Melatonin supplementation promotes muscle fiber hypertrophy and regulates lipid metabolism of skeletal muscle in weaned piglets

Abstract

Melatonin has been reported to play crucial roles in regulating meat quality, improving reproductive properties, and maintaining intestinal health in animal production, but whether it regulates skeletal muscle development in weaned piglet is rarely studied. This study was conducted to investigate the effects of melatonin on growth performance, skeletal muscle development, and lipid metabolism in animals by intragastric administration of melatonin solution. Twelve 28-d-old DLY (Duroc × Landrace × Yorkshire) weaned piglets with similar body weight were randomly divided into two groups: control group and melatonin group. The results showed that melatonin supplementation for 23 d had no effect on growth performance, but significantly reduced serum glucose content (P < 0.05). Remarkably, melatonin increased longissimus dorsi muscle (LDM) weight, eye muscle area and decreased the liver weight in weaned piglets (P < 0.05). In addition, the cross-sectional area of muscle fibers was increased (P < 0.05), while triglyceride levels were decreased in LDM and psoas major muscle by melatonin treatment (P < 0.05). Transcriptome sequencing showed melatonin induced the expression of genes related to skeletal muscle hypertrophy and fatty acid oxidation. Enrichment analysis indicated that melatonin regulated cholesterol metabolism, protein digestion and absorption, and mitophagy signaling pathways in muscle. Gene set enrichment analysis also confirmed the effects of melatonin on skeletal muscle development and mitochondrial structure and function. Moreover, quantitative real-time polymerase chain reaction analysis revealed that melatonin supplementation elevated the gene expression of cell differentiation and muscle fiber development, including paired box 7 (PAX7), myogenin (MYOG), myosin heavy chain (MYHC) IIA and MYHC IIB (P < 0.05), which was accompanied by increased insulin-like growth factor 1 (IGF-1) and insulin-like growth factor binding protein 5 (IGFBP5) expression in LDM (P < 0.05). Additionally, melatonin regulated lipid metabolism and activated mitochondrial function in muscle by increasing the mRNA abundance of cytochrome c oxidase subunit 6A (COX6A), COX5B, and carnitine palmitoyltransferase 2 (CPT2) and decreasing the mRNA expression of peroxisome proliferator-activated receptor gamma (PPARG), acetyl-CoA carboxylase (ACC) and fatty acid-binding protein 4 (FABP4) (P < 0.05). Together, our results suggest that melatonin could promote skeletal muscle growth and muscle fiber hypertrophy, improve mitochondrial function and decrease fat deposition in muscle.

In this study, the effects of melatonin on muscle development in weaned piglets were investigated. Melatonin supplement daily could promote skeletal muscle growth and muscle fiber hypertrophy, improve mitochondrial function and decrease fat deposition in muscle.

Introduction

Skeletal muscle mass accounts for approximately more than 40% of body weight (BW) and is responsible for body movement, nutrient absorption, and metabolic balance in animals (Frontera and Ochala, 2015). In animal production, skeletal muscle is the most economically valuable product determining meat production and pork quality (Jin et al., 2021). Exploring strategies for regulating skeletal muscle development is important to ensure pork production, and improve pork quality and efficiency.

Skeletal muscle is mainly composed of a large number of muscle fibers, the number and size of muscle fibers contribute to the process of muscle development (Bismuth and Relaix, 2010). The number of muscle fibers has been basically stable after birth, and the postnatal muscle development of animals depends on an increase in muscle fiber size (hypertrophy) and muscle fiber type transformation (Wilkinson et al., 2018; Matarneh et al., 2021). Muscle fiber can be divided into type Ι, type IIa, type IIb and type IIx encoded by the MYH7, MYH2, MYH1, and MYH4 genes according to their characteristics and metabolic functions (Matarneh et al., 2021). In general, type I fibers are generally smaller in diameter, redder in appearance, and have more mitochondria than type II fibers (Pette and Staron, 2001). In turn, the composition and proportion of different muscle fiber types also determine the meat characteristics and quality. Studies have shown that the higher proportion of types Ι and IIa muscle fibers leads to the higher flesh-color score, tenderness, and intramuscular fat content in meat (Shan et al., 2015; Ramanathan et al., 2020; Matarneh et al., 2021), which is very important for improving meat quality in animals.

Melatonin is a natural phytochemical found in plants (such as alfalfa, almonds, black and white mustard, small white leaves, turmeric tuber, celery, flax, fennel, fenugreek, cherry, etc.) (Tan et al., 2012; Kennaway, 2017). Melatonin was initially found to be a hormone responsible for regulating circadian rhythm. An increasing number of studies have indicated that melatonin is a bioactive factor that plays a variety of biological effects (Fatemeh et al., 2022). In addition to circadian rhythm regulation, melatonin also has antioxidant, antiaging, immunomodulatory, and anticancer properties (Bhattacharya et al., 2019; Fatemeh et al., 2022). In husbandry production, melatonin is widely used to regulate immune response, intestinal health, and reproductive performance (Niu et al., 2020; Zhai et al., 2021; Xia et al., 2022). Recently, melatonin has been reported to alleviate skeletal muscle wasting, prevent mitochondrial dysfunction, and restore muscle function in mice and rats (Teodoro et al., 2014; Duan et al., 2022). Furthermore, a small number of studies have reported the application of melatonin in regulating carcass traits and meat quality (Duan et al., 2019; Reid et al., 2023). Numerous studies have shown that melatonin plays a role in the regulation of animal muscle growth and the fate of muscle stem cells in animals (Salucci et al., 2017; Bai et al., 2019); however, the application of melatonin in animal husbandry is still limited, and the effects of melatonin on skeletal muscle development in piglet remain unclear.

Consequently, the present study aimed to investigate the effects of melatonin supplementation on growth performance, muscle development, and intramuscular fat deposition in weaned piglets and provide a theoretical basis for melatonin to improve muscle development and meat quality, which will help to explore the application of melatonin as a feed additive in livestock production.

Materials and Methods

Ethics statement

This experiment was conducted in the Laboratory Animal Center of Zhejiang University. All experimental procedures involving piglets were approved by the Zhejiang University Animal Care and Use Committee (ZJU20170466).

Animals and experimental design

A total of 12 weaned piglets (female) at 28 d of age DLY (Duroc × Landrace × Yorkshire) were randomly divided into two groups (n = 6). All the piglets were fed the same basal diet that meets National Research Council-recommended nutrient requirements for pigs (Table 1) and water throughout the experiment. Following 5 d for adaptive rearing, all the piglets were given fasting gavage at 9 a.m every morning. As previously published (Xia et al., 2022), piglets from melatonin-treated group were infused with 10 mL of the sterile saline solution dissolved with melatonin on basis of BW (5 mg/kg), and the control group in which piglets received the same volume of sterile saline solution daily for 23 d. ­Melatonin solution was prepared daily and kept with an aluminum foil cover to prevent light-induced degradation before use.

Table 1.

Composition and nutrient levels of the basal diets for weaned piglet

Ingredient	%
Premium northeast corn	11.3
Extruded premium northeast corn	20
Puffed broken rice	9
Puffed strong gluten flour	6
Flour	5
Brown rice	10
Sucrose	3
Whey powder	3
Expanded soybean	8
Peeled soybean meal	6.5
Fermentation enzymatic hydrolysis of soybean meal	8
Fish meal	2
Soybean oil	2.2
Premix	6
Total	100.00
Nutrient level
Digestible energy (kcal/kg)	3450
Crude protein	18.0
Crude fiber	5.0
Crude ash	7.0
Calcium	0.50 to 0.90
Total phosphorus	0.40 to 0.65
Sodium chloride	0.30 to 1.00
Copper (ppm)	25
Zinc (ppm)	50
Lysine	1.35

Sample collection

At the end of experiment, all pigs were fasted for 12 h before slaughter. The piglets were anesthetized via electrical stunning and sacrificed by exsanguination. The whole blood of pigs was gathered and then used to separate serum by centrifugation at 3,500 × g for 15 min. Subsequently, the tissue samples, including longissimus dorsi muscle (LDM), psoas major muscle (PMM), liver, spleen, and kidney was isolated immediately and weighed by an electronic scale. Subsequently, the relative organ weight of muscle, liver, spleen, and kidney were calculated: organ/body weight * 1. About 20 g LDM and PMM samples were fixed in 4% paraformaldehyde solution for more than 36 h for morphological analysis and the other samples were frozen in liquid nitrogen and stored in at −80 °C for further study.

Growth performance determination

The initial and final BW of all piglets was determined on days 1 and 23, respectively. In addition, BW of piglets on weeks 1 and 2 was determined on days 8 and 15, respectively. Meanwhile, daily feed intakes were recorded every day. On the basis of these data, the average daily feed intake (ADFI), average daily gain (ADG), and the feed-to-gain (F:G) ratio were obtained.

Serum biochemical assays

The separated serum was thawed and preserved on ice, and then the analysis of serum biochemical indexes was carried out in the Affiliated Hospital of Hangzhou Normal University through automatic biochemical analyzer, including serum glucose, triglyceride (TG), cholesterol (CHO), high density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) and immunoglobulin level (IgG and IgM).

Morphology analysis

The LDM and PMM samples were fixed in 4% paraformaldehyde solution for more than 36 h, subsequently, paraffin-embedded to obtain sections. Hematoxylin and eosin staining were performed to observe and analyze the number and cross-sectional area of muscle fiber in muscle as described previously (Liu et al., 2023). The number and cross-sectional area of muscle fiber were measured manually using Image J software.

Muscle triglyceride measurement

The LDM and PMM samples were cut into small pieces and then homogenized with tissue lysate to obtain a clear tissue suspension and left at room temperature for 10 min. The concentrations TG were measured with the tissue triglyceride assay kit (Beijing Pulilai Gene Technology Co. Ltd, China) according to the manufacturer’s instructions. In addition, the concentration of protein in the homogenate was detected using a BCA Protein Assay Reagent Kit (Thermo Fisher Scientific Inc., Waltham, MA, USA).

Transcriptomic sequencing

Total RNA from the LDM was isolated and purified using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA library construction and sequencing were performed by LC Bio Technology Co. Ltd (Hangzhou, China). Briefly, the RNA purity and integrity of each sample were quantified using NanoDrop ND-1000 (NanoDrop, Wilmington, DE, USA) and Bioanalyzer 2100 (Agilent, CA, USA) with RIN number >7.0, respectively. cDNA was synthesized using Super Script II Reverse Transcriptase reagent (1896649, Invitrogen). Then cDNA was then used to synthesize U-labeled second-stranded DNAs. At last, 2 × 150bp paired-end sequencing (PE150) on an illumina Novaseq 6000 was performed.

FastQC software was used for quality control of the original sequencing databases with default parameter. StringTie was used to calculate Fragments Per Kilobase of exon model per Million mapped fragments value. Differential gene expression was calculated using the DESeq2 package. Genes with the corresponding q values <0.05 and fold change >2 were considered to be differentially expressed genes (DEGs).

Functional enrichment analysis

The Gene Ontology (GO) biological process and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of DEGs were performed to identify the significantly enriched GO terms and metabolic pathways using DAVID software (https://david.ncifcrf.gov/).

Gene set enrichment analysis

Each GO term and involved genes were defined as gene sets, and gene set enrichment analysis (GSEA) was implemented on the Java GSEA platform. Gene sets with false discovery rate values <  0.05 were considered statistically significant.

Real-time quantitative PCR

RNA extraction and quantitative real-time polymerase chain reaction (qPCR) were performed as described previous study (Xu et al., 2021). Briefly, total RNA was isolated with TRIzol reagent (Thermo Fisher, USA) and the purity and concentration of total RNA were measured using NanoDrop 2000 (Thermo Fisher, USA). Reverse transcription was performed by A ReverAid First Strand cDNA Synthesis Kit (Thermo Fisher, USA). qPCR was performed with an Applied Biosystems StepOnePlus Real-Time PCR System using SYBR Green Master Mix (Roche). The 2^−ΔΔCT method was used to analyze the relative mRNA expression of the target genes normalized to GAPDH as an internal control. The primer sequences are listed in Table 2.

Table 2.

Primer sequences for genes

Genes	Primer	Sequence (5ʹ to 3ʹ)	GenBank accession No.
MYHC I	Forward	CGTGGACTACAACATCATAGGC	NM_213855
	Reverse	CCTTCTCAACAGGTGTGTCG
MYHC IIA	Forward	CATTGAGGCCCAGAATAGGC	NM_214136
	Reverse	TGCTTCCGTCTTCACTGTCAC
MYHC IIB	Forward	GACTCTGGCTTTCCTCTTTGC	NM_001123141
	Reverse	GAGCTGACACGGTCTGGAAA
MYHC IIX	Forward	TTGACTGGGCTGCCATCAAT	AB025262
	Reverse	GCCTCAATGCGCTCCTTTTC
PAX7	Forward	TGAGGAGTACAAGAGGGAGAA	XM_021095460
	Reverse	GGACAGTGCTGCGATCA
MYOD1	Forward	CCGACGGCATGATGGATTATAG	NM_001002824
	Reverse	CGACACCGCAGCATTCTT
MYOG	Forward	GGCTACGAGCGGACTGA	NM_001012406
	Reverse	GACACGGACTTCCTCTTACAC
IGF-1	Forward	TTCAACAAGCCCACAGGGTA	NM_214256
	Reverse	CTCCAGCCTCCTCAGATCAC
IGFBP5	Forward	GTGTACCTGCCCAACTGTGA	NM_214099
	Reverse	AAGCTGTGGCACTGGAAGTC
FABP4	Forward	GGGACATCAAGGAGAAGC	NM_001002817
	Reverse	ACCGTGTTGGCGTAGAG
CPT2	Forward	CACTTGTTTGCTTTGCG	NM_001246243
	Reverse	GCTGGTGGACAGGATGTT
ACC	Forward	TTCCAGGCACAGTCCTTAGG	NM_001114269
	Reverse	TCATCCAACACGAGCTCAGT
COX5B	Forward	CTATGGCATCTGGAGGTGGT	NM_001007517
	Reverse	ACAGATGCAGCCCACTATCC
PPARG	Forward	AGGGCCAAGGATTCATGACA	NM_214379
	Reverse	GTGGTTCAACTTGAGCTGCA
SCD	Forward	TACTATCTGCTGAGTGCTGTGG	NM_213781
	Reverse	CTGGAATGCCATCGTGTTGG
GAPDH	Forward	GTCGGTTGTGGATCTGACCT	NM_001206359
	Reverse	TTGACGAAGTGGTCGTTGAG

MYHC, myosin heavy chain; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PPARG, peroxisome proliferator-activated receptor γ; ACC, acetyl-CoA carboxylase; FABP4, fatty acid-binding protein 4; SCD, stearoyl Coenzyme A desaturase; PAX7, paired box 7; MYOD1, myogenic differentiation 1; MYOG, myogenin; IGF-1, insulin-like growth factor 1; IGFBP5, insulin-like growth factor-binding protein-5; CPT2, carnitine palmitoyltransferase 2; COX5B, cytochrome c oxidase subunit 5B.

Statistical analysis

GraphPad Prism 8.0 software was used for statistical analysis. All values were expressed as mean ± SEM unless otherwise stated and were performed the Normality test. Except for sequencing data, comparisons between two groups were analyzed using a two-tailed Student’s t-test. Differences among groups were considered statistically significant at P < 0.05.

Results

Effect of melatonin on growth performance in weaned piglet

As is shown by the data in Table 3, melatonin supplementation had no significant effect on BW, ADG, and F:G during each period. Interestingly, ADFI of weaned piglets was reduced significantly after melatonin treatment during the second-week feeding (P < 0.05), while no difference was founded between the two groups during other growth periods (Table 3).

Table 3.

Growth performance for weaned piglet

Items	Ctrl	Mel	P-value
BW (kg)
Initial	9.88 ± 0.60	10.09 ± 0.70	0.825
First week	12.66 ± 0.70	13.51 ± 0.94	0.337
Second week	16.69 ± 1.21	16.53 ± 0.29	0.909
Final	20.92 ± 1.32	21.14 ± 0.46	0.892
ADG (kg/d)
First week	0.35 ± 0.03	0.36 ± 0.04	0.784
Second week	0.58 ± 0.08	0.43 ± 0.03	0.187
Third week	0.53 ± 0.05	0.58 ± 0.06	0.543
Days 0 to 23	0.48 ± 0.03	0.46 ± 0.04	0.675
ADFI (kg/d)
First week	0.44 ± 0.01	0.44 ± 0.03	0.987
Second week	0.66 ± 0.03	0.57 ± 0.02	0.017
Third week	0.89 ± 0.08	0.85 ± 0.02	0.724
Days 0 to 23	0.66 ± 0.04	0.62 ± 0.01	0.651
F:G
First week	1.32 ± 0.12	1.37 ± 0.21	0.405
Second week	1.11 ± 0.12	1.28 ± 0.12	0.243
Third week	1.69 ± 0.16	1.56 ± 0.06	0.800
Days 0 to 23	1.36 ± 0.03	1.41 ± 0.11	0.240

Ctrl, control; Mel, melatonin; BW, body weight; ADFI, average daily feed intake; ADG, average daily gain; F:G, feed-to-gain ratio; SEM, standard error of the mean.

Effects of melatonin on tissue weight of weaned piglets

This study further examined the effect of melatonin on tissue weight. The results showed that compared with the control group, melatonin administration significantly increased the relative weight of LDM (P < 0.05), eye muscle area (P < 0.01), and greatly decreased the relative weight of liver tissue (P < 0.05), but had no significant effect on the weight of spleen and kidney tissue (Table 4). These results suggest that melatonin may be involved in regulating muscle development.

Table 4.

Relative organ weight of weaned piglets

Items	Ctrl	Mel	P-value
LDM weight, g/kg	7.92 ± 0.61	10.67 ± 0.35	0.018
Eye muscle area of LDM, cm2	16.62 ± 0.63	18.00 ± 0.25	0.001
Liver weight, g/kg	25.89 ± 1.44	21.88 ± 0.71	0.037
Kidney weight, g/kg	4.82 ± 0.33	4.86 ± 0.27	0.921
Spleen weight, g/kg	2.27 ± 0.20	2.09 ± 0.24	0.584

Ctrl, control; Mel, melatonin; BW, body weight; LDM, longissimus dorsi muscle.

Effect of melatonin on serum blood biochemical parameters

To assess the effects of melatonin on metabolism and immune processes in vivo, serum glucose levels, lipid, and immune indicators were measured. The result is shown in Figure 1, melatonin significantly reduced serum glucose levels (P < 0.05), but had no significant effect on serum lipid contents (P > 0.05), including TG, CHO, HDL-C, LDL-C, and immunoglobulin level (IgG and IgM) (Figure 1).

Figure 1.

Effect of melatonin on serum biochemical indices in weaned piglet (n = 6 per treatment group). Glu, glucose; TG, triglyceride; CHO, cholesterol; HDL-C, high density lipoprotein cholesterol; LDL-C, low density lipoprotein cholesterol; IgM, immunoglobulins M; IgG, immunoglobulins G. Data are presented as means ± SEM.

Morphological measurements of the LDM

The effects of melatonin on the LDM and PMM structure of weaned piglets are shown in Figure 2. Compared with the control group, the average area of muscle fibers increased significantly (P < 0.01), the total triglyceride content in LDM and PMM tissue was significantly decreased in the melatonin treatment group (P < 0.05), although the number of muscle fibers did not change significantly (P > 0.05) (Figure 2). These results indicated that melatonin treatment induced the muscle fiber hypertrophy, which was accompanied by a decrease in intramuscular fat deposition.

Figure 2.

Effect of melatonin on muscle histomorphology and muscle fiber development of LDM (A) and PMM (B) in weaned piglet (n = 3 per treatment group). (A) Number of muscle fibers, cross-sectional area, and total triglyceride content in LDM. (B) Number of muscle fibers, cross-sectional area, and total triglyceride content in PMM. Data are presented as means ± SEM.

Effect of melatonin on transcriptome dynamics in LDM

Transcriptome sequencing was performed to determine the effect of melatonin on gene expression levels of LDM in weaned piglets. The results showed that a total of 68 DEGs were identified by melatonin treatment, among which 54 genes were significantly upregulated and 14 genes were significantly downregulated (P < 0.05). Volcanic map and heat map were used to show the changes of different genes (Figure 3). GO biological process and KEGG enrichment analysis were further performed to determine the function and signaling pathways of these differentially altered genes. GO enrichment analysis showed that these genes were enriched in biological processes such as skeletal muscle hypertrophy and fatty acid oxidation (Figure 4A), which further confirmed that melatonin was involved in the regulation of muscle fiber development in weaned piglets. KEGG enrichment analysis showed that the differential gene enrichment signaling pathway is related to cholesterol metabolism, autophagy, and protein digestion and absorption (Figure 4B), suggesting that melatonin may mobilize the mitochondrial function of muscle tissue to regulate the development of muscle fibers.

Figure 3.

Effect of melatonin on transcriptome changes of LDM of weaned piglets (n = 4 per treatment group). (A) Volcano map showing differentially expressed genes after melatonin treatment. (B) Heatmap showing differentially expressed genes after melatonin treatment. Data are presented as means ± SEM.

Figure 4.

Enrichment analysis of differentially expressed genes in LDM of weaned piglets. (A) GO biological process enrichment analysis of differentially expressed genes after melatonin treatment (n = 4 per treatment group). (B) KEGG pathway analysis of differentially expressed genes after melatonin treatment (n = 4 per treatment group). Data are presented as means ± SEM.

GO and KEGG analysis focus on the enrichment analysis of differentially changed genes, so we further performed GSEA analyses for interpreting gene expression data to identify the biological processes regulated by melatonin (Subramanian et al., 2005). GSEA analysis was used to explore the biological process changes of weaned piglets affected by melatonin (Figure 5A). The results showed that the biological processes with significant differences were associated with skeletal muscle system development, skeletal muscle contraction, and muscle fiber morphology (Figure 5B to D). Additionally, melatonin affected mitochondrial matrix, mitochondrial electron transport chain, and mitochondrial respiratory chain complex (Figure 5E to G), further confirming that melatonin regulates muscle development and mitochondrial function in animals.

Figure 5.

GSEA analysis of melatonin affected-genes associated with skeletal muscle development and mitochondrial function (n = 4 per treatment group). Data are presented as means ± SEM.

Melatonin supplementation elevated the expression of skeletal muscle development-related genes

Finally, this study further explored the effect of melatonin on gene expression level in muscle tissue. Compared to the control group, melatonin supplementation elevated the mRNA levels of PAX7, MYOG, IGF-1, and IGFBP5 (P < 0.05) (Figure 6A). In addition, the expression of genes related to muscle fiber type in the LDM of weaned piglet were analyzed. Compared with the control group, the mRNA expression of MYHC IIA and MYHC IIB was remarkedly upregulated (P < 0.05) after intragastric administration of melatonin (Figure 6B). Nevertheless, the mRNA expressions of MYOD1 in LDM were not significantly affected by melatonin treatment (Figure 6B).

Figure 6.

Melatonin supplementation changed the expression of muscle development-related genes in weaned piglet (n = 5 per treatment group). PAX7, paired box 7; MYOD1, myogenic differentiation antigen; MYOG, myogenin; IGF-1, insulin-like growth factor 1; IGFBP5, insulin-like growth factor-binding protein-5; MYHC, myosin heavy chain. Data are presented as means ± SEM.

Effect of melatonin on lipid metabolism and mitochondrial function in LDM

Since melatonin treatment markedly decreased TG content in muscle of weaned piglets, the study further detected the genes expression associated with lipid metabolism. Compared with the control group, melatonin supplementation significantly decreased the expression of mature fat marker genes, including PPARG, ACC, and FABP4 (P < 0.05) (Figure 7A). Remarkably, the expression levels of the fatty acid composition and synthesis-related gene (CD36, FAS, ELOVL6, and SCD) remained unchanged after treatment (Figure 7A).

Figure 7.

Melatonin supplementation modulated lipid metabolism and mitochondrial function in weaned piglet (n = 5 per treatment group). PPARG, peroxisome proliferator-activated receptor γ; ACC, acetyl-CoA carboxylase; FABP4, fatty acid-binding protein 4; SCD, stearoyl Coenzyme A desaturase; CD36, CD36 molecule; FAS, fatty acid synthesis; CPT2, carnitine palmitoyltransferase 2; COX5B, cytochrome c oxidase subunit 5B; COX6A, cytochrome c oxidase subunit 6A; ELOVL6, ELOVL fatty acid elongase 6; UCP2, uncoupling protein 2; UCP3, uncoupling protein 3. Data are presented as means ± SEM.

RNA-seq results show that melatonin may affect fatty acid oxidation and mitochondrial function, hence the expression of mitochondria-related genes was verified by qPCR. Compared with the control group, melatonin supplementation significantly increased COX6A, COX5B, and CPT2 (P < 0.05) mRNA abundance in LDM (Figure 7B). However, the mRNA expressions of UCP2 and UCP3 turned to be similar between the two groups in LDM (Figure 7B).

Discussion

In the present study, melatonin intake promoted muscle fiber development, increased muscle fiber cross-sectional area, and decreased muscle triglyceride content in weaned piglets, although there was no significant effect on growth performance. Transcriptome sequencing confirmed that differentially changed genes by melatonin treatment are associated with skeletal muscle hypertrophy and fatty acid oxidation, and GSEA enrichment analysis also revealed that melatonin-affected gene changes were related to skeletal muscle development and mitochondrial structure and function. In conclusion, our results reveal the contribution and role of melatonin in promoting muscle fiber development in weaned piglets.

In this study, short-term melatonin supplementation failed to change growth performance of weaned piglets, which is consistent with the result of a previous study (Xia et al., 2022). Similarly, melatonin administration did not affect calf birth weight and similarly calf weaning weight (Reid et al., 2023). However, several experiments in mouse models have shown that melatonin intervention leads to significant reductions in BW and adipose tissue weight (Ren et al., 2018; Liu et al., 2019; Tamura et al., 2021). The reason for the difference in the effect of melatonin is believed to be related to the time of melatonin action and diet. We further measured the relative tissue weight of weaned piglets and found that melatonin elevated the relative LDM weight and eye muscle area and decreased the relative weight of liver tissue, but had no significant effect on spleen and kidney. These results indicated melatonin could promote muscle growth in weaned piglets. Morphological analysis showed that the muscle fiber area of LDM and PMM of weaned piglets increased significantly after melatonin treatment, suggesting that melatonin may be involved in regulating the hypertrophy of muscle fibers.

To determine the role of melatonin in regulating muscle fiber development in weaned piglets, transcriptome sequencing was performed to identify the biological effects by melatonin intragastric administration. The results showed that the enrichment biological process of DEGs after melatonin treatment was related to fatty acid oxidation and skeletal muscle hypertrophy, which further verified the beneficial effect of melatonin on muscle fiber development at the molecular level. Skeletal muscle development is an important index related to the growth rate, meat yield, and meat quality of animals, and the regulation of muscle fiber development is the key and difficult point in animal husbandry. In this study, the role of melatonin in promoting muscle fiber hypertrophy of weaned piglets was found in vivo, which was consistent with some research results. Incubating chicken embryos in green light promoted the secretion of melatonin, GH, and IGF-1 in serum, and then promoted the development of breast muscle and gastrecnemius muscle of broilers, indirectly confirming the conclusion of our study (Bai et al., 2019). The weight and fiber diameter of soleus muscle of adult male rats were significantly reduced after castration, while that of soleus muscle and fiber diameter were significantly increased after melatonin supplementation, which effectively restored the ultrastructure of myofibril and significantly increased the expression of IGF-1 in muscle fibers and stem cells (Oner et al., 2008). This indirectly confirms the role of melatonin in promoting muscle fiber hypertrophy. Studies from other animals show that melatonin intake promoted the growth and development of lambs, and significantly increased the cross-sectional area of lamb muscle fibers (Ma et al., 2022). Moreover, transcriptome sequencing indicated that melatonin may induce alternations in apoptosis signaling pathway (Ma et al., 2022), further confirming the role of melatonin in promoting the development of animal muscle fibers. Moreover, melatonin intake can effectively improve the senescence, proliferation, and differentiation of satellite cells induced by high-fat diet (HFD) (Mankhong et al., 2023), suggesting melatonin may regulate muscle development through promoting satellite proliferation. qPCR analysis confirmed that melatonin treatment for 23 d significantly increased the expression of muscle fiber type and myogenic regulatory factors genes, including MYHC IIA, MYHC IIB, PAX7, and MYOG. Notably, melatonin treatment (day 210 postnatally) did not affect the expression of myogenic and adipogenic genes of loin muscle from calves (Reid et al., 2023), which may be related to the timing of melatonin supplementation. Importantly, melatonin has been reported to improve muscle function in injury and aging conditions (Salucci et al., 2021). The decrease of endogenous melatonin in the aging process is closely related to sarcopenia (Carrillo-Vico et al., 2005; Bubenik and Konturek, 2011), indicating melatonin may be involved in maintaining muscle function and metabolism. Exogenous melatonin supply can slow muscle atrophy, regulate insulin resistance, improve muscle mitochondrial function, and prevent chemically-induced skeletal muscle cell apoptosis and endoplasmic reticulum stress in vitro in rat (Rodriguez et al., 2007; Lee et al., 2014). Chronic intake of melatonin can prevent mitochondrial damage in muscle of aging mice (Hibaoui et al., 2009; Teodoro et al., 2014). In summary, melatonin plays an important role in promoting muscle growth and maintaining muscle function.

Melatonin may preferentially regulate the process of glucose metabolism in the body, including the utilization and turnover of glucose. The significant decrease in blood glucose level indicated that melatonin may promote glycogen storage in the body. This is consistent with the results of several studies. One study indicated oral melatonin significantly reduced blood glucose levels and free fatty acid content in diabetic rats, improved insulin action, and β cell function to improve glucose homeostasis in young diabetic rats (Agil et al., 2012). In addition, pineal resection eliminated the decrease in plasma glucose concentration, while melatonin replacement restored plasma glucose concentration in pineal resection rats (la Fleur et al., 2001). Although most studies have revealed the key role of melatonin in lowering blood glucose, there is a great debate about the role of melatonin in the metabolism of glucose and lipid in the body. Some scholars believe that the action time and concentration are the key to the action of melatonin (Garaulet et al., 2020). Elevated melatonin concentrations at night, combined with food intake, are associated with decreased glucose tolerance, and high melatonin levels during fasting may promote islet beta cell recovery (Garaulet et al., 2020). Therefore, the application of melatonin should be closely linked to the animal’s circadian rhythm and feeding.

Intramuscular fat deposition is an important process that affects the formation of meat quality. The intramuscular fat content of animals is one of the important indicators that determine the sensory quality and nutritional quality of meat (Scollan et al., 2017). In particular, the composition of unsaturated fatty acids and the intake of functional lipids have beneficial effects on human health and metabolism (Wang et al., 2021). Our results showed that melatonin significantly reduced TG content in muscle of weaned piglets and expression levels of mature fat marker genes, including PPARG, ACC, and FABP4. Additionally, gene expression associated with mitochondrial function and fatty acid oxidation were activated by melatonin. These results suggest that melatonin can lead to less intramuscular fat content by promoting mitochondrial function, which is consistent with the results of several animal trials. Some studies have found that melatonin injection through the tail vein can reduce the subcutaneous fat weight in mice (Liu et al., 2019). Excessive uric acid resulted in oxidative stress, TG accumulation, and mitochondrial dysfunction in skeletal muscle C2C12 myoblasts, while melatonin treatment significantly reduces TG deposition (Maarman et al., 2017). Similarly, another study reported that melatonin not only affects the composition of cell subgroups of precursor adipocytes through single-cell sequencing analysis, but also activates liposolysis in vivo, resulting in the decrease of intramuscular fat content (Li et al., 2021). Therefore, the use of melatonin should be strictly controlled to avoid negative effects on meat quality and intramuscular fat deposition.

Conclusion

In conclusion, short-term melatonin intake failed to change the growth performance of weaned piglets, but increased LDM weight through promoting skeletal muscle hypertrophy, evidenced by the increased muscle fiber area. In addition, melatonin also improved mitochondrial function and decreased fat deposition in muscle.

Glossary

Abbreviations

ACC

acetyl-CoA carboxylase

ADFI

average daily feed intake

ADG

average daily gain

BW

body weight

CHO

cholesterol

COX6A

cytochrome c oxidase subunit 6A

CPT2

carnitine palmitoyltransferase 2

Ctrl

control

DEGs

differentially expressed genes

DLY

Duroc × Landrace × Yorkshire

FABP4

fatty acid-binding protein 4

F:G

feed-to-gain

GLU

glucose

GO

gene ontology

GSEA

gene set enrichment analysis

HDL-C

high density lipoprotein cholesterol

H&E

hematoxylin and eosin staining

IGF-1

insulin-like growth factor 1

IGFBP5

insulin-like growth factor binding protein 5

IgG

immunoglobulins G

IgM

immunoglobulins M

LDL-C

low-density lipoprotein cholesterol

LDM

longissimus dorsi muscle

Mel

melatonin

MYOD1

myogenic differentiation 1

MYOG

myogenin

MYHC

myosin heavy chain

PAX7

paired box 7

PMM

psoas major muscle

PPARG

peroxisome proliferator-activated receptor gamma

qPCR

quantitative real-time polymerase chain reaction

TG

triglyceride

UCP2

uncoupling protein 2