scholar]
  64. Tamura K., Stecher G., Kumar S. MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021;38:3022–3027. doi: 10.1093/molbev/msab120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Tan Q., Schnabel G., Chaisiri C., Yin L. F., Yin W. X., Luo C. X. Colletotrichum species associated with peaches in China. J. Fungi (Basel) 2022;8:313. doi: 10.3390/jof8030313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Tóth A., Petróczy M., Palkovics L. First report of Colletotrichum acutatum sensu lato through the occurrence of C. godetiae on cornelian cherry (Cornus mas) in Europe. Plant Dis. 2017;101:841. [Google Scholar]
  67. von Arx J. A. Die arten der gattung Colletotrichum cda. Phytopathol. J. 1957;29:413–468. (in German) [Google Scholar]
  68. Wang Y.-C., Hao X.-Y., Wang L., Xiao B., Wang X.-C., Yang Y.-J. Diverse Colletotrichum species cause anthracnose of tea plants (Camellia sinensis (L.) O. Kuntze) in China. Sci. Rep. 2016;6:35287. doi: 10.1038/srep35287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. White T. J., Bruns T., Lee S., Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M. A., Gelfand D. H., Sninsky J. J., White T. J., editors. PCR protocols: a guide to methods and applications. Academic Press; New York, USA: 1990. pp. 315–322. [Google Scholar]
  70. Woo J., Kim J.-E., Kim M., Cha B. First report of mochi tree (Ilex integra) anthracnose caused by Colletotrichum fioriniae in Korea. Plant Dis. 2021;105:1218. doi: 10.1094/PDIS-07-20-1559-PDN. [DOI] [PubMed] [Google Scholar]
  71. Xavier K. V., Kc A. N., Peres N. A., Deng Z., Castle W., Lovett W., Vallad G. E. Characterization of Colletotrichum species causing anthracnose of pomegranate in Southeastern United States. Plant Dis. 2019;103:2771–2780. doi: 10.1094/PDIS-03-19-0598-RE. [DOI] [PubMed] [Google Scholar]
  72. Xu S. J., Aktaruzzaman M., Kim B. S., Kim J. Y., Shin H. D. First report of anthracnose caused by Colletotrichum fioriniae on eggplant fruits in Korea. Plant Dis. 2018;102:2642. [Google Scholar]
  73. Zhou Y., Huang J. S., Yang L. Y., Wang G. F., Li J. Q. First report of banana anthracnose caused by Colletotrichum scovillei in China. Plant Dis. 2017;101:381. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

PPJ-OA-05-2023-0078-Supplementary-Table-1.pdf (366.2KB, pdf)

Articles from The Plant Pathology Journal are provided here courtesy of The Korean Society of Plant Pathology

RESOURCES