Skip to main content
PMC home page
PLOS ONE logoLink to PLOS ONE
. 2023 Aug 17;18(8):e0285742. doi: 10.1371/journal.pone.0285742

The emergence of Omicron VOC and its rapid spread and persistence in the Western Amazon

Gabriella Sgorlon 1,2,3, Tárcio P Roca 1,3,4, Ana Maisa Passos-Silva 1,2,3, Jackson A S Queiroz 1,2,3, Karolaine S Teixeira 1,3, Adrhyan Araújo 1,3, Flávia S Batista 5, Valquiria R Souza 6, Franciane M Oliveira 6, Luis G Morello 7,8, Fabricio K Marchini 7,8, Juan MV Salcedo 1,2,3, Rita de Cassia P Rampazzo 7, Felipe G Naveca 9, Deusilene Vieira 1,2,3,*
Editor: Babatunde Olanrewaju Motayo10
PMCID: PMC10434903  PMID: 37590264

Abstract

Genomic surveillance represents a strategy to understanding the evolutionary mechanisms, transmission, and infectivity of different SARS-CoV-2 variants. We evaluated 603 individuals positive for SARS-CoV-2 from 34 municipalities of Rondônia between December 2021 to December 2022. Nasopharyngeal samples were collected, RNA was extracted and screened using RT-qPCR for VOCs. RNA of the samples were sequenced and further analyzed for phylogeny, mutations, and lineages, totaling 96.19% of samples positive for Omicron VOC in this cohort. We observed that most individuals had at least two doses, however 18.97% were not vaccinated with any dose. 554 sequences were amenable to analysis for alignment and phylogenetic characterization; this group corresponded to the 27 subvariants of the Omicron VOC; a total of 100 mutations were identified, 48% of which were found in the S gene. In conclusion, the data demonstrated the rapid spread and persistence of Omicron VOC in Rondônia during the 12-month study period. Although high frequency of mutations was found in the analyzed samples, there were no individuals with a severe clinical profile, demonstrating that vaccination had a positive effect in those cases.

Introduction

Severe Acute Respiratory Syndrome Virus 2 (SARS-CoV-2) has the RNA genome with high mutational rate [1, 2]. To date, about 12,000 mutations have been reported, some are related to increased infectivity, vaccine-escape and worsening of the clinical presentation. [1–3].

Genomic surveillance is an appropriate approach that has supported the investigation and circulation of cases of new variants and subvariants in circulation to support government decision making and implementation of health measures aimed at controlling SARS-CoV-2 infections [3–6].

Omicron VOC identified in November 2021 in South Africa, has approximately a total of 32 mutations concentrated mainly in the receptor binding domain (RBD) and Spike protein (S). This VOC spread rapidly to 40 countries after only one month of its emergence [2, 7].

In Brazil, the first case of Omicron VOC was reported in November 2021 in the state of São Paulo, remaining the dominant VOC throughout 2022 with 13,986,090 confirmed cases and 77,173 deaths in the country. Genomic surveillance detected that by February, the Omicron variant was already dominant, reaching 99.8% of the samples analyzed [8–10].

In the first week of the year 2022 there was an increase in the number of cases of COVID-19, demonstrating an atypical profile in Northern Brazil. This fact could be related to the entry of Omicron VOC and its sublines with high transmissibility rates [11, 12]. Thus, the aim of this study was to evaluate the epidemiological and genomic profile for confirmation about the circulating SARS-CoV-2 variants in the Brazilian Western Amazon.

Materials and methods

Ethical aspects and study site

This study was conducted in the Laboratory of Molecular Virology at Fiocruz/RO, with approval from the Research Ethics Committee of the Research Center for Tropical Medicine of Rondônia-CEPEM/RO 4.000.086 and was carried out in accordance with the ethical principles stipulated by the 1975 World Medical Assembly and the Ministry of Health (Resolution 466).

All experiments were conducted in accordance with the relevant guidelines and regulations and were exempted from the requirements for informed consent due to the pandemic timing making direct contact with the subjects impossible. In addition, the study poses no risk to subjects due to the use of RNA from naso- or oropharyngeal samples already collected and extracted for the diagnosis of COVID by the centers, with no need for additional collections.

Biological samples and epidemiological data

The cohort of 603 individuals positive for SARS-CoV-2 were selected by convenience from primary care clinics and reference centers in different municipalities of Rondônia state between December 2021 to December 2022. Diagnosis of SARS-CoV-2 was carried out in Laboratório Central de Saúde Pública de Rondônia (LACEN/RO) by RT-qPCR with One Step/COVID-19 kits (IBMP, Brazil). Epidemiological data and vaccination status were collected from medical records in the GAL/RO, SIVEP-Gripe and E-SUS databases.

Extraction of viral RNA

RNA was extracted from 140 μL of samples collected using nasopharyngeal swab in viral transport medium; using QIAamp® Viral RNA Mini Kits (QIAGEN, Germany) according to the manufacturer’s instructions. RNA from each sample was eluted in 60 μL of AVE buffer for viral load and inference testing.

Screening for Alpha, Beta, and Gamma VOCs

In order to screen for the Alpha, Beta and Gamma VOCs, the multiplex RT-qPCR protocol of Vogels et al. was utilized [13]. Three targets were included in this multiplex: N1, deletion Δ69/70 and deletion of SGF Δ3675–3677 in the ORF1a gene.

The cycling process used for the reaction was 55°C for 10 minutes for reverse transcription, PCR activation at 95°C for 1 minutes, 39 subsequent cycles of 10 seconds at 95°C and 31 seconds at 60°C. Samples with Ct <35 for the N1 target alone were characterized as the Alpha VOC, and samples with Ct <35 for the N1 target and Δ69/70 deletion were classified as Beta or Gamma.

Screening for the Delta VOC

The inference test was performed using the primers and probes (Table 1) described by Yaniv et al. with modifications [14]. The final reaction volume was 20 μL with a primer concentration of 0.5 μM and a probe concentration of 0.2 μM. The reaction contained 5 μL of RNA sample and the reaction steps were performed according to the manufacturer recommendations using TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems 1, California, USA).

Table 1. RT-qPCR primers and probe for the Delta VOC.

Name  Description  Sequence 5’-3’ 
Delta_CoV  Sense  GTTTATTACCACAAAAACAACAAAAG
Delta_CoV  Antisense  GGCTGAGAGACATATTCAAAAGTG
Delta_CoV  Probe  Cy3- TGGATGGAAAGTGGAGTTTATTCTAGT - BHQ 2
Open in a new tab

Adapted from: Karin Yaniv. Accessed on: July 5th, 2021.

The cycling process used for the reaction was 51°C for 10 min for reverse transcription, PCR activation at 95°C for 1 min, 40 subsequent cycles of 10 s at 95°C and 31 s at 60°C; the final step included fluorescence capture.

Screening for the Omicron VOC

All samples that were negative for Alpha, Beta, Gamma and Delta variants were subjected to RT-qPCR genotyping for the Omicron variant. The reaction was performed using 5 μL of TaqPath™ 1-Step RTqPCR Master Mix (4x), 0.5 μL of TaqMan SARS-CoV-2 Mutation Panel Assay (40X) for the SNP assay S:K417N, 5 μL of extracted RNA and a final volume of 20 μL. The cycling used for the reaction was as follows: pre-reading at 60°C for 30 seconds, Reverse Transcription at 50°C for 10 min, DNA polymerase activation at 95°C for 2 minutes, 45 cycles at 95°C for 3 seconds for denaturation and 60°C for 30 seconds for annealing and extension, ending with a post-reading at 60°C for 30 seconds. The genotyping module of the Design & Analysis Software Version: 2.6.0 (Thermo Fisher Scientific) was used for analysis, with a 95% confidence interval for real-time data. Given that this mutation is described as prevalent only in subvariants of Beta, Delta and Omicron, all samples positive for S:K417N and negative for the other variants tested were classified as Omicron [15–17].

Quantification of viral load

The viral load of samples was determined using 5μL of viral RNA extracted using the Multiplex One-Step RT-qPCR assay for detection of SARS-CoV-2 as developed by Queiroz et al, 2021 [18].

Complete genome sequencing of SARS-CoV-2

The sequencing of the complete SARS-CoV-2 genome was performed with the support of the FIOCRUZ Genomic Surveillance Network. Samples with Ct values <25, based on quantitative assays, were selected to allow for high genomic coverage. Nucleotide sequencing was performed using Illumina MiSeq or NextSeq platforms and the COVIDSEQ Kit (Illumina, San Diego, CA, USA) [19].

FASTQ reads were generated by the Illumina pipeline in BaseSpace. Consensus sequences were generated using DRAGEN COVID LINEAGE 3.5.1 to 3.5.3, according to the most updated version of this application in each sequencing run. Subsequently, the quality of the consensus files was analyzed using the Nextclade v1.5.2 tool [20], those with more than 1% "Ns" ambiguities had the FASTQ files imported into Geneious Prime 2021 for trimming and assembly using a custom workflow employing the BBDuk and BBMap tools (v38.84) and the NC_045512.2 RefSeq as a template with careful visual inspection. Using both approaches, we generated consensus sequences with average depth coverage greater than 800X, excluding duplicate reads. The genome-wide consensus sequences of SARS-CoV-2 were initially assigned to viral lineages using the Pango Lineage web application [21].

Data acquisition and Maximum-Likelihood (ML) phylogeny

Available high quality (>29 kb) whole genomes (<1% of N) of BA.* sampled in Brazil (n = 363) were downloaded from the GISAID EpiCoV database on January 5th, 2023. The sequences were aligned using MAFFT v.7.487 [22]. The best model of nucleotide substitution was measured (GTR+G+I) using ModelFinder [23] and the phylogenetic tree was reconstructed using the maximum likelihood method in the program IQ-TREE v.2.1.3 [24]. Branch support values were obtained using Ultrafast Bootstrap with 1,000 replicates. The tree was visualized and edited with FigTree v.1.4.4 [25]. SARS-CoV-2 genomes were classified into lineages using the available software Pangolin [26] and mutations were analyzed with Nextclade Beta [27].

Statistical analysis

Descriptive analyses were represented through central tendency and dispersion measurements. A Chi-square test was used for statistical inference with a significance level of 5% (p<0.05). Statistical analysis was performed and graphics were generated using the software R v4.0.3.

Results

In the cohort of 603 SARS-CoV-2 positive samples, 96.19% (580/603) corresponded to the Omicron VOC and 3.81% (23/603) to the Delta variant, without detection of either Gamma, Alpha or Beta VOCs; the data were confirmed by three RT-qPCR screening assays for VOCs described in methodology.

These cases were identified since December 1, 2021, to December 7, 2022 in 34 municipalities in the state of Rondônia (65.38%), demonstrating a wide distribution of the variant. The first collection period, December 2021 and January 2022, we observed higher prevalence in the North, West and South regions of state; sequentially, in the second period, February 2022 and March 2022, notifications came from the most populous municipalities in the state, such as Porto Velho, Ji-paraná and Ariquemes.

After the periods described on the map, we continued genomic surveillance until December 2022 and identified another 167 sequences characterized as Omicron, in which 58.68% are predominantly from the state capital,, with no other variants identified.

The median age of the population analyzed was 39 years old (SD 16.74), with ages ranging from 5 month to 95 years old; 50.69% (294/580) were female and 49.31% (286/580) were male. The main symptoms reported by patients included headache in 49.83% (289/580), cough with 49.48% (287/580) and fever in 42.24% (245/580) of cases. Dyspnea, disturbance of smell and taste were less reported symptoms with 7.24% (42/580), 2.59% (15/580) and 2.41% (14/580) of patients, respectively. Only 5.86% (34/580) of patients fell into the asymptomatic group.

Regarding vaccination, 18.97% (110/580) were not vaccinated, and among those vaccinated, 7.76% (45/580) had only one dose, 43.28% (251/580) with two, 26.21% (152/580) with three, and 3.79% (22/580) with four doses. The immunizers received by the study population were COVISHIELD, Sinovac, Comirnaty® | Pfizer Brazil, and Janssen-Cilag. There were 5 deaths in this study, 3 unimmunized individuals with a mean age of 75 years and 2 with the first and second dose of vaccine with a mean age of 93 years. The deaths were from individuals infected by subvariants BA.1 (1/5), BA.1.1 (3/5), and BA.5.1 (1/5). Individuals had a mean of 5 days (SD 3.6 days) of symptoms until diagnosis. The viral load of the cohort had an interquartile median of 7.08 Log10/mL, and less than 0.52% (3/580) of individuals had a quantifiable viral load after 14 days of symptoms and one individual symptomatic up to 19 days (Fig 1).

Fig 1. Viral load measured by the number of days after onset of symptoms.

Fig 1

Open in a new tab

Among the 603 samples tested by RT-qPCR, 580 samples were selected for sequencing, taking into consideration the viral load and multiplex tests for exclusion of other VOCS. Of the sequenced samples 95.52% (n = 554) had good quality metrics for phylogeny and mutation analysis. Fig 2 demonstrated the maximum likelihood phylogeny in relation to the clade classification of the Omicron variant.

Fig 2. Maximum likelihood phylogenetic tree presenting 554 sequences obtained in this study and 363 genomes retrieved from GISAID.

Fig 2

Open in a new tab

The samples are indicated as blue circles. The tree was rooted with the most ancestral sequence (EPI_ISL_402123).

The analyses of the sequenced samples corresponded to 30.14% (167) BA.1; 18.05% (100) BA.1.1; 6.14% (34) BA.1.1.1; 0.18% (1) BA.1.1.14; 0.18% (1) BA.1.1.15; 0.18% (1) BA.1.1.18; 1.26% (7) BA.1.14; 12.82% (71) BA.1.14.1; 0.18% (1) BA.1.14.2; 0.90% (5) BA.1.15; 2.17% (12) BA.1.17.2; 0.18% (1) BA.1.20; 0.36% (2) BA.1.9; 2.35% (13) BA.2; 0.18% (1) BA.2.12.1; 0.18% (1) BA.2.36; 0.72% (4) BA.2.56; 0.18% (1) BA.2.81; 1.81% (10) BA.4; 0.18% (1) BA.4.1; 9.93% (55) BA.5.1; 0.18% (1) BA.5.1.15; 8.84% (49) BA.5.2.1; 0.36% (2) BA.5. 6; 0.54% (3) BE.9; 1.62% (9) BF.5 and 0.18% (1) BQ.1.1. To date, no cases of XBB.1.5 have been reported in the state of Rondônia.

We identified 100 mutations (Fig 3) with a frequency greater than 2%. The S gene presented 48% (48/100) mutations, followed by 24% (24/100) in ORF1a, 8% (8/100) in ORF1b, 7% (7/100) in N, and 13% (13/100) distributed among the other genes (ORF3a; M; E; ORF6 and ORF9b).

Fig 3. Dot plot demonstrating the frequency of mutations identified in the set of 554 samples analyzed by NGS.

Fig 3

Open in a new tab

The labels of mutations with frequencies <2% have been hidden.

Mutations previously identified as signatures for the Omicron VOC genomes were analyzed. The N gene region presented four mutations (E31-32del, G204R, R203K and P13L) and the ORF1a gene three mutations (T3255I, P3395H and S3675-3677del) with a frequency of 100%. The N679K and P681H substitutions, considered signature over other variants, showed a frequency of 100%, along with a substitution in N501Y present in 99.64% of the sequences, all of which were characterized as changes in the Spike protein. Six other mutations (D614G, D796Y, G339D, H655Y, N764K, N969K, and Q954H) were found in this region at high frequency.

Discussion

The emergence and persistence of Omicron VOC worldwide was also evaluated in the state of Rondônia, located in the Northern Region of Brazil. The first case in the state was identified on December 1, 2021, and then we continued the analysis until December 2022, completing a total of 580 samples consistently characterized through genomic surveillance.

In parallel with the emergence of Omicron VOC, questions have arisen regarding the frequency of symptoms reported during the period of infection. In this study, the most described symptoms were similar to those detected in individuals infected by other variants, as infected presenting headache, cough and fever. Unlike the first SARS-CoV-2 cases reported in the early 2020s, a low frequency of individuals infected with Omicron VOC demonstrated symptoms such as taste and smell disturbances [28, 29].

In this cohort, 81% of the individuals received at least 1 dose of the COVID-19 vaccine and there is evidence that immunization reduced the more severe cases. However, it is worth noting that the 5 deaths recorded were from unvaccinated individuals or without booster doses, presenting advanced age, highlighting the importance of following vaccination protocols [30].

Individuals infected with the Omicron variant had high viral load up to 9 days after symptom onset, with values of this parameter decreasing from 10 days [31, 32]. Similarly, the cohort in this study showed high levels and maintenance of viral load for up to 10 days after symptom onset, with a mean of 5 days.

The Omicron variant was first detected in the state of Rondônia in December 2021 while the Delta variant was still predominant. After the introduction of Omicron, it subsequently became predominant, accounting for approximately 100% of the samples analyzed in February 2022. A previously published review article demonstrated that Omicron average basic and effective reproduction numbers were 8.2 and 3.6, respectively, meaning a 2.5- to 3.8-fold higher transmissibility than the Delta variant, which may be partially explained by the higher number of mutations, higher transmissibility and greater capability for immune escape [33].

Even with the largest portion of the study population with full immunization, Our findings showed the presence of the 27 subvariants of the Omicron VOC, evidencing that the profile of this VOC exhibits reduced susceptibility to vaccine-induced neutralizing antibodies and risk of new waves of infection [34]. One study showed that neutralizing activity was reduced against BA.2.12.1 and BA.4/BA.5 compared to BA.1 [35]. Another study showed that the BQ.1.1 subvariant showed enhanced resistance against sera from healthcare workers vaccinated with 3 doses [36]. Evidence demonstrating the need for protection against future SARS-CoV-2 variants.

The Omicron variant has a highly transmissible profile due to a higher number of mutations than the other variants [37]. Mutations in the Spike protein play a signature role in other VOCs, such as N679K, P681H, and N501Y were visualized in all sequences, and this persistence of mutations is directly linked to the increased rates of infectivity, the high transmission capacity, and the potential for rapid dispersal of this variant [38–41].

This characteristic is visualized among popular gene variations, such as D614G, which was found with high frequency among the sequences, reported in studies that analyze the epistatic interaction aiming at the transmissibility that the virus achieves in infection [42–44].

The Omicron sequences analyzed here carried the H655Y mutation in a high proportion when compared to other alterations, this same mutation was also characterized in variant B.1.1.33 [45], characterizing with a common mutation between the strains.

In conclusion, the data demonstrated the rapid spread of Omicron VOC by the state of Rondônia, Western Amazon region, throughout 2022 in a dominant manner, with 27 subvariants. Although there were a high number of mutations in the sequenced samples, the patients did not present a severe clinical profile, demonstrating that vaccination had a positive effect in these cases. In addition, there was no identification of XBB.1.5.

Supporting information

S1 Table. SARS-CoV-2 genomes.

All genome sequences and associated metadata in this dataset are published in GISAID’s EpiCoV database. To view the contributors of each individual sequence with details such as accession number, Virus name, Collection date, Originating Lab and Submitting Lab and the list of Authors, visit 10.55876/gis8.230107pn.

(PDF)

Click here for additional data file. (20.7KB, pdf)

Acknowledgments

The present study was developed by a group of researchers from Laboratório de Virologia Molecular da Fundação Oswaldo Cruz, in collaboration from Coordenação de Aperfeiçoamento Pessoal de Nível Superior–CAPES, from whom some authors received financial aid (scholarships) during the production of this study, the Vice president of Vigilância em Saúde e Laboratórios de Referências of Fiocruz, Instituto de Biologia Molecular do Paraná (IBMP) and Laboratório Central de Saúde Pública de Rondônia (LACEN/RO) were essential for the development of the study.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This study was funded by Fundação Oswaldo Cruz de Rondônia – FIOCRUZ/RO, Departamento de Ciência e Tecnologia (DECIT), Fundação para o Desenvolvimento da Ação Científica e Tecnológica e à Pesquisa do Estado de Rondônia - FAPERO (Process:350.095.442.048.526.000.000/ 2016; Public bid invitation: 012/2016 PRO-RONDÔNIA and 001/2020 PPSUS) and by Instituto Nacional de Epidemiologia da Amazônia Ocidental - INCT EpiAmO. FGN is a CNPq fellow. Departamento de Ciência e Tecnologia (DECIT) of the Brazilian MoH, US/CDC and OPAS, Brazilian office. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Papanikolaou V, Chrysovergis A, Ragos V, Tsiambas E, Katsinis S, Manoli A, et al. From delta to Omicron: S1-RBD/S2 mutation/deletion equilibrium in SARS-CoV-2 defined variants. Gene. 2022;814. doi: 10.1016/j.gene.2021.146134 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Mistry P, Barmania F, Mellet J, Peta K, Strydom A, Viljoen IM, et al. SARS-CoV-2 Variants, Vaccines, and Host Immunity. Front Immunol. 2022;12: 5400. doi: 10.3389/fimmu.2021.809244 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Tracking SARS-CoV-2 variants. [cited 10 Mar 2022]. Available: https://www.who.int/en/activities/tracking-SARS-CoV-2-variants/
  • 4.Sgorlon Oliveira G, Silva-Flannery L, da Silva JF, Siza C, Esteves RJ, Marston BJ, et al. Active surveillance and early detection of community transmission of SARS-CoV-2 Mu variant (B.1.621) in the Brazilian Amazon. J Med Virol. 2022. [cited 15 Mar 2022]. doi: 10.1002/JMV.27686 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.A rede–Genomahcov–Fiocruz. [cited 25 Oct 2022]. Available: https://www.genomahcov.fiocruz.br/a-rede/
  • 6.Sgorlon G, Queiroz JA da S, Roca TP, da Silva AMP, Gasparelo NWF, Teixeira KS, et al. Clinical and epidemiological aspects of Delta and Gamma SARS-CoV-2 variant of concern from the western Brazilian Amazon. Mem Inst Oswaldo Cruz. 2022;117. doi: 10.1590/0074-02760220155 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chen J, Wang R, Gilby NB, Wei G-W. Omicron (B.1.1.529): Infectivity, vaccine breakthrough, and antibody resistance. ArXiv. 2021. [cited 10 Mar 2022]. Available: http://arxiv.org/abs/2112.01318 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.SP confirma os dois primeiros casos da variante Ômicron no Brasil | Governo do Estado de São Paulo. [cited 10 Mar 2022]. Available: https://www.saopaulo.sp.gov.br/noticias-coronavirus/sp-confirma-os-dois-primeiros-casos-da-variante-omicron-no-brasil/
  • 9.Novo Brasil. [cited 10 Mar 2022]. Available: https://covid.saude.gov.br/
  • 10.Dashboard-pt–Genomahcov–Fiocruz. [cited 11 Nov 2022]. Available: https://www.genomahcov.fiocruz.br/dashboard-pt/
  • 11.Boletim Epidemiológico No 95 ‐ Boletim COE Coronavírus—Português (Brasil). [cited 20 Jan 2022]. Available: https://www.gov.br/saude/pt-br/centrais-de-conteudo/publicacoes/boletins/boletins-epidemiologicos/covid-19/2022/boletim-epidemiologico-no-95-boletim-coe-coronavirus.pdf/view
  • 12.Bruel T, Hadjadj J, Maes P, Planas D, Seve A, Staropoli I, et al. Serum neutralization of SARS-CoV-2 Omicron sublineages BA.1 and BA.2 in patients receiving monoclonal antibodies. Nat Med. 2022. [cited 23 Mar 2022]. doi: 10.1038/s41591-022-01792-5 [DOI] [PubMed] [Google Scholar]
  • 13.Multiplexed RT-qPCR to screen for SARS-COV-2 B.1.1.7, B.1.351, and P.1 variants of concern. [cited 8 Mar 2022]. Available: https://www.protocols.io/view/multiplexed-rt-qpcr-to-screen-for-sars-cov-2-b-1-1-ewov14dnkvr2/v3?step=1
  • 14.Yaniv K, Ozer E, Kushmaro A, Goldstein-Goren S. SARS-CoV-2 variants of concern, Gamma (P.1) and Delta (B.1.617), sensitive detection and quantification in wastewater employing direct RT-qPCR. [cited 22 Feb 2022]. doi: 10.1101/2021.07.14.21260495 [DOI] [Google Scholar]
  • 15.Classificação de Omicron (B.1.1.529): Variante de preocupação SARS-CoV-2. [cited 10 Mar 2022]. Available: https://www.who.int/news/item/26-11-2021-classification-of-omicron-(b.1.1.529)-sars-cov-2-variant-of-concern
  • 16.Omicron Variant: What You Need to Know | CDC. [cited 10 Mar 2022]. Available: https://www.cdc.gov/coronavirus/2019-ncov/variants/omicron-variant.html
  • 17.surto.info. [cited 10 Mar 2022]. Available: https://outbreak.info/situation-reports?pango=BA.1
  • 18.Queiroz JA da S, Rampazzo R de CP, Filho EB da S, Oliveira GS, Oliveira S da C, Souza LFB, et al. Development of a quantitative one-step multiplex RT-qPCR assay for the detection of SARS-CoV-2 in a biological matrix. International Journal of Infectious Diseases. 2021;104: 373–378. doi: 10.1016/j.ijid.2021.01.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gomes Naveca F, Nascimento V, Souza V, de Lima Corado A, Nascimento F, Silva G, et al. Spread of Gamma (P.1) sub-lineages carrying Spike mutations close to the furin cleavage site and deletions in the N-terminal domain drives ongoing transmission of SARS-CoV-2 in Amazonas, Brazil. [cited 14 Feb 2022]. doi: 10.1101/2021.09.12.21263453 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Aksamentov I, Roemer C, Hodcroft EB, Neher RA. Nextclade: clade assignment, mutation calling and quality control for viral genomes. J Open Source Softw. 2021;6: 3773. doi: 10.21105/JOSS.03773 [DOI] [Google Scholar]
  • 21.O’Toole Á, Scher E, Underwood A, Jackson B, Hill V, McCrone JT, et al. Assignment of epidemiological lineages in an emerging pandemic using the pangolin tool. Virus Evol. 2021;7. doi: 10.1093/VE/VEAB064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Katoh K, Standley DM. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol. 2013;30: 772–780. doi:10.1093/MOLBEV/MST010 [DOI] [PMC free article] [PubMed]
  • 23.Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 2017. 14:6. 2017;14: 587–589. doi: 10.1038/nmeth.4285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, et al. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol Biol Evol. 2020;37: 1530–1534. doi: 10.1093/molbev/msaa015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.FigTree. [cited 16 Dec 2021]. Available: http://tree.bio.ed.ac.uk/software/figtree/
  • 26.Rambaut A, Holmes EC, O’Toole Á, Hill V, McCrone JT, Ruis C, et al. A dynamic nomenclature proposal for SARS-CoV-2 lineages to assist genomic epidemiology. Nat Microbiol. 2020;5: 1403–1407. doi: 10.1038/s41564-020-0770-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Hadfield J, Megill C, Bell SM, Huddleston J, Potter B, Callender C, et al. NextStrain: Real-time tracking of pathogen evolution. Bioinformatics. 2018;34: 4121–4123. doi: 10.1093/bioinformatics/bty407 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Vihta K-D, Pouwels KB, Peto TE, Pritchard E, House T, Studley R, et al. Omicron-associated changes in SARS-CoV-2 symptoms in the United Kingdom. medRxiv. 2022; 2022.01.18. doi: 10.1093/cid/ciac613 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Health Ontario P. COVID-19 Variant of Concern Omicron (B.1.1.529): Risk Assessment, January 19, 2022. [Google Scholar]
  • 30.Vaccine Breakthrough Infections: The Possibility of Getting COVID-19 after Getting Vaccinated. [cited 11 Mar 2022]. Available: https://www.cdc.gov/coronavirus/2019-ncov/vaccines/effectiveness/why-measure-effectiveness/breakthrough-cases.html
  • 31.Investigação epidemiológica ativa sobre infecção por SARS-CoV-2 causada pela variante Omicron (linhagem Pango B.1.1.529) no Japão: relatório preliminar sobre período infeccioso. [cited 11 Mar 2022]. Available: https://www.niid.go.jp/niid/en/2019-ncov-e/10884-covid19-66-en.html
  • 32.Hay JA, Kissler SM, Fauver JR, Mack C, Tai CG, Samant RM, et al. Viral dynamics and duration of PCR positivity of the SARS-CoV-2 Omicron variant. medRxiv. 2022; 2022.01.13. [Google Scholar]
  • 33.Liu Y, Joacim Rocklöv M, Rocklöv J. The effective reproduction number for the omicron SARS-CoV-2 variant of concern is several times higher than Delta. J Travel Med. 2022. [cited 12 Mar 2022]. doi: 10.1093/JTM/TAAC037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hoffmann M, Krüger N, Schulz S, Cossmann A, Rocha C, Kempf A, et al. The Omicron variant is highly resistant against antibody-mediated neutralization: Implications for control of the COVID-19 pandemic. Cell. 2022;185: 447–456.e11. doi: 10.1016/j.cell.2021.12.032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Lyke KE, Atmar RL, Islas CD, Posavad CM, Szydlo D, Paul Chourdhury R, et al. Rapid decline in vaccine-boosted neutralizing antibodies against SARS-CoV-2 Omicron variant. Cell Rep Med. 2022;3. doi: 10.1016/j.xcrm.2022.100679 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Qu P, Evans JP, Faraone JN, Zheng YM, Carlin C, Anghelina M, et al. Enhanced neutralization resistance of SARS-CoV-2 Omicron subvariants BQ.1, BQ.1.1, BA.4.6, BF.7, and BA.2.75.2. Cell Host Microbe. 2022. [cited 8 Jan 2023]. doi: 10.1016/J.CHOM.2022.11.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kumar S, Thambiraja TS, Karuppanan K, Subramaniam G. Omicron and Delta variant of SARS-CoV-2: A comparative computational study of spike protein. J Med Virol. 2022;94: 1641–1649. doi: 10.1002/jmv.27526 [DOI] [PubMed] [Google Scholar]
  • 38.Barton MI, Macgowan S, Kutuzov M, Dushek O, Barton GJ, Anton Van Der Merwe P. Effects of common mutations in the sars-cov-2 spike rbd and its ligand the human ace2 receptor on binding affinity and kinetics. Elife. 2021;10. doi: 10.7554/ELIFE.70658 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Khan A, Zia T, Suleman M, Khan T, Ali SS, Abbasi AA, et al. Higher infectivity of the SARS-CoV-2 new variants is associated with K417N/T, E484K, and N501Y mutants: An insight from structural data. J Cell Physiol. 2021;236: 7045–7057. doi: 10.1002/jcp.30367 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Naveca FG, Nascimento V, Souza V, Corado A de L, Nascimento F, Silva G, et al. Spread of Gamma (P.1) Sub-Lineages Carrying Spike Mutations Close to the Furin Cleavage Site and Deletions in the N-Terminal Domain Drives Ongoing Transmission of SARS-CoV-2 in Amazonas, Brazil. Zhang B, editor. Microbiol Spectr. 2022;10. doi: 10.1128/SPECTRUM.02366-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bhattacharya M, Sharma AR, Dhama K, Agoramoorthy G, Chakraborty C. Omicron variant (B.1.1.529) of SARS-CoV-2: understanding mutations in the genome, S-glycoprotein, and antibody-binding regions. Geroscience. 2022. [cited 11 Mar 2022]. doi: 10.1007/s11357-022-00532-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Gobeil SMC, Janowska K, McDowell S, Mansouri K, Parks R, Manne K, et al. D614G Mutation Alters SARS-CoV-2 Spike Conformation and Enhances Protease Cleavage at the S1/S2 Junction. Cell Rep. 2021;34. doi: 10.1016/J.CELREP.2020.108630 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Yurkovetskiy L, Wang X, Pascal KE, Tomkins-Tinch C, Nyalile TP, Wang Y, et al. Structural and Functional Analysis of the D614G SARS-CoV-2 Spike Protein Variant. Cell. 2020;183: 739–751.e8. doi: 10.1016/j.cell.2020.09.032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Gellenoncourt S, Saunders N, Robinot R, Auguste L, Rajah MM, Kervevan J, et al. The Spike-Stabilizing D614G Mutation Interacts with S1/S2 Cleavage Site Mutations To Promote the Infectious Potential of SARS-CoV-2 Variants. J Virol. 2022;96. doi: 10.1128/JVI.01301-22/SUPPL_FILE/JVI.01301-22-S0001.PDF [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Gularte JS, da Silva MS, Filippi M, Demoliner M, Schallenberger K, Hansen AW, et al. Viral isolation allows characterization of early samples of SARS-CoV-2 lineage B1.1.33 with unique mutations (S: H655Y and T63N) circulating in Southern Brazil in 2020. Braz J Microbiol. 2022;53: 1313–1319. doi: 10.1007/s42770-022-00789-z [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Babatunde Olanrewaju Motayo

13 Mar 2023

PONE-D-23-01948The emergence of Omicron VOC and its rapid spread and persistence in the Western AmazonPLOS ONE

Dear Dr. Vieira,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Apr 27 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Babatunde Olanrewaju Motayo, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information.

3. Thank you for stating the following financial disclosure: 

  "This study was funded by Fundação Oswaldo Cruz de Rondônia – FIOCRUZ/RO, Departamento de Ciência e Tecnologia (DECIT), Fundação para o Desenvolvimento da Ação Científica e Tecnológica e à Pesquisa do Estado de Rondônia - FAPERO (Process:350.095.442.048.526.000.000/ 2016; Public bid invitation: 012/2016 PRO-RONDÔNIA and 001/2020 PPSUS) and by Instituto Nacional de Epidemiologia da Amazônia Ocidental - INCT EpiAmO. FGN is a CNPq fellow. Departamento de Ciência e Tecnologia (DECIT) of the Brazilian MoH, US/CDC and OPAS, Brazilian office."

Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." 

If this statement is not correct you must amend it as needed. 

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

4. Thank you for stating the following in the Acknowledgments Section of your manuscript: 

   "The present study was developed by a group of researchers from Laboratório de Virologia Molecular da Fundação Oswaldo Cruz, in Rondônia, with financial support from the Genomic Coronavirus Fiocruz Network, Departamento de Ciencia e Tecnologia (DECIT), Fundação para o Desenvolvimento das Ações Científicas 

e Tecnológicas da Pesquisa do Estado de Rondônia – FAPERO, Programa de Pesquisa para o SUS (PPSUS), as well as Instituto Nacional de Ciência e Tecnologia de 

Epidemiologia da Amazônia Ocidental – INCT- EpiAmo who have been important contributors to scientific development in the Amazon region. Collaboration from 

Coordenação de Aperfeiçoamento Pessoal de Nível Superior – CAPES, from whom some authors received financial aid (scholarships) during the production of this study, the Vice president of Vigilância em Saúde e Laboratórios de Referências of Fiocruz, Instituto de Biologia Molecular do Paraná (IBMP) and Laboratório Central de Saúde Pública de Rondônia (LACEN/RO) were essential for the development of the study"

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. 

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: 

   "This study was funded by Fundação Oswaldo Cruz de Rondônia – FIOCRUZ/RO, Departamento de Ciência e Tecnologia (DECIT), Fundação para o Desenvolvimento da Ação Científica e Tecnológica e à Pesquisa do Estado de Rondônia - FAPERO (Process:350.095.442.048.526.000.000/ 2016; Public bid invitation: 012/2016 PRO-RONDÔNIA and 001/2020 PPSUS) and by Instituto Nacional de Epidemiologia da Amazônia Ocidental - INCT EpiAmO. FGN is a CNPq fellow. Departamento de Ciência e Tecnologia (DECIT) of the Brazilian MoH, US/CDC and OPAS, Brazilian office."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

5. Thank you for stating the following in the Competing Interests section: 

   "At the time of submission, R.C.P.R, L.G.M and F.K.M were employees at IBMP, which manufactures and commercializes the test described in this study. The other authors declare no potential conflict of interest."

Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests).  If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared. 

Please include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf.

6. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

7. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

8. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section. 

9. We note that Figure 1 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (a) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (b) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.  

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

10. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. 

11. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

You are advised to revise your manuscript in line with the reviewers comments. You are also to provide a step by step response to all reviewers concerns to the manuscript.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This study reported the emergence of Omicron VOC and its rapid spread and persistence in the Western Amazon. It is a nice study with the clear methodology. There are a few comments:

1. What are subtypes of Omicron VOC?

2. What CoVID-19 vaccines did the patients receive?

3. How was the Illumina data analyzed to get complete genomes of SARS-CoV-2?

4. How was the phylogeny generated?

Reviewer #2: Summary:

This manuscript describes the collection and basic analyses of the emergence and spread of SARS-CoV-2 variants in Rondônia, Brazil. This piece highlights the increase in SARS-CoV-2 sequencing over the last months in Rondônia, Brazil and presents substantial new country-specific genomic data which is important in understanding the evolutionary mechanisms, transmission, and infectivity of SARS-CoV-2 variants in Brazil.

Suggestions:

1. It’s quite unfortunate that phylogeographic analysis was not included in this study which would have been used to infer the geographic origin of the variants, the course of range expansions, and the presence of genetic bottlenecks. Can this aspect be incorporated into the study?

2. Fig 3 shows three (3) clusters of BA.1 in the tree. Any explanation for the topology incongruence?

3. Your references are not consistent. Kindly check the PLOS format.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2023 Aug 17;18(8):e0285742. doi: 10.1371/journal.pone.0285742.r002

Author response to Decision Letter 0

25 Apr 2023

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf.

R: Manuscript was formatted in journal style.

2. Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed). If your study included minors, state whether you obtained consent from parents or guardians. If the need for consent was waived by the ethics committee, please include this information.

If you are reporting a retrospective study of medical records or archived samples, please ensure that you have discussed whether all data were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data from their medical records used in research, please include this information.

Changes made in line 69 to 74: “All experiments were conducted in accordance with the relevant guidelines and regulations and were exempted from the requirements for informed consent due to the pandemic timing making direct contact with the subjects impossible. In addition, the study poses no risk to subjects due to the use of RNA from naso- or oropharyngeal samples already collected and extracted for the diagnosis of COVID by the centers, with no need for additional collections”.

3. Thank you for stating the following financial disclosure:

"This study was funded by Fundação Oswaldo Cruz de Rondônia – FIOCRUZ/RO, Departamento de Ciência e Tecnologia (DECIT), Fundação para o Desenvolvimento da Ação Científica e Tecnológica e à Pesquisa do Estado de Rondônia - FAPERO (Process:350.095.442.048.526.000.000/ 2016; Public bid invitation: 012/2016 PRO-RONDÔNIA and 001/2020 PPSUS) and by Instituto Nacional de Epidemiologia da Amazônia Ocidental - INCT EpiAmO. FGN is a CNPq fellow. Departamento de Ciência e Tecnologia (DECIT) of the Brazilian MoH, US/CDC and OPAS, Brazilian office."

Please state what role the funders took in the study. If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

If this statement is not correct you must amend it as needed.

Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf.

R: Changes made in line 315 to 317: The following sentence was added “ The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

4. Thank you for stating the following in the Acknowledgments Section of your manuscript:

"The present study was developed by a group of researchers from Laboratório de Virologia Molecular da Fundação Oswaldo Cruz, in Rondônia, with financial support from the Genomic Coronavirus Fiocruz Network, Departamento de Ciencia e Tecnologia (DECIT), Fundação para o Desenvolvimento das Ações Científicas

e Tecnológicas da Pesquisa do Estado de Rondônia – FAPERO, Programa de Pesquisa para o SUS (PPSUS), as well as Instituto Nacional de Ciência e Tecnologia de

Epidemiologia da Amazônia Ocidental – INCT- EpiAmo who have been important contributors to scientific development in the Amazon region. Collaboration from

Coordenação de Aperfeiçoamento Pessoal de Nível Superior – CAPES, from whom some authors received financial aid (scholarships) during the production of this study, the Vice president of Vigilância em Saúde e Laboratórios de Referências of Fiocruz, Instituto de Biologia Molecular do Paraná (IBMP) and Laboratório Central de Saúde Pública de Rondônia (LACEN/RO) were essential for the development of the study"

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"This study was funded by Fundação Oswaldo Cruz de Rondônia – FIOCRUZ/RO, Departamento de Ciência e Tecnologia (DECIT), Fundação para o Desenvolvimento da Ação Científica e Tecnológica e à Pesquisa do Estado de Rondônia - FAPERO (Process:350.095.442.048.526.000.000/ 2016; Public bid invitation: 012/2016 PRO-RONDÔNIA and 001/2020 PPSUS) and by Instituto Nacional de Epidemiologia da Amazônia Ocidental - INCT EpiAmO. FGN is a CNPq fellow. Departamento de Ciência e Tecnologia (DECIT) of the Brazilian MoH, US/CDC and OPAS, Brazilian office."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

R:The acknowledgements of the study's funding bodies have been removed, thus adjusting them to line 293 to 299: “The present study was developed by a group of researchers from Laboratório de Virologia Molecular da Fundação Oswaldo Cruz, in collaboration from Coordenação de Aperfeiçoamento Pessoal de Nível Superior – CAPES, from whom some authors received financial aid (scholarships) during the production of this study, the Vice president of Vigilância em Saúde e Laboratórios de Referências of Fiocruz, Instituto de Biologia Molecular do Paraná (IBMP) and Laboratório Central de Saúde Pública de Rondônia (LACEN/RO) were essential for the development of the study.”

R: Changes made in line 308 to 317: “Funding: This study was funded by Fundação Oswaldo Cruz de Rondônia - FIOCRUZ/RO, the Genomic Coronavirus Fiocruz Network, Department of Science and Technology (DECIT), Foundation for the Development of Scientific and Technological Action and Research of the State of Rondônia - FAPERO (Process:350. 095.442.048.526.000.000/ 2016; Public bid invitation: 012/2016 PRO-RONDÔNIA and 001/2020 PPSUS) and by Instituto Nacional de Epidemiologia da Amazônia Ocidental - INCT EpiAmO. FGN is a CNPq fellow. Department of Science and Technology (DECIT) of the Brazilian MoH, US/CDC and PAHO, Brazilian office. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

5. Thank you for stating the following in the Competing Interests section:

"At the time of submission, R.C.P.R, L.G.M and F.K.M were employees at IBMP, which manufactures and commercializes the test described in this study. The other authors declare no potential conflict of interest."

Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf.

R: Changes made in line 320 to 321: Inserting sentence at the end of the topic "This does not alter our adherence to PLOS ONE policies on sharing data and materials."

6. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

The information that will be passed on comprises the sequence IDs collected in GISAID, which is already in the manuscript as background material (S1 Table) line 390 to 391.

7. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

R: "Data not shown" referred to the map (Figure 1). With the removal of the map the article has all data according to PLOS policy.”

8. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section.

R: Topic removed: “Institutional Review Board Statement: The project was evaluated and approved by the Research Ethics Committee of the Research Center for Tropical Medicine - CEPEM - Rondônia under protocol no. 4,000,086 and carried out in accordance with the ethical principles stipulated by the 1975 World Medical Assembly and the Ministry of Health (Resolution 466).”

9. We note that Figure 1 in your submission contain [map/satellite] images which may be copyrighted. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For these reasons, we cannot publish previously copyrighted maps or satellite images created using proprietary data, such as Google software (Google Maps, Street View, and Earth). For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (a) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (b) remove the figures from your submission:

a. You may seek permission from the original copyright holder of Figure 1 to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

b. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

The following resources for replacing copyrighted map figures may be helpful:

USGS National Map Viewer (public domain): http://viewer.nationalmap.gov/viewer/

The Gateway to Astronaut Photography of Earth (public domain): http://eol.jsc.nasa.gov/sseop/clickmap/

Maps at the CIA (public domain): https://www.cia.gov/library/publications/the-world-factbook/index.html and https://www.cia.gov/library/publications/cia-maps-publications/index.html

NASA Earth Observatory (public domain): http://earthobservatory.nasa.gov/

Landsat: http://landsat.visibleearth.nasa.gov/

USGS EROS (Earth Resources Observatory and Science (EROS) Center) (public domain): http://eros.usgs.gov/#

Natural Earth (public domain): http://www.naturalearthdata.com/

“It was not possible to obtain the Creative Commons Attribution License (CC BY 4.0), so we have chosen to remove the map at this point (figure 1).”

10. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

R: Changes made in line 480 to 484: S1 Table. SARS-CoV-2 genomes. All genome sequences and associated metadata in this dataset are published in GISAID’s EpiCoV database. To view the contributors of each individual sequence with details such as accession number, Virus name, Collection date, Originating Lab and Submitting Lab and the list of Authors, visit 10.55876/gis8.230107pn

11. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Two new references have been added to the methodology about the genome assembly, so that references 20 and 21 have been added to the following section in the methodology: “FASTQ reads were generated by the Illumina pipeline in BaseSpace. Consensus sequences were generated using DRAGEN COVID LINEAGE 3.5.1 to 3.5.3, according to the most updated version of this application in each sequencing run. Subsequently, the quality of the consensus files was analyzed using the Nextclade v1.5.2 tool [20], those with more than 1% "Ns" ambiguities had the FASTQ files imported into Geneious Prime 2021 for trimming and assembly using a custom workflow employing the BBDuk and BBMap tools (v38.84) and the NC_045512.2 RefSeq as a template with careful visual inspection. Using both approaches, we generated consensus sequences with average depth coverage greater than 800X, excluding duplicate reads. The genome-wide consensus sequences of SARS-CoV-2 were initially assigned to viral lineages using the Pango Lineage web application [21].”

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: This study reported the emergence of Omicron VOC and its rapid spread and persistence in the Western Amazon. It is a nice study with the clear methodology. There are a few comments:

1. What are subtypes of Omicron VOC?

Information found on the page 198-205: Twenty-seven Omicron VOC subtypes were found: “The analyses of the sequenced samples corresponded to 30.14% (167) BA.1; 18.05% (100) BA.1.1; 6.14% (34) BA.1.1.1; 0.18% (1) BA.1.1.14; 0.18% (1) BA.1.1.15; 0.18% (1) BA.1.1.18; 1.26% (7) BA.1.14; 12.82% (71) BA.1.14.1; 0.18% (1) BA.1.14.2; 0.90% (5) BA.1.15; 2.17% (12) BA.1.17.2; 0.18% (1) BA.1.20; 0.36% (2) BA.1.9; 2.35% (13) BA.2; 0.18% (1) BA.2.12.1; 0.18% (1) BA.2.36; 0.72% (4) BA.2.56; 0.18% (1) BA.2.81; 1.81% (10) BA.4; 0.18% (1) BA.4.1; 9.93% (55) BA.5.1; 0.18% (1) BA.5.1.15; 8.84% (49) BA.5.2.1; 0.36% (2) BA.5. 6; 0.54% (3) BE.9; 1.62% (9) BF.5 and 0.18% (1) BQ.1.1. To date, no cases of XBB.1.5 have been reported in the state of Rondônia.”

2. What CoVID-19 vaccines did the patients receive?

R: Changes made on pages 183 to 185: “The immunizers received by the study population were COVISHIELD, Sinovac, Comirnaty® | Pfizer Brazil, and Janssen-Cilag”.

3. How was the Illumina data analyzed to get complete genomes of SARS-CoV-2?

R: Changes made on pages 134 to 144: “FASTQ reads were generated by the Illumina pipeline in BaseSpace. Consensus sequences were generated using DRAGEN COVID LINEAGE 3.5.1 to 3.5.3, according to the most updated version of this application in each sequencing run. Subsequently, the quality of the consensus files was analyzed using the Nextclade v1.5.2 tool [20], those with more than 1% "Ns" ambiguities had the FASTQ files imported into Geneious Prime 2021 for trimming and assembly using a custom workflow employing the BBDuk and BBMap tools (v38.84) and the NC_045512.2 RefSeq as a template with careful visual inspection. Using both approaches, we generated consensus sequences with average depth coverage greater than 800X, excluding duplicate reads. The genome-wide consensus sequences of SARS-CoV-2 were initially assigned to viral lineages using the Pango Lineage web application [21].”

4. How was the phylogeny generated?

Initially, high quality reference sequences were retrieved from all the VOC Omicron lineages found in the study and then the dataset was aligned using MAFFT. The phylogeny was generated based on the maximum likelihood method. We used IQ-TREE 2 with the Ultrafast Bootstrap algorithm which is already frequently used for phylogenetic analysis applied to SARS-CoV-2.

Reviewer #2: Summary:

This manuscript describes the collection and basic analyses of the emergence and spread of SARS-CoV-2 variants in Rondônia, Brazil. This piece highlights the increase in SARS-CoV-2 sequencing over the last months in Rondônia, Brazil and presents substantial new country-specific genomic data which is important in understanding the evolutionary mechanisms, transmission, and infectivity of SARS-CoV-2 variants in Brazil.

Suggestions:

1. It’s quite unfortunate that phylogeographic analysis was not included in this study which would have been used to infer the geographic origin of the variants, the course of range expansions, and the presence of genetic bottlenecks. Can this aspect be incorporated into the study?

Unfortunately, to perform a robust analysis there are some limitations related to the insufficient number of high quality deposited sequences of particular lineages.

In addition, a long period of time will be required to run the analyses considering a large data set, which would not be possible for the proposed response period.

2. Fig 3 shows three (3) clusters of BA.1 in the tree. Any explanation for the topology incongruence?

The justification for this topology is that the BA.1 lineage is the common ancestor of other BA.1* lineages and widely dispersed in different locations.

This can be checked in: https://nextstrain.org/ncov/gisaid/global/6m?tl=pango_lineage

Moreover, the clusters were strongly supported by a satisfactory bootstrap value (>99).

3. Your references are not consistent. Kindly check the PLOS format.

The format of the references was revised according to the journal model.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file. (24.6KB, docx)

Decision Letter 1

Babatunde Olanrewaju Motayo

2 May 2023

The emergence of Omicron VOC and its rapid spread and persistence in the Western Amazon

PONE-D-23-01948R1

Dear Dr. Vieira,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Babatunde Olanrewaju Motayo, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (No Response)

Reviewer #2: The authors have made significant improvement on the manuscript and equally addressed most of the concerns raised during the initial review. Their inability to include the phylogeographic analysis is quite unfortunate but understandable due to time factor.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

Acceptance letter

Babatunde Olanrewaju Motayo

4 May 2023

PONE-D-23-01948R1

The emergence of Omicron VOC and its rapid spread and persistence in the Western Amazon

Dear Dr. Vieira:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr Babatunde Olanrewaju Motayo

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Table. SARS-CoV-2 genomes.

    All genome sequences and associated metadata in this dataset are published in GISAID’s EpiCoV database. To view the contributors of each individual sequence with details such as accession number, Virus name, Collection date, Originating Lab and Submitting Lab and the list of Authors, visit 10.55876/gis8.230107pn.

    (PDF)

    Click here for additional data file. (20.7KB, pdf)
    Attachment

    Submitted filename: Response to Reviewers.docx

    Click here for additional data file. (24.6KB, docx)

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.

    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES