Pigeon MDA5 inhibits viral replication by triggering antiviral innate immunity

Abstract

Pigeons are considered less susceptible, and display few or no clinical signs to infection with avian influenza virus (AIV). Melanoma differentiation-associated gene 5 (MDA5), an important mediator in innate immunity, has been linked to the virus resistance. In this study, the pigeon MDA5 (piMDA5) was cloned. The bioinformatics analysis showed that the C-terminal domain (CTD) of MDA5 is highly conserved among species while the N-terminal caspase recruitment domain (CARD) is variable. Upon infection with Newcastle diseases virus (NDV) and AIV, piMDA5 was upregulated in both pigeons and pigeon embryonic fibroblasts (PEFs). Further study found that overexpression of piMDA5 mediated the activation of interferons (IFNs) and IFN-stimulated genes (ISGs) while inhibiting NDV replication. Conversely, the knockdown of piMDA5 promoted NDV replication. Additionally, CARD was found to be essential for the activation of IFN-β by piMDA5. Furthermore, pigeon MDA5, chicken MDA5, and human MDA5 differ in inhibiting viral replication and inducing ISGs expression. These findings suggest that MDA5 contributes to suppressing viral replication by activating the IFN signal pathway in pigeons. This study provides valuable insight into the role of MDA5 in pigeons and a better understanding of the conserved role of MDA5 in innate immunity during evolution.

INTRODUCTION

Pigeon is one member of the Columbidae family, and homing pigeons are a common food in numerous countries. In 2013, 9 hospitalized patients who tested positive for H7N9 were poultry workers, and one of those raised pigeons (Li et al., 2014). Also, the zoonotic low pathogenic avian influenza H7N9 has been detected in healthy pigeons (Abolnik, 2014); this indicates that pigeons may be the reservoir of viruses causing mammals infections. Birds display a difference in susceptibility to avian influenza virus (AIV) infection as well as symptoms. Compared with ducks and chickens, pigeons can be infected with low to medium titers of the virus, but usually not show clinical signs, even when infected with highly pathogenic avian influenza (HPAI) strains (Abolnik, 2014). Only a few pigeons developed specific antibodies when pigeons received high dose of AIV (Abolnik et al., 2018). The innate immune system may be at play, but it needs research to explore.

Innate immunity, a widely distributed and evolutionarily conserved form of immunity, is defined as the first line of defense against multiple invaded pathogens. During viral and bacterial infection, the host utilizes the pattern recognition receptors (PRRs) to recognize nonself but specific and conserved microbial structures called pathogen-associated molecular patterns (PAMPs) and initiates related signaling pathway, which ultimately induces the production of type I interferons (IFNs), interferon-stimulator genes (ISGs), and other pro-inflammatory cytokines (Wu and Chen, 2014; Hu et al., 2017; Carty et al., 2020). PRRs are classified into DNA and RNA receptors. DNA receptors include many members, such as toll-like receptor 9 (TLR9), absent in melanoma 2 (AIM2), DNA-dependent activator of IFN-regulatory factors (DAI), cyclic GMP-AMP synthase (cGAS), and so on (Takaoka et al., 2007; Sun et al., 2013; Gray et al., 2016). Microorganisms containing RNA could be recognized by toll-like receptor 3 (TLR3), toll-like receptor 7 (TLR7), toll-like receptor 8 (TLR8), and retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs) (Akira and Hemmi, 2003; Yoneyama et al., 2004; Loo et al., 2008). The activation of PRRs is critical for the host to induce the expression of ISGs, inhibit the replication of pathogens and finally establish the antimicrobial state (Yang and Shu, 2020).

RIG-I and melanoma differentiation-associated gene 5 (MDA5) are the major RNA sensors, which contain 2 N-terminal tandem caspase recruitment domains (CARDs), a helicase domain, and a C-terminal domain (CTD) (Yoneyama and Fujita, 2008). RIG-I and MDA5 share similar regulation mechanisms. In the unstimulated cells, both of them are phosphorylated to suppress their activation (Wies et al., 2013a; Takashima et al., 2015); during viral infection, they are dephosphorylated and ubiquitinated to induce the formation of 2CARD tetramer and the activation of mitochondrial antiviral signaling protein (MAVS) (Seth et al., 2005; Gack et al., 2007; Oshiumi et al., 2010; Wies et al., 2013b; Lang et al., 2017). The differences between RIG-I and MDA5 enable them to function in detecting short and long dsRNA, which makes them nonredundant in antiviral innate immunity (Yoneyama and Fujita, 2008; Wu et al., 2013; Brisse and Ly, 2019). As an important RNA receptor, MDA5 senses long dsRNA and activates MAVS through CARDs, which triggers the downstream signaling transduction, including the production of IFNs, TNFα and ILs (Loo et al., 2008; Fullam and Schroder, 2013). These cytokines are critical for the host to eliminate the invaded pathogens and maintain the balance of immunity (Akira et al., 2006).

In mammals, the specific roles and regulation of MDA5 in innate immunity have been studied clearly; but the characterization of MDA5 in avian innate immunity remains to be explored. Compared to mammals, poultry especially chicken have fewer innate immune genes (Magor et al., 2013). Meanwhile, RNA virus infection induces different symptoms among poultry, which may be related to the loss of immune genes. The absence of RIG-I in chicken enlarges the range of MDA5 ligands, which makes MDA5 unique in the anti-RNA virus innate immunity (Barber et al., 2010). Chicken MDA5(chMDA5) is upregulated and related to IFN responses of cells infected with RNA virus (Karpala et al., 2011; Hayashi et al., 2014; Lee et al., 2014). Also, duck MDA5 (duMDA5) and goose MDA5 (goMDA5) have been reported to function in innate immunity against viral infection (Wei et al., 2013; Wei et al., 2014; Li et al., 2021). Besides, duMDA5 involves in duck enteritis virus (DEV) (DNA virus) infection (Huo et al., 2019). And LGP2 downregulated IFN-β production induced by duMDA5 in a concentration-dependent manner (Huo et al., 2019). However, the function and characterization of pigeon MDA5 (piMDA5) is not clear.

In this study, we investigated the functions of piMDA5 in innate immunity. First, we cloned and characterized the full-length coding sequence of piMDA5.Then we detected the level of piMDA5 mRNA both in vivo and in vitro postviral infection. The results suggest that piMDA5 regulates IFN-β and ISGs mRNA expression to inhibit NDV infection and the N-terminal CARD domain is essential for its function. Besides, pigeon MDA5, chicken MDA5, and human MDA5 show different abilities to resist viral infection and activate IFN-β. These findings help to understand poultry innate immunity and provide data for further research of innate immunity between birds and mammals.

MATERIALS AND METHODS

Cells and Virus

Pigeon embryonic fibroblasts (PEFs) were isolated at embryonic d 9. DF-1 cell is a chicken embryonic fibroblast cell line from East Lansing strain eggs, was stored as in previous study (Cheng et al., 2015). The PEFs and DF-1 cells were cultured in high-glucose Dulbecco's Modified Eagle Medium (DMEM) (Gibco, California) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% penicillin-streptomycin (Gibco). All cells were maintained at a 5% CO₂ and 37°C incubator. AIV and Green fluorescent protein (GFP)-tagged NDV (NDV-GFP) are stored in our laboratory. The A/chicken/Shanghai/010/2008 (H9N2) virus (SH010), an H9N2 subtype of AIV, was isolated from chickens in Shanghai, China, in 2008. These viruses are stored in our laboratory.

Ethics Statement

The animal experiment was approved by the Animal Ethics Committee of Shanghai Veterinary Research Institute (Shanghai, China). The Animal Experimental Ethics Review Number was “SHVRI-SZ-20191101-01.” All animal experiments were performed according to the guidelines for Animal Experimentation of the Shanghai Veterinary Research Institute.

Animal Infection Experiments

Six pigeons (2 male pigeons and 1 female pigeon for each group) were intramuscularly inoculated with 0.1 mL of NDV/AIV per pigeon (2 × 10⁴ TCID₅₀/mL) as the infection group, whereas the other 3 pigeons received 0.1 mL of PBS per pigeon as the control group. Three pigeons in each group were killed at 3 d postinfection (dpi). Tissue samples including trachea, spleen, bursa, muscle, kidney, lung, cardiac, small intestine, blood, liver, thymus, and large intestine were collected for further analysis.

Cloning and Bioinformatic Analysis of piMDA5

According to the predicted coding sequence of pigeon MDA5 (XP_021146627.1_1) from the National Center for Biotechnology Information (NCBI), the primers were designed, and piMDA5 cDNA was amplified from cell samples via polymerase chain reaction (PCR). The PCR product was ligated into a pTOPO-Blunt vector (CV1701, Aidlab Biotech, Beijing, China) for sequencing, and the positive colonies were sent to the Sangon Biotech (Shanghai, China) for sequencing. The sequence alignment of MDA5 amino acids from 8 animals was performed with Clustal W (https://www.genome.jp/tools-bin/clustalw) and edited with ESPript 3.0 (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi) (Robert and Gouet, 2014). A phylogenetic tree was conducted with Megalign using the neighbor-joining method based on the amino acids of MDA5. PiMDA5 domains were predicted with SMART (http://smart.embl-heidelberg.de) (Letunic et al., 2021). And Swiss-model was used to predict the three-dimensional structure of piMDA5 (https://swissmodel.expasy.org/) (Studer et al., 2020).

Plasmid Construction

Flag-tagged piMDA5 plasmid (pcDNA4.0-Flag- piMDA5) was constructed by inserting the full-length piMDA5 into the EcoR I and EcoR V sites pcDNA4.0-Flag of the expression vector using a CloneExpress II One-Step Cloning Kit (10912ES10, Yeasen, Shanghai, China). The truncated plasmids of piMDA5, including deletion of amino acids 6 to 98 (dCARD1), d111-289 aa (dCARD2), d395-610 aa (dRLR), d714-808 aa (dHelic), and d882-999 aa (dCTD), were constructed with the modified homologous recombination method. The DH5α Chemically Competent Cell (Tsingke Biological Technology, Beijing, China) was used for plasmid transformation. The chicken IFN-β promoter luciferase reporter plasmid (chIFN-β-Luc) and pcDNA4.0-Flag plasmid were stored in our laboratory. All primers used for cloning are listed in Table 1.

Table 1.

Primer sequences for PCR and their applications in this study.

Target gene	Purpose	Name	Sequence of Oligonucleotide (5′–3′)
piMDA5	To obtain sequence	piMDA5 1F	ATGGGAGAAGAGTCCCGAGACG
		piMDA5 1R	CTAATCTTCATCACTTGAAGGGC
		piMDA5 2F	ACAGTTGCGAAACACTTTAATGGAGG
		piMDA5 2R	CTTCTAGTAGATGTTTCCAGTACAC
		piMDA5 3F	GCCATTGTGGAGGATTTGAAACAGC
		piMDA5 3R	GCAAAGGCACTGAGCCGAG
	Construction of piMDA5	pcDNA4.0-Flag F	agtgtggtggaattct ATGGGAGAAGAGTCCCGAGA
		pcDNA4.0-Flag R	ACTGTGCTGGATATCCTAATC ttcatcacttgaag
	Construct truncated forms of piMDA5	piMDA5 dCARD1 F	AGCCAGCTGCCATCG
		piMDA5 dCARD1 R	CGATGGCAGCTGGCTTCGGGACTCTTCTCCCATGA
		piMDA5 dCARD2 F	GGAGGCCGACGGAGGAGAAATGGAAAGCAGATCTTC
		piMDA5 dCARD2 R	TCCTCCGTCGGCCTCCTCGGC
		piMDA5 dRLR F	TCGGATGGTGTCATTTTTCAGCTGAGAATCGCCAC
		piMDA5 dRLR R	AATGACACCATCCGAATGG
		piMDA5 dHelic F	GACTCGGCTCAGTGCCGAGAGCACCTATGCACTTG
		piMDA5 dHelic R	GGCACTGAGCCGAGTCT
		piMDA5 dCTD F	GCAGCTCATTGCCCTT
		piMDA5 dCTD R	AGGGCAATGAGCTGCATTTTTCTTGTATGTCTTGC
	Construct shRNA of piMDA5	shMDA5-1# F	GAAAGGACGAAACACCGGTACCATTGGTAGAACAACATTCAAGAGATGTTG
		shMDA5-1# R	TAGAACTAGTGGATCCAAAAAGGTACCATTGGTAGAACAACATCTCTTGAATGTTG
		shMDA5-2# F	GAAAGGACGAAACACCGCCAATCTCGATGCGTGTAGATTCAAGAGATCTAC
		shMDA5-2# R	TAGAACTAGTGGATCCAAAAAGCCAATCTCGATGCGTGTAGATCTCTTGAATCTAC

Luciferase Reporter Assays

The PEF or DF-1 cells were plated in 24-well plates (NEST Biotechnology, Wuxi, China) and cultured to 95% to 100% confluence; they were then transiently transfected with reporter plasmid chIFN-β (0.1 µg/well), internal control Renilla luciferase (pRL-TK, 0.05 µg/well) and the indicated plasmids, using Nulen PlusTrans Transfection Reagent (Nulen, Shanghai, China). The cells were lysed 24 h post-transfection, and the luciferase activity was detected with the Dual-Luciferase Reporter Assay System (Promega, Wisconsin) according to the instructions. Renilla luciferase activity was used for normalization. All reporter assays were repeated at least three times.

RNA Extraction and Quantitative Real-Time PCR

Total RNA was extracted from the cell lines or tissues by using AG RNAex Pro Reagent (AG21101, Accurate Biology, Hunan, China) based on the instructions. The RNA was reverse transcribed to cDNA with the reverse transcription kits (Q121-02, Vazyme, Nanjing, China). Quantitative real-time PCR (qRT-PCR) tests were conducted by using the ABI 7500 RT-PCR system with AceQ qPCR SYBR Green Master Mix (Without ROX) (Q121-02, Vazyme). The conditions and data processing method for the qRT-PCR were the same as in our previous study (Cheng et al., 2017). All primers used in this study are listed in Table 2.

Table 2.

Primer sequences for qRT-PCR and their applications in this study.

Target gene	Purpose	Name	Sequence of oligonucleotides (5′–3′)
piIFN-γ	qRT-PCR	qpiIFN-γ F	ACCTCAAGGATCTGGCAAAG
		qpiIFN-γ R	GCTGGAGTATCCACCAGTTT
piIFN-α		qpiIFN-α F	CACCATCATCTCCAGTCATCAG
		qpiIFN-α R	CTTAGACATCGCTGTGGAAACT
piGAPDH		qpiGAPDH F	ATGACCACTGTCCATGCTATC
		qpiGAPDH R	GCTCCAGTAGATGCTGGAATAA
piMDA5		qpiMDA5 F	GGAAGGCCTAGACATCAAAGAA
		qpiMDA5 R	AAGTGCATAGGTGCTCTCATC
piPKR		qpiPKR F	GACTTCGGTCTTGTGACTTCTC
		qpiPKR R	GACTGTTCTGGTGCCATGTAT
chIFN-β	qRT-PCR	qchIFN-β F	CCTCAACCAGATCCAGCATT
		qchIFN-β R	GGATGAGGCTGTGAGAGGAG
chMX1		qchMX1 F	GTTTCGGACATGGGGAGTAA
		qchMX1 R	GCATACGATTTCTTCAACTTTGG
chβ-actin		qchβ-actin F	CAGACATCAGGGTGTGATGG
		qchβ-actin R	TCAGGGGCTACTCTCAGCTC
huIFN-β	qRT-PCR	qhuIFN-β F	GTCACTGTGCCTGGACCATAG
		qhuIFN-β R	GTTTCGGAGGTAACCTGTAAGTC
huMX1		qhuMX1 F	AGCGGGATCGTGACCAGAT
		qhuMX1 R	TGACCTTGCCTCTCCACTTATC
huOASL		qhuOASL F	CGGCCAACTAAGCTGAAGA
		qhuOASL R	CCCAGGCATAGATGGTTAGAAG
huβ-actin		qhuβ-actin F	TTTTGGCTATACCCTACTGGCA
		qhuβ-actin R	CTGCACAGTCGTCAGCATATC

Western Blot Analysis

The PEFs or DF-1 cells were plated in 12-well plates at 10⁶/mL and transfected with various plasmids. Twenty-four hours post-transfection, the cells were washed twice with phosphate buffer saline (PBS) (Gibco, California) and then lysed with RIPA Lysis Buffer (Beyotime, Shanghai, China) containing an InStab protease cocktail (Yeasen, Shanghai, China) and phenylmethylsulfonyl fluoride (PMSF) (Yeasen). Western blot analysis was performed according to standard protocols (Wang et al., 2022). Images were obtained using the Tanon 5200 imaging system (Tanon, Shanghai, China), as described in our previous study (Lin et al., 2021).

Viral Infection

The PEFs were plated in 12-well plate, washed twice with PBS (Gibco), and infected with NDV-GFP. Following absorption for 1 h, the unattached viruses were removed, and the cells were washed three times with PBS and cultured in a 2% FBS medium. After viral infection, the cell samples were used for Western blot analysis. The replication of intracellular NDV in the infected-DF-1 cells was detected by Western blot based on GFP expression. The fluorescence from the cells was measured 24 h after infection using the fluorescence microscope.

Statistical Analysis

The data were expressed as means ± standard deviations. Significance was determined using one-way ANOVA or a two-tailed independent Student's t-test (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

RESULTS

Cloning and the Conserved Sequences Analysis of piMDA5

To explore the role of piMDA5 in innate immunity, piMDA5 was cloned and performed bioinformatic analysis. The full length of piMDA5 gene is 3030 bp, which encodes 1,009 amino acids (Figure S1A). Then, we predicted the domains of piMDA5 with SMART. PiMDA5 has the same domains as human MDA5, a CARD1 domain (6-98aa), a CARD2 domain (111-289aa), a RLR domain (395-610aa), a Helic domain (714-808aa), and a CTD domain (882-999aa) (Figure S1B). MDA5 protein sequence of human (Homo sapiens, NP_071451.2), monkey (Macaca mulatta, NP_001040588.1), mouse (Mus musculus, NP_001157949.1), bat (Molossus molossus, XP_036110048.1), zebrafish (Danio rerio, NP_001295492.1), chicken (Gallus gallus, NP_001180567.2), duck (Oxyura jamaicensis, XP_035187420.1), and pigeon (Columba livia, XP_021146627.1_1) were performed the multiple sequence alignment. The results show that MDA5 is highly conserved in poultry. And the N-terminal CARD of MDA5, which is responsible for the signaling transduction of MDA5, varies between poultry and mammals. Besides, the RLR, Helic, and CTD domains have high similarities in these species (Figure S1B).

Phylogenetic Tree Analysis and the Predicted Three-Dimensional Model of piMDA5

As an important RNA sensor, MDA5 plays a critical role in anti-RNA innate immunity, especially in chickens. Through the analysis of MDA5 sequences, piMDA5 has a homology of 83.5% and 86.6% to chMDA5 and duMDA5, respectively, and lower to mammals MDA5 (Figure S2A). Further, we obtained MDA5 protein sequences from the NCBI database and construct the phylogenetic tree, which consists of three major branches, including mammals, poultry, and fishes (Figure S2C). Consistent with the previous result, MDA5 within avian is highly conserved and belongs to the first subgroup. Moreover, the similarity between pigeons and eagles is higher than that of pigeons and other poultry, such as chickens, ducks, and geese. And MDA5 of mammals is the second subgroup (Figure S2C). MDA5 of zebrafish has only 48.9% and 49.3% similarities with that of pigeons and human, respectively (Figure S2A). This suggests MDA5 may play a different role in innate immunity. The predicted three-dimensional (3D) model of piMDA5 with Swiss-model is shown in Figure S2B.

Tissue Distribution of piMDA5 Expression

To identify the tissue distribution of piMDA5 in pigeons, tissues samples including trachea, spleen, bursa, muscle, kidney, lung, cardiac, small intestine, blood, liver, thymus, and large intestine were collected, and the mRNA levels of MDA5 were detected. The results showed that piMDA5 is widely expressed in most tissues analyzed. The expression level was the highest in the liver; higher levels were detected in the spleen, blood, small intestine, and large intestine; moderate levels in the trachea, lung, and thymus; and lower levels in the bursa, kidney, and cardiac; and the lowest level in muscle (Figure S3).

Upregulation of piMDA5 Expression in Response to RNA Viral Infection

In poultry farming, pigeons are sensitive to NDV (Thomazelli et al., 2021). To investigate the function of MDA5 in the antiviral innate immune response, viral infection experiments were carried out in vivo and in vitro. Viral infection induced the upregulation of MDA5, IFN-α, IFN-γ, and PKR (Figures 1A–1H). AIV infection triggers the upregulation of IFN-α expression higher than that of IFN-γ, and NDV infection does the opposite, which suggests AIV and NDV infection may induce the activation of different signaling pathways. Meanwhile, MDA5 expression was upregulated in 60% of tissues at 3 d postinfection, the highest in blood. And the second higher upregulation is in lung post-NDV infection, but in liver post AIV infection (Figures 1I and 1J). However, the expression of MDA5 in the small intestine is steady in response to viral infection. These data suggest that NDV and AIV may trigger the signaling pathway through different sensors.

Figure 1.

Upregulation of piMDA5, IFN-α, IFN-γ, and PKR in PEF cells at 24 h post-NDV(A–D) and AIV (E–H) infection, MOI =1. (I, J) Upregulation of piMDA5 in pigeon tissues at 3 d post-NDV (I) and AIV(J) infection. RT-qPCR was used to detect the expression levels. Data are expressed as the means ± SD of three independent experiments. The difference between the experimental and control groups was *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Overexpression of piMDA5 Protected Cells From NDV Infection Through Enhancing the Expression of IFN-β and ISGs

Viral infection induced the activation of RLRs receptors and triggers the transduction of associated signaling (Rehwinkel and Gack, 2020).To determine the role of piMDA5 in DF-1 cells infected with NDV, DF-1 cells were transfected with Flag-piMDA5 plasmid or pc4.0-Flag. Then, these cells were infected with NDV 24 hours post-transfection, and cytokines were assessed with qRT-PCR. Compared with control cells, overexpressing piMDA5 significantly induced IFN-β and ISGs expression in response to viral infection (Figure 2A). The GFP area of NDV-GFP-infected cells in the piMDA5-overexpressing group was less than that in the pc4.0-Flag group (Figure 2B). These results suggest that piMDA5 inhibiting viral replication correlates with its function in regulating IFN expression. To further identify the differences, piMDA5, chMDA5, and huMDA5 were transfected into DF-1 cells and A549 cells for 24 h and infected with NDV-GFP. Viral replication was analyzed and related cytokines were detected by qRT-PCR. The overexpression of piMDA5 in these both 2 cells significantly represses viral replication, but huMDA5 does not in chicken cells and chMDA5 does not in human cells (Figure 2C–2G). The above results suggest that MDA5 from different species have different resistances to viral infection, but piMDA5 resists viral infection in different species.

Figure 2.

Viral fluorescence (A) and relative mRNA levels of IFN-β, OASL, and MX1 (B) in DF-1 cells after 12 h post-transfection with piMDA5 or an empty vector and infected with NDV-GFP for 24 h (MOI = 0.5). (C, D) Viral fluorescence (C) or relative mRNA levels of IFN-β, OASL, and MX1 (D) in A549 cells 24 h post-transfection with piMDA5, chMDA5, huMDA5, or an empty vector and infected with NDV-GFP for 12 h (MOI = 0.5). (E) Viral fluorescence in DF-1 cells after 24 h post-piMDA5, chMDA5, huMDA5, or empty vector transfection and 24/48 h post-NDV-GFP infection (MOI = 0.5). (F) Intensities of GFP in Figure 2E were measured with ImageJ. (G) The levels of NDV-GFP in DF-1 cells were quantified with a western blot. Data are expressed as the means ± SD of three independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Interfering MDA5 Expression Promotes NDV Replication

Overexpressing piMDA5 inhibits viral replication and augments IFN expression (Figures 2A and 2B). To further confirm the effect of piMDA5 on antiviral innate immunity, the RNAi plasmids of piMDA5 plasmids (shMDA5-1#, shMDA5-2#, shNC) were constructed and transfected into MDA5^KO DF-1 cells with Flag-piMDA5 plasmids for 24 h and infected with virus for 24 h. It was found that both shMDA5-1# and shMDA5-2# could inhibit the expression of piMDA5 (Figure 3A). Along with the knockdown of piMDA5, its induction of IFN-β and related ISGs was reduced, and viral replication was enhanced (Figures 3A–3D). The above results demonstrate that piMDA5 plays an important role in antiviral innate immunity.

Figure 3.

(A) Western blot of MDA5^KO DF-1 cells transfected with indicated plasmids and infected with NDV-GFP. (B) Fluorescence microscopy images of viral replication (green) in MDA5^KO DF-1 cells transfected with indicated plasmids, and then infected with VSV-GFP/NDV-GFP for 12 h. (C–E) mRNA expression of MDA5(C), IFN-β(D), and MX1(E) in MDA5^KO DF-1 cells transfected with indicated plasmids, and then infected with NDV-GFP. (F, G) Fluorescent intensities of GFP in Figure 3B were measured with ImageJ. Data are expressed as the means ± SD of three independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

The Essential Domain of piMDA5 for Activating IFN-β

Mammals MDA5 recognizes short dsRNA from invaded microorganisms, initiates innate immunity and enhances adaptive immunity (Yoneyama and Fujita, 2008). To explore the function of piMDA5 in innate immunity, DF-1 cells were transfected with piMDA5 plasmid and chIFN-β-luc plasmid. Overexpression of piMDA5 in DF-1 cells significantly upregulates the activity of the IFN-β promoter, and this activation was related to the dosage of the transfected piMDA5 plasmid (Figure 4A). MDA5 was also analyzed with the western blot assay (Figure 4B). Compared with mammals MDA5, the C-terminal of MDA5 is highly conserved in poultry (Figure S1A). The N-terminal CARD domain is responsible for binding with MAVS and signaling transduction (Kato et al., 2017). To further identify the essential domain of MDA5, the secondary structure predicted by CD research, related truncated plasmids were generated and transfected into DF-1 cells to conduct a dual luciferase reporter assay (Figure 4C). The deletion of the CARD domain abolishes the enhancement of IFN-β promoter activity induced by piMDA5, but lacking the RLR, Helic, and CTD domain does not (Figures 4D and 4E). These results indicate that the N-terminal CARD domain of MDA5 is essential for triggering innate immunity and inhibiting viral replication.

Figure 4.

(A) PiMDA5 dose-dependently induced IFN-β induction. (B) Western blot for expression of the piMDA5 protein. (C) Schematic structure of piMDA5 truncated plasmids. (D) The effects of piMDA5 truncated mutants on IFN-β promoter activity. (E) Western blot for expression of the piMDA5 truncated mutants. Error bars represent standard deviations. Three independent experiments were repeated. The difference between the experimental and control groups was *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

DISCUSSION

The hosts sense PAMPs with a variety of cellular PRRs, including RLRs, TLRs, and structurally diverse DNA sensors, which amplifies the signaling cascade through the second messenger and adaptor protein (McFadden et al., 2017; Chow et al., 2018). MDA5, as a homolog of RIG-I, recognizes long dsRNA from invaded microbes, induces MAVS activation and TBK1 phosphorylation, and finally triggers IFN expression and production (Dias Junior et al., 2019). MDA5 in poultry and mammals makes big differences, and the characterization of chMDA5 and duMDA5 have been reported (Hayashi et al., 2014; Wei et al., 2014). The full-length sequences and tissue distribution of piMDA5 have been reported in 2019 (Li et al., 2019), but the role of piMDA5 in viral infection and innate immunity is still not clear.

In this study, we cloned piMDA5 and performed the protein homology analysis of MDA5 from different species. The full length of piMDA5 contains a 3030 bp open reading frame and encodes 1009 amino acids (Figure S1A). Consistent with mammals MDA5, piMDA5 consists of two N-terminal CARD domain, a RLR domain, a Helic domain, and a CTD domain (Figure S1B). The homology analysis showed that the CTD domain of MDA5, which relates to the ability to bind dsRNA (Wu et al., 2013), is highly conserved in mammals and poultry. But the 2CARD domain, which is responsible for MAVS activation and IFN induction (Brisse and Ly, 2019), is variable (Figure S1A). The predicted three-dimensional structure of piMDA5 is similar to chicken MDA5 and huMDA5 (Figure S2B). Regarding the importance and universality of MDA5, we constructed the neighbor-joining tree and performed the protein homology analysis of MDA5. It was found that MDA5 in birds, mammals, and fishes is relatively conserved, respectively. All the above results showed that MDA5 from various species functions differently and may differ in its abilities to bind dsRNA and induce IFN.

In mammals, when RNA virus invaded and aberrant dsRNA accumulated in the cytoplasm, MDA5 expression is upregulated, and innate immunity is triggered (Chow et al., 2018; Wang et al., 2022).In this study, the upregulation of piMDA5 expression was also observed in response to RNA virus in vivo and in vitro (Figures 1A, 1E, 1I, and 1J). And in PEF cells, NDV and AIV infection trigger the antiviral innate immune response, which is indicated by the upregulation of ISGs and cytokines (Figures 1B–1D and 1F–1H). In chickens and ducks, AIV and NDV infection also induced the increasement of MDA5, IFN, and ISGs expression (Karpala et al., 2011; Wei et al., 2014). To explore the role of piMDA5 during viral infection, we overexpressed and knockdown piMDA5 in WT or MDA5^KO DF-1 cells respectively, then infected with NDV for 12 hours. It was found that interfering piMDA5 expression promotes NDV replication (Figure 3). And overexpression of piMDA5 inhibited NDV infection by promoting IFN-β, OASL, and MX1 expression in both DF-1 and A549 cells (Figure 2). A similar phenomenon was also observed in chMDA5, but the inhibition of viral replication of that is less than that of piMDA5. Interestingly, the upregulation of ISGs and the inhibition of viral replication induced by huMDA5 is lighter than that of chMDA5 and piMDA5 (Figure 2). And research shows that chMDA5 resists viral replication stronger than huMDA5 and bat MDA5 (Wang et al., 2022). These findings may indicate that the sensitivity of the host to RNA virus infection may related to the function of its MDA5, further studies are necessary to clarify the association between the resistance to RNA virus replication and the function of MDA5.

MDA5 is the key to IFN signaling initiation and transduction in mammalian and avian antiviral innate immunity (Karpala et al., 2011; Lee et al., 2012; Wei et al., 2014). Consistent with the previous results, overexpression of piMDA5 enhances the activity of IFN-β promoter in DF-1 cells and this activation correlates with the transfected dosage of piMDA5 plasmids (Figures 4A and 4B). PiMDA5 consists of five domains, and the dual-luciferase reporter assay identified that the CARD domain is critical for IFN activation induced by piMDA5. Canine influenza virus (CIV) infection could be inhibited by MDA5 overexpression, and the CARD domain is important for the inhibition (Fu et al., 2020). Also, chicken MDA5 and human MDA5 play an important role in resisting viral infection (Lee et al., 2014; Yu et al., 2016). In cancer cells, mouse MDA5 without the N-terminal CARD domain engages in cell death program but can't efficiently induce the IFN-β expression (Yu et al., 2016). MDA5 not only is important in innate immunity but also bridges antiviral and antitumor immunity.

In brief, piMDA5 is characterized first. As an important RNA sensor, MDA5 is highly conserved in the evolution and also is important for the host to resist virus infection and establish the antiviral state. This study helps to perfect the avian innate immunity system and to explain the differences in viral resistance among birds.