Abstract
In this study, we applied bacterial artificial chromosome (BAC) technology with PRVΔTK/gE/gI as the base material to replace the first, central, and terminal segments of the US3 gene with codon-deoptimized fragments via two-step Red-mediated recombination in E. coli GS1783 cells. The three constructed BACs were co-transfected with gI and part of gE fragments carrying homologous sequences (gI+gE’), respectively, in swine testicular cells. These three recombinant viruses with US3 codon de-optimization ((PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, and PRVΔTK&gE-US3deop−3) were obtained and purified. These three recombinant viruses exhibited similar growth kinetics to the parental AH02LA strain, stably retained the deletion of TK and gE gene fragments, and stably inherited the recoded US3. Mice were inoculated intraperitoneally with the three recombinant viruses or control virus PRVΔTK&gEAH02 at a 107.0 TCID50 dose. Mice immunized with PRVΔTK&gE-US3deop−1 did not develop clinical signs and had a decreased virus load and attenuated pathological changes in the lungs and brain compared to the control group. Moreover, immunized mice were challenged with 100 LD50 of the AH02LA strain, and PRVΔTK&gE-US3deop−1 provided similar protection to that of the control virus PRVΔTK&gEAH02. Finally, PRVΔTK&gE-US3deop−1 was injected intramuscularly into 1-day-old PRV-negative piglets at a dose of 106.0 TCID50. Immunized piglets showed only slight temperature reactions and mild clinical signs. However, high levels of seroneutralizing antibody were produced at 14 and 21 days post-immunization. In addition, the immunization of PRVΔTK&gE-US3deop−1 at a dose of 105.0 TCID50 provided complete clinical protection and prevented virus shedding in piglets challenged by 106.5 TCID50 of the PRV AH02LA variant at 1 week post immunization. Together, these findings suggest that PRVΔTK&gE-US3deop−1 displays great potential as a vaccine candidate.
Keywords: pseudorabies virus, virulence, safety, immunogenicity, codon de-optimization
1. Introduction
Pseudorabies is an acute infectious disease caused by a highly virulent and contagious herpesvirus, pseudorabies virus (PRV). Although the natural host is the pig, it can also infect many different mammals, including cattle, goats, cats, dogs, sheep, and wild animals, in which it causes often-fatal disease of the central nervous system [1,2]. Despite immunization with classic vaccines, such as Bartha-K61, there has been ongoing virus evolution with apparent antigenic variation in PRV in China since 2011, which has resulted in several outbreaks of swine pseudorabies in pig farms [3,4,5]. Thus, vaccine development is necessary to combat newly arising variants.
In our previous study, we constructed a PRV variant TK/gE double gene deletion strain (PRVΔTK&gE-AH02), which was safe for 1-day-old PRV antibody-positive piglets and 4- to 5-week-old PRV-negative piglets. Moreover, the strain provided robust protection to a recent PRV variant. However, it showed some pathogenicity in 1-day-old PRV antibody-negative piglets [6]. Consequently, further reducing the virulence of this particular PRV strain while preserving the immunogenicity seemed necessary.
The basic amino acids (except methionine and tryptophan) are often encoded by two or more synonymous codons. Further, evolution has led to different codon usage frequencies in different species or various tissues of the same species [7]. In this context, codon de-optimization has emerged as a tool for replacing synonymous codons in the existing virus sequences with suboptimal codons [8]. The rationale of the technique is that suboptimal codons are used less frequently in the host cell, reducing the mRNA stability, affecting translation efficiency, and thus significantly reducing protein expression levels [8,9,10]. Moreover, it should be noted that codon de-optimization does not result in changes to the amino acid sequence of the viral proteins, which retains the same antigenic epitopes as the wild-type virus and thus remains completely immunogenic [9,11]. Owing to these aspects, codon de-optimization-based modification of viruses to attenuate virulence has become a popular trend to produce vaccine candidates. Several attenuated viruses have been generated using various codon de-optimization strategies [12,13,14,15,16]. We here focused on the US3 gene, which encodes a serine/threonine kinase. Previous studies indicated that the US3 gene was dispensable for virus growth in cells but was a critical virulence factor in vivo [17]. Motivated by these aspects, we constructed three recombinant viruses with US3 codon de-optimization based on a PRV TK/gE double gene deletion strain (PRVΔTK&gE-AH02) by replacing partial synonymous codons with suboptimal codons in the first, central, and terminal segments of the US3 gene with reference to the porcine codon usage frequency table and codon adaptation index (CAI). We then systematically evaluate their safety and immune potency in mice and piglets.
2. Materials and Methods
2.1. Materials
2.1.1. Virus and Cells
The PRV variant AH02LA (CGMCC No. 10891) and its PRV AH02LA TK/gE double gene deleted mutant (PRVΔTK&gE-AH02) strain were identified and preserved in the laboratory. Swine testicular (ST) cells (CVCC: CL27) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fischer Scientific, Waltham, MA, USA) containing 2% or 10% fetal bovine serum (FBS, Gibco, Waltham, MA, USA) with 100 IU/mL penicillin (Sigma-Aldrich, St. Loius, MO, USA) and 100 μg/mL streptomycin (Sigma-Aldrich) in an environment of 5% CO2 at 37 °C.
2.1.2. Plasmids and Strains
T-Vector pMD19 (Simple) plasmid was purchased from TaKaRa Co. Ltd. (Dalian, China). E. coli GS1783 cells (a kind gift of Dr. Gregory Smith, Northwestern University) containing BACPRVΔTK/gE/gI&K+ or BACPRVΔTK/gE/gI were prepared and stored in our laboratory. The pmKate2-N vector was purchased from Evrogen (Moscow, Russia).
2.1.3. Main Reagents
Trypsin was purchased from Thermo Fischer Scientific (Waltham, MA, USA). DNA and RNA extraction kits were purchased from Omega (Bienne, Switzerland). T4 DNA ligase, LA Taq polymerase, DH5α receptor cells, the plasmid extraction kit, proteinase K, and restriction endonucleases (Dpn I and Kpn I) were purchased from Dalian Bao Biological Engineering Co; Ltd. (Dalian, China). The Universal Column Genome Extraction Kit was purchased from Beijing Kangwei Century Co. Ltd. (Beijing, China). The 2×TSINGKE® Master quantitative polymerase chain reaction (qPCR) Mix (SYBR Green I) was purchased from Tsingke Biotechnology Co. Ltd. (Nanjing, China). Lipofectamine® 3000 was purchased from Invitrogen (Waltham, MA, USA).
2.1.4. Test Animals
The 4- to 6-week-old healthy Institute of Cancer Research (ICR) female mice (18–22 g) were purchased from Nanjing Qinglong Mountain Animal Breeding Farm (Nanjing, China) and reared in the mice room of the North Animal House of Jiangsu Academy of Agricultural Sciences (Nanjing, China). The 1-day-old PRV-negative piglets and sows were self-raised in the laboratory and reared in the same pens of a pig farm of Jiangsu Academy of Agricultural Sciences. The piglets, aged 28–35 days old, were self-raised and fed twice daily (at 8:00 and 17:00) in the pig farm of Jiangsu Academy of Agricultural Sciences. It should be noted that all the test pigs were negative for PRV, swine fever virus, cerebrospinal virus, porcine reproductive and respiratory syndrome virus, porcine parvovirus, and porcine circovirus type 2.
2.2. Methods
2.2.1. Construction of Bacterial Artificial Chromosomes (BACs) with US3 Codon De-Optimization
The primer sequences used in this study are shown in Table 1. The primers were synthesized by the Tsingke Biotechnology Co. Ltd. (Nanjing, China). The codon de-optimized US3 (US3deop-1, US3deop-2, US3deop-3 in the Supplementary Information S1) was obtained after the codon de-optimization of the US3 gene into the first, central, and terminal segments with reference to the porcine codon usage frequency table and CAI. The recombinant plasmids, T-US3deop-1, T-US3deop-2, and T-US3deop-3, were constructed by ligating the synthesized US3deop-1, US3deop-2, and US3deop-3 with the linearized PMD19-T simple vectors. Then, plasmids T-US3deop-1, T-US3deop-2, and T-US3deop-3 were digested with restriction endonucleases Cla I, Btg I, and BspE I, respectively. The target fragments were ligated with kanamycin resistance gene, respectively, and then transformed into DH5α cells to obtain recombinant plasmids. Finally, PCR and sequencing were performed to identify whether the kanamycin resistance gene was correctly ligated in recombinant plasmids.
Table 1.
Primers | Sequence (5′–3′) | Aim |
---|---|---|
PRV US3deop-1-Kan F | CCCATCGATGGCGATGGCGATAGCAGGATGACGACGATAAGTAGGGATAAC | Amplification of US3deop-1-Kan |
PRV US3deop-1-Kan R | CCCATCGATGATGATTTCATCATCGCTGGGTAATGCCAGTGTTACAACCA | |
PRV US3deop-2-Kan F | TCCCCCGGGGCCCGGTGACGTGTCTGGGATGACGACGATAAGTAGGGATAAC | Amplification of US3deop-2-Kan |
PRV US3deop-2-Kan R | TCCCCCGGGCGAGCATCTGCTTCAGGGGGTAATGCCAGTGTTACAACCA | |
PRV US3deop-3-Kan F | CCCATCGATCTCATCCGCGCCCTCAGGATGACGACGATAAGTAGGGATAAC | Amplification of US3deop-3-Kan |
PRV US3deop-3-Kan R | CCCATCGATCAGATGCATCTCCCCGTTGGGTAATGCCAGTGTTACAACCA | |
US3deop-1-Kan ide F | CCGATGAAATCCTGTATTCG | Identification of US3deop-1-Kan |
US3deop-1-Kan ide R | GCTCATAACACCCCTTGTAT | |
US3deop-2-Kan ide F | GACGTGTCTGGTCCTGCCGCATTT | Identification of US3deop-2-Kan |
US3deop-2-Kan ide R | AATCGCGGCCTCGAGCAAGA | |
US3deop-3-Kan ide F | GGGGTGCATCCCGAAGAATTTC | Identification of US3deop-3-Kan |
US3deop-3-Kan ide R | CGCGAGCCCATTTATACCCA | |
PRV gI+gE’ F | GTCGTGGGCATCGTCATCAT | Amplification of gI and part of gE |
PRV gI+gE’ R | TAGGAGATGGTACATCGCGG | |
H1-US3deop-1-Kan-H2 F | CTTGCCGGGCTCAGCAGGGGGTTGTCGCGCGTCCACGCCCAGCGCTCGCACGCAGCAACA | Amplification of US3deop-1-Kan with homologous arms |
H1-US3deop-1-Kan-H2 R | GTACAGATCGCACCGAAAGTGCGGCAGGACCAGGCACGTCACCGGGCCCCGGGCGAGCAT | |
H1-US3deop-2-Kan-H2 F | CTGATGGAGGGCATGCTGCTGAAGCGCCTGGCCCACGATAACGTCATGAGCCTGAAGCAG | Amplification of US3deop-2-Kan with homologous arms |
H1-US3deop-2-Kan-H2 R | GGGCGGGAACTCCTCGGGGTGCACCCCGCGGAGGGCGCGGATGAGGTCGATCAGGTGCAT | |
H1-US3deop-3-Kan-H2 F | GAGACGCTGGCCTACCCCAAGACGATCACCGGCGGGGACGAGCCCGCGATCAACGGGGAG | Amplification of US3deop-3-Kan with homologous arms |
H1-US3deop-3-Kan-H2 R | TTGTTGAGCTGTGGAGATGCGCAAAGGTGTGTGTGTCCTACCGCTCGGAGCCGGGCCGTT | |
PRV US3 check F | AGCGCTCGCACGCAGCAACA | Identification of US3 |
PRV US3 check R | CTTTGGAATGTGGACCGTAT | |
PRV ΔTK check F | CGCACCCCGAG GTTGACTTCAA | Identification of partial deletion of TK gene |
PRV ΔTK check R | TTGTACGCGCCGAAGAGGGTGT | |
PRV gE site check F | TCTGGAGGGGCCCT CGCCGA | Identification of gE |
PRV gE site check R | AGAGAGAGGACGGAGGCGTGTCATC | |
PRV US3deop-1/2 mRNA F | ATGCACCTGATCGACCTCAT | Real time PCR for determination of US3deop-1/2 mRNA |
PRV US3deop-1/2 mRNA R | TTGTAAATCAGGAAAGCCCC | |
PRV US3deop-3 mRNA F | GACACGGTGGTGCTGAAGGT | Real time PCR for determination of US3deop-1/2 mRNA |
PRV US3deop-3 mRNA R | TACAGATCGCACCGAAAGTG | |
US3deop-1 inred F | ATCTCGAGCTCAAGCTTCGAATTCATGGCCGATGCCGGAATCCCC | Amplification of US3deop-1, US3deop-2, and US3deop-3 |
US3deop-2/3 inred F | ATCTCGAGCTCAAGCTTCGAATTCATGGCCGACGCCGGAATCCC | |
US3deop-1/2/3 inred R | GCGGTACCGTCGACTGCAGAATTCTACGGTCCACATTCCAAA | |
pmKate2-US3 inred F | TTTAGTGAACCGTCAGATCC | Identification of US3deop-1/2/3 in pmKate2-N-US3deop-1, pmKate2-N-US3deop-2, and pmKate2-N-US3deop-3 |
pmKate2-US3 inred R | ACGGGATCAAACGTCAACAT | |
gB F | GCGGTCACCTTGTGGTTGTT | Real time PCR for determination of gB mRNA |
gB R | AACGTCATCGTCACGACCGT |
H1-US3deop-1-Kan-H2 (US3deop-1-Kan with homologous arms), H1-US3deop-2-Kan-H2 (US3deop-2-Kan with homologous arms), and H1-US3deop-3-Kan-H2 (US3deop-3-Kan with homologous arms) DNA were initially amplified with primers of H1-US3deop-1-Kan-H2 F/R, H1-US3deop-2-Kan-H2 F/R, H1-US3deop-3-Kan-H2 F/R (Table 1). After digestion with Dpn I, three PCR products were, respectively, electroporated into E. coli GS1783 with BACPRVΔTK/gE/gI. Approximately 100–150 monoclonal colonies were grown on each plate. There was no significant difference among 3 constructs. Further, single colonies were picked to extract the BAC DNAs. Then, the extracted BAC DNAs were used as a template for PCR identification and sequencing with primers, i.e., US3deop-1-Kan ide F/R, US3deop-2-Kan ide F/R, and US3deop-3-Kan ide F/R (Table 1). These three identified BAC DNAs and the control BACPRVΔTK/gE/gI were digested by Kpn I. Then, the restriction fragment length polymorphism (RFLP) analysis was performed and compared with the predicted profiles. Finally, the positive clones were named BACPRVΔTK/gE/gI-US3deop−1&K+, BACPRVΔTK/gE/gI-US3deop−2&K+, and BACPRVΔTK/gE/gI-US3deop−3&K+, respectively.
The obtained BACPRVΔTK/gE/gI-US3deop−1&K+, BACPRVΔTK/gE/gI-US3deop−2&K+, and BACPRVΔTK/gE/gI-US3deop−3&K+ were subjected to a second step of Red recombination to remove the kanamycin resistance genes. The BAC DNA was initially extracted using the double plate resistance screening approach and further characterized with PCR, and subsequently sequenced using primers PRV US3 check F/R, respectively. The three PCR-positive BAC DNA were selected and digested by Kpn I for RFLP analysis. Finally, the cloned strains that matched with the predicted profiles were named BACPRVΔTK/gE/gI-US3deop−1, BACPRVΔTK/gE/gI-US3deop−2, and BACPRVΔTK/gE/gI-US3deop−3, respectively.
2.2.2. Acquisition of Recombinant Viruses with US3 Codon De-Optimization
The DNA of PRVΔTK&gE-AH02 was used as a template to amplify the gI and partial gE gene fragments with homologous arms (gI+gE’), using the primers PRV gI+gE’ F/R. Then, the gI+gE’ fragments were co-transfected with BACPRVΔTK/gE/gI-US3deop−1, BACPRVΔTK/gE/gI-US3deop−2, and BACPRVΔTK/gE/gI-US3deop−3 DNA, respectively, on ST cells using Lipofectamine® 3000 following the manual of supplier. The mini-F sequences of BACPRVΔTK/gE/gI-US3deop−1, BACPRVΔTK/gE/gI-US3deop−2, and BACPRVΔTK/gE/gI-US3deop−3 were replaced with gI+gE’ fragments. After 24 h of transfection, the culture medium was discarded and supplemented with DMEM containing 10% FBS and 0.5% methylcellulose for 24–48 h. Then, the viruses with no green fluorescence emission were picked under the excitation of Ultraviolet (UV) light at a wavelength of 488 nm and inoculated with fresh ST cells. After picking for several rounds, the DNAs from the three purified viruses were extracted, and the gE gene was identified through PCR and sequencing with a pair of primers (PRV gE site check F/R). Finally, the adequately identified strains were denoted PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, and PRVΔTK&gE-US3deop−3, respectively. A schematic diagram of the construction of PRVΔTK&gE-US3deop−1 as an example is shown in Figure 1.
2.2.3. Detection of US3 Gene Expression from the Virus Background
To detect the US3 gene expression level from the virus background, PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, PRVΔTK&gE-US3deop−3, and PRVΔTK&gE-AH02, as well as parental AH02LA strains, were inoculated with a multiplicity of infection (MOI) of 10 into a monolayer of ST cells. ST cells were harvested at different times (2, 6, and 10 h) after infection. Then, total RNA was extracted and subjected to reverse transcription. After reverse transcription, the expression of the US3 gene in different virulent strains was detected using fluorescence qPCR. The primers are shown in Table 1.
2.2.4. Detection of US3 Protein Expression of Eukaryotic Plasmids with Codon De-Optimized US3
US3 primers, i.e., US3deop-1 inred F, US3deop-2/3 inred F, and US3deop-1/2/3 in red R with EcoR I sites, were initially designed according to the pmKate2-N vector sequence (Table 1). Further, the PRVΔTK&gE-AH02, PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, and PRVΔTK&gE-US3deop−3 were used as templates, respectively, to amplify US3 fragments with homologous vector sequences (h1-US3-h2, h1-US3deop-1-h2, h1-US3deop-2-h2, and h1-US3deop-3-h2). Then, the pmKate2-N vector was digested by EcoR I.
The h1-US3-h2, h1-US3deop-1-h2, h1-US3deop-2-h2, and h1-US3deop-3-h2 were ligated with the pmKate2-N vector, respectively. The ligation system was set as follows: 5 μL of 2×Seamless Cloning Mix, 2 μL of US3 fragment, 1 μL of EcoR I enzymatic linearization pmKate2-N vector, and 2 μL of dd-H2O, reacted at 50 °C for 30–45 min. Then, 5–10 μL of the cooled recombinant product was transformed into DH5α cells to obtain recombinant plasmids, i.e., pmKate2-N-US3, pmKate2-N-US3deop-1, pmKate2-N-US3deop-2, and pmKate2-N-US3deop-3. The recombinant plasmids were identified using PCR and sequencing with primers pmKate2-US3 inred F/R.
The plasmid transfection was performed using Lipofectamine® 3000 following the manual of the supplier. Initially, ST cells were seeded in the 6-well plates, and the transfection process was performed after the growth rate attained a confluence of 70–90%. Then, 10 µg of pmKate2-N-US3, pmKate2-N-US3deop-1, pmKate2-N-US3deop-2, and pmKate2-N-US3deop-3 was added to the plates for transfection, respectively, and they continued to be cultured in the incubator maintained at 37 °C and 5% CO2. Finally, the expression level of the red fluorescent protein of each plasmid was observed under an inverted fluorescence microscope at 24 h post-transfection.
2.2.5. Cytopathic Effect
To determine the characteristics of cytopathic effects (CPE), PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, PRVΔTK&gE-US3deop−3, PRVΔTK&gE-AH02, and parental AH02LA strains were inoculated into the 6-well plates seeded with freshly grown monolayers of ST cells at a MOI of 0.01. Cells were incubated with a cell maintenance solution to 0.6 mL at 37 °C. After 1 h of incubation, the inoculum was removed and DMEM containing 2% FBS was added. Further, CPE were observed under an inverted microscope at 24, 48, and 72 h post-infection, respectively.
2.2.6. Plaque Assay
PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, PRVΔTK&gE-US3deop−3, and PRVΔTK&gE-AH02, along with parental AH02LA, were inoculated into the 6-well plates seeded with fresh ST cells at a MOI of 0.01. DMEM was added as a cell maintenance solution to 0.6 mL and incubated at 37 °C for 1h. Further, the inoculum was removed and a cell maintenance medium containing 1% low melting point agarose and 2% FBS was added. After solidifying the medium, the plate was further incubated for 24 h. A total of 100 images of each virus were taken under the same doubling microscope for each plaque, whose surface area was determined by Image J software (LOCI, University of Wisconsin, Madison, WI, USA). The plaque areas of other strains were compared with that of the parental AH02LA strain, which was set to 100%. All experiments were repeated thrice, independently.
2.2.7. Virus Growth Kinetics
Initially, PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, PRVΔTK&gE-US3deop−3, and PRVΔTK&gE-AH02, as well as parental AH02LA strains, were inoculated on ST cells at a MOI of 0.01, respectively. At 6, 12, 24, 36, 48, 60, and 72 h post-infection, the ST cells were collected with the supernatant mixture. After freeze–thawing thrice at −80 °C and 37 °C, the cell debris was removed using centrifugation, and the viral fluid was harvested. The viral TCID50 were determined on ST cells according to the Reed–Muench method. All experiments were independently replicated thrice.
2.2.8. Genetic Stability Test
The genetic stability test of the modified strains was performed as stated below. Initially, PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, and PRVΔTK&gE-US3deop−3 were transmitted continuously on ST cells for up to 20 generations (F20). gE, TK, and the recoded US3 genes in PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, and PRVΔTK&gE-US3deop−3 were identified via PCR and sequencing with primers PRV ΔTK check F/R, PRV gE site check F/R, and PRV US3 check F/R, respectively.
2.2.9. Pathogenicity and Immunological Experiments in Mice
Healthy ICR female mice (n = 128) aged 4 to 6 weeks were randomly divided into 12 groups of 8 mice each. Mice were subcutaneously inoculated with 0.2 mL of PRVΔTK&gE-AH02, PRVΔTK/gE-US3deop−1, PRVΔTK/gE-US3deop−2, or PRVΔTK/gE-US3deop−3 (107.0 TCID50/0.2 mL, 106.0 TCID50/0.2 mL, and 105.0 TCID50/0.2 mL), respectively. The negative control group was inoculated with 0.2 mL of DMEM. Finally, the clinical signs and mortality rate of mice were monitored daily for 14 days.
The healthy ICR female mice (n = 20) aged 4–6 weeks were randomly divided into 4 groups of 5 mice each. Further, the mice were intraperitoneally injected with 0.2 mL of PRVΔTK/gE-US3deop−1, PRVΔTK/gE-US3deop−2, PRVΔTK/gE-US3deop−3, or PRVΔTK&gE-AH02 (107.0 TCID50/0.2 mL), respectively. At 5 days post-infection, all mice were sacrificed and major organs, i.e., brain and lung samples, were collected. The tissue samples were prepared by weighing 0.1 mg of samples separately and placing them in the grinding beads. After grinding, the samples were centrifuged. Then, the supernatant was used to extract DNA, and the PRV gB gene was used as the target. The viral load was quantified with real-time quantitative PCR using primers gB F/R. Notably, the gB standard curve was used for the linear regression analysis of copy numbers. In addition, histopathological sections of the brain and lung tissues were prepared, and the changes were observed.
Based on our previous study [18], after 2 weeks of immunization in the 107.0 TCID50 dose group, mice were administered with 100 LD50 of PRV AH02LA strain. Further, the clinical signs and mortality rate of mice were monitored daily for 14 days after the challenge. At the end of the experiment, all surviving mice were sacrificed and disposed of harmlessly.
2.2.10. Pathogenicity and Immunological Experiments in Piglets
Briefly, 1-day-old healthy piglets (n = 15), negative for PRV, were randomly divided into 3 groups of 5 piglets each. The piglets in the immunized group were intramuscularly inoculated with 1 mL of PRVΔTK&gE-AH02 (106.0 TCID50/mL), PRVΔTK/gE-US3deop−1 (106.0 TCID50/mL), and DMEM, respectively. High-dose PRV vaccines were used to evaluate their safety in 1-day-old piglets in clinical applications [6,18]. Further, body temperatures, clinical signs, and the mortality rate of piglets in different treatment groups were recorded daily for 14 days. Finally, serum samples were collected from piglets at 7, 14, and 21 days post-inoculation and tested for neutralizing antibody index. Then, 100 μL of each serum sample (heat inactivated for 30 min at 56 °C) was mixed with an equal volume of virus (AH02LA) at a different dilution. The neutralization indexes were calculated as the TCID50 of piglet serum in the test group divided by the TCID50 of negative serum.
Piglets aged 28–35 days old (n = 15) were randomly divided into 3 groups of 5 piglets each and reared in isolated environments in group cages before treatment. The piglets were intramuscularly inoculated with 1 mL of PRVΔTK&gE-AH02 (105.0 TCID50/mL), PRVΔTK/gE-US3deop−1 (105.0 TCID50/mL), and DMEM, respectively. At 1 week post-immunization, all piglets were administered with 2 mL of PRV AH02LA strain (106.5 TCID50/2 mL) via nasal drip based on our previous study [6]. After challenging, the body temperatures, clinical signs, and mortality rate of piglets were recorded daily for 14 days. Nasal swab samples were collected daily from 0 to 14 days post challenge to detect virus shedding. After shaking and freeze–thaw cycles (−80 °C and 37 °C), samples were centrifuged (10,000 rpm) and the supernatants were used to determine the viral titers.
2.3. Statistical Analysis
The data were represented as mean ± standard deviation (SD) and analyzed with one-way analysis of variance (ANOVA) followed by Tukey’s test using GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA), considering a p-value less than 0.05 as statistically significant. * represents p < 0.05, ** indicates p < 0.01, *** signifies p < 0.001, and p > 0.05 refers to a not-significant result.
3. Results
3.1. Generation of Recombinant BAC with US3 Codon De-Optimization
Initially, the codon de-optimized US3 containing the kanamycin resistance gene was subjected to the two-step Red-mediated homologous recombination in E. coli GS1783 containing BACPRVΔTK/gE/gI, and the kanamycin resistance gene was knocked out. Further, the three BACs were identified using the double-plate resistance screening, and PCR and sequencing. Then, BAC DNA was cleaved with Kpn I and subjected to RFLP analysis. It was observed that the predicted PRV (GenBank: KM061380.1) profiles were essentially identical (Figure 2A). Compared to BACPRVΔTK/gE/gI-US3deop−1&K+, BACPRVΔTK/gE/gI-US3deop−2&K+, BACPRVΔTK/gE/gI-US3deop−3&K+, BACPRVΔTK/gE/gI-US3deop−1, BACPRVΔTK/gE/gI-US3deop−2, and BACPRVΔTK/gE/gI-US3deop−3 possessed an additional band of 5843 bp size and a missing band of 6881 bp size.
3.2. Construction and Identification of Recombinant Viruses with US3 Codon De-Optimization
Typically, BACPRVΔTK/gE/gI-US3deop−1, BACPRVΔTK/gE/gI-US3deop−2, and BACPRVΔTK/gE/gI-US3deop−3 DNA were co-transfected with gI+gE’ fragments in the ST cells, respectively. Successful co-transfection could be observed under UV excitation at a wavelength of 488 nm (Figure 2B). After three rounds of picking and plating, purified recombinant viruses with US3 codon de-optimization (PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, and PRVΔTK&gE-US3deop−3) were obtained. PCR and its sequencing analyses validated the successful recovery of gI and part of the gE genes). As depicted in Figure 2C, the mRNA expression levels of US3 genes of PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, and PRVΔTK&gE-US3deop−3 were significantly lower than that of PRVΔTK&gE-AH02 at 10 h post-infection (p < 0.001). As shown in Figure 2D, recombinant eukaryotic plasmids pmKate2-N-US3, pmKate2-N-US3deop-1, pmKate2-N-US3deop-2, and pmKate2-N-US3deop-3 expressed red fluorescent protein at 24 h post-transfection, and the red fluorescent protein expression levels of pmKate2-N-US3deop-1, pmKate2-N-US3deop-2, and pmKate2-N-US3deop-3 were lower than that of pmKate2-N-US3.
3.3. Growth Characteristics of Recombinant Viruses with US3 Codon De-Optimization
Among various strains, the parent AH02LA strain resulted in the most significant number of spots and the largest plaque area at 24 h post-infection. Moreover, cells were fused and shed in large numbers, while the lesions of PRVΔTK&gE-AH02-infected ST cells appeared slightly delayed when compared with those of the parent AH02LA strain. Nevertheless, the plaque morphology showed no significant difference from that of the parent AH02LA strain after 48 h and 72 h of infection. In contrast, PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, and PRVΔTK&gE-US3deop−3 showed smaller plaques, presenting cell fusion and only rarely cell flotation (Figure 3A,B). As observed from the multi-step viral growth curves (Figure 3C), PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, and PRVΔTK&gE-US3deop−3 displayed similar growth kinetics when compared with PRVΔTK&gE-AH02. The peak titers of PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, PRVΔTK&gE-US3deop−3, and PRVΔTK&gE-AH02, as well as the parent AH02LA strains, were 107.67, 107.97, 107.75, 107.75, and 108.18 TCID50/mL, respectively.
3.4. Safety and Immunogenicity in Mice
Clinical symptoms and the number of deaths were displayed in Table 2. Mice inoculated subcutaneously with 0.2 mL of PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, PRVΔTK&gE-US3deop−3 or PRVΔTK&gEAH02 (107.0 TCID50/0.2mL, 106.0 TCID50/0.2mL, and 105.0 TCID50/0.2mL) showed no significant clinical signs, and all mice survived after inoculation.
Table 2.
Virus Strain | Inoculation Dose (TCID50/mL) | Quantity | Clinical Symptoms | Lethality |
---|---|---|---|---|
PRVΔTK&gE-US3deop−1 | 107 | 8 | / | 0 |
106 | 8 | / | 0 | |
105 | 8 | / | 0 | |
PRVΔTK&gE-US3deop−2 | 107 | 8 | / | 0 |
106 | 8 | / | 0 | |
105 | 8 | / | 0 | |
PRVΔTK&gE-US3deop−3 | 107 | 8 | / | 0 |
106 | 8 | / | 0 | |
105 | 8 | / | 0 | |
PRVΔTK&gEAH02 | 107 | 8 | / | 0 |
106 | 8 | / | 0 | |
105 | 8 | / | 0 | |
Control group | / | 8 | / | 0 |
In addition, mice were intraperitoneally inoculated with 107.0 TCID50 of PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, PRVΔTK&gE-US3deop−3, or PRVΔTK&gEAH02. All mice were sacrificed at 5 days post-inoculation, and the viral copy numbers in the brains and lungs of mice were determined using qPCR. Viral DNA copy numbers in the brain and lungs of PRVΔTK&gE-US3deop−1-inoculated mice were lower than those of PRVΔTK&gEAH02-inoculated mice (p < 0.05). PRVΔTK&gE-US3deop−2-inoculated mice showed lower copy numbers in the lungs than PRVΔTK&gEAH02-inoculated mice (p < 0.05). However, no significant difference in viral load between the other groups was observed (Figure 4A).
The histopathological analysis of major organs (brain and lung) in mice was performed at 5 days post-inoculation with 107.0 TCID50 of PRVΔTK/gE-US3deop−1, PRVΔTK/gE-US3deop−2, PRVΔTK/gE-US3deop−3, or PRVΔTK&gE-AH02. In the PRVΔTK/gE-AH02-inoculated mice, inflammatory cell infiltration in the lungs and brains were observed. In contrast, no significant pathological changes were observed in the brains and lungs of mice inoculated with PRVΔTK/gE-US3deop−1 and PRVΔTK/gE-US3deop−2 (Figure 4B).
In the next experiment, mice were immunized with 107.0 TCID50 of PRVΔTK&gE-US3deop−1, PRVΔTK&gE-US3deop−2, PRVΔTK&gE-US3deop−3, and PRVΔTK&gEAH02. At 14 days post-immunization, mice were administered with 100 LD50 of PRV AH02LA strain. It was observed that all mice in the control group succumbed to infection at 4 days post-challenge. The survival rates were eventually recorded as 75% for both PRVΔTK&gE-US3deop−1 and PRVΔTK&gEAH02 groups and 50% and 37.5% for PRVΔTK&gE-US3deop−2 and PRVΔTK&gE-US3deop−3 groups, respectively (Figure 4C and Supplementary Table S1).
3.5. Safety and Immunogenicity in Piglets
Considering the safety and immunogenicity results in mice, we further explored the safety and immunogenicity of PRVΔTK&gE-US3deop−1 in piglets. One-day-old piglets were inoculated intramuscularly with 106.0 TCID50 of PRVΔTK&gE-US3deop−1 or PRVΔTK&gE-AH02 and the temperature changes as well as clinical signs were monitored for 14 days (Figure 5A,B and Supplementary Table S2). After inoculation with PRVΔTK&gE-US3deop−1, it was observed that two piglets presented a normal body temperature and showed no other substantial clinical symptoms. However, three piglets exhibited a body temperature of 40.0–40.5 °C for 2–3 days, and two piglets showed mild respiratory symptoms. In contrast, after PRVΔTK&gE-AH02 vaccination, four piglets displayed a body temperature of 40–41 °C for 3–6 days, and two piglets developed clinical symptoms, such as sneezing, coughing, and loss of appetite, while the other piglets appeared healthy.
Moreover, serum was collected from piglets at 7, 14, and 21 days post-immunization to detect the neutralizing antibody index (Figure 5C). At 7 days post-immunization, the neutralizing antibody index was low in the PRVΔTK&gE-US3deop−1 and PRVΔTK&gE-AH02 treatment groups, and it subsequently increased progressively. At 14 days post-immunization, the neutralizing antibody index was 50,118 in the PRVΔTK&gE-US3deop−1 treatment group and 72,443 in the PRVΔTK&gE-AH02 treatment group. At 21 days post-immunization, the neutralizing antibody index was 1,698,244 in the PRVΔTK&gE-US3deop−1 group and 2,884,031 in the PRVΔTK&gE-AH02 group. Notably, no significant difference in the neutralizing antibody index was observed between the PRVΔTK&gE-AH02 and PRVΔTK&gE-US3deop−1 groups at 7, 14, and 21 days post-immunization. In future studies, we will also detect the duration of antibodies in piglets immunized with PRVΔTK&gE-US3deop−1. For protective efficacy, all piglets in the challenge control group developed a reduced appetite and sneezing at 2 days post-challenge. At 3 days post-challenge, typical symptoms, such as nasal mucous discharge, salivation, abdominal breathing, depression, and loss of appetite, began to appear. The body temperature of all piglets in the challenge control group reached over 41 °C for 3–6 days. All five piglets in the challenge control group died during the test period. After the AH02LA challenge, no clinical signs or temperature responses were observed in piglets immunized with PRVΔTK&gE-US3deop−1 and PRVΔTK&gE-AH02 (Figure 6A,B and Supplementary Table S3).
After the challenge, nasal swabs were collected daily to determine the virus titers in the excreted nasal discharge. It was observed that all piglets in the control group started to shed the virus at 1 day post-challenge, and continued to do so until death. However, no virus was detected in piglets immunized with PRVΔTK&gE-US3deop−1 and PRVΔTK&gE-AH02 (Figure 6C and Supplementary Table S4).
4. Discussion
Since 2011, a virulent variant of PRV has developed into an epidemic in pig operations in China. It has increasingly been recognized that the traditional Bartha-K61 vaccine showed poor immune protection, lacking the ability to prevent virus shedding [19,20,21]. To deal with the hazardous nature of PRV mutant strains, several PRV gene-deleted and attenuated vaccines have been developed using mutant strains that can improve protection against PRV variant strains, and discriminate between immunized pigs and pigs infected with wild-type virus [6,22,23,24]. Nevertheless, the safety of these attenuated strains for PRV antibody-negative neonatal piglets is particularly perturbing [6]. The further attenuation of these strains while maintaining immunogenicity is necessary to develop a safe and effective live PRV vaccine.
Codon de-optimization has emerged as one of the efficient strategies for the engineering of live-attenuated vaccines in many systems [9,12]. Notably, codon de-optimization is often achieved using suboptimal codons to recode virulence genes. This approach offers many advantages, as stated in the following. Regarding safety, codon de-optimization often relies on introducing many synonymous mutations in virulence genes, leading to the highly efficient attenuation of the virus by reducing viral gene expression [8,25]. Considering excellent immunogenicity, codon de-optimization did not change the amino acid sequence in the viral protein, retaining the same antigenic epitopes as the wild-type virus [8]. In terms of simple operation, the codon de-optimized viruses could be generated rapidly via gene synthesis and reverse genetics, and it is theoretically possible to control the degree of attenuation.
Although a lack of viral protein kinase activity results in reduced virulence, several kinases, including herpesvirus kinase, are often dispensable for growth in cell culture [17,18,26]. The US3 gene encodes a 334–390 amino acid protein serine/threonine kinase, and is a positive regulator of viral replication and pathogenicity [27,28]. Notably, the US3 gene is involved in viral particle formation, cytoskeletal rearrangement, and the escape of multiple host antiviral responses [29,30,31].
In the current study, the US3 gene was divided into three segments, and codon de-optimization was designed for each. It was observed that the protein expression levels of the recombinant eukaryotic plasmid were significantly reduced after the US3 codon de-optimization. Further, the virus growth curve assay showed that the US3 gene de-optimization showed no substantial effect on the virus proliferation. Nevertheless, several differences were evident when compared to the parental virus, such as the delayed time of plaque formation, a rare occurrence of cell fusion and smaller plaques. The genetic stability test revealed that there was no change in the codon de-optimized sequences, heralding a very low possibility of reversion to virulence. The three recombinant viruses with US3 codon de-optimization were tested for pathogenicity and immunogenicity in mice. The results showed that PRVΔTK&gE-US3deop−1 decreased the virus load and attenuated pathological changes in the brain and lung of mice compared with PRVΔTK&gE-AH02. The protection efficiency of PRVΔTK&gE-US3deop−1 was similar to PRVΔTK&gE-AH02 in mice. Further, a piglet safety test showed that PRVΔTK&gE-US3deop−1 was less pathogenic in piglets than PRVΔTK&gE-AH02, producing high levels of neutralizing antibody. Finally, an evaluation of the immunoprotective effect of PRVΔTK&gE-US3deop−1 in piglets showed that it not only provided complete protection, but also prevented virus shedding against the virulent variant AH02LA challenge at 1 week post-immunization. It is clear that levels of antibodies correlate poorly with the decreased virus replication early after infection, and PRV-specific lymphocyte proliferation responses and a rapid influx of T lymphocytes at the site of viral replication play an important role in the clearance of PRV infection [32,33]. Therefore, the PRV-specific cell-mediated immune response may have been related to the prevention of clinical disease and virus shedding early after challenge. Future studies involving cell-mediated immunity analysis are necessary to better understand the mechanisms of immune protection induced by live PRV vaccines.
5. Conclusions
In summary, a recombinant virus with US3 codon de-optimization (PRVΔTK&gE-US3deop−1) was successfully constructed. With its high immune efficacy, it could be a suitable vaccine candidate, presenting its potential for eliminating newly arising PRV variants in pig farms. This study also provided a new theoretical basis and technical means for PRV vaccine development.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/vaccines11081288/s1, Supplementary Information S1: Nucleotide sequence of US3-1, US3-2, US3-3 and US3deop-1, US3deop-2, US3deop-3. Nucleotide changes compared to original sequence are highlighted in red. Table S1: Data presents the immunogenicity of different virus strains in mice. Table S2: Data presents the pathogenicity of different virus strains in piglets. Table S3: Data presents the immunogenicity of different virus strains in piglets. Table S4: Determination of virus titers in nasal swabs collected daily in the challenge-infected piglets.
Author Contributions
Conceptualization, J.W. and C.Z.; methodology, M.X.; validation, Y.W., S.C. and L.Z.; formal analysis, L.T., Y.Z. and M.X.; writing—original draft preparation, Y.L. and M.X.; writing—review and editing, N.O. and C.Z. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
This study was approved by the Animal Ethics Committee of Jiangsu Academy of Agricultural Sciences and followed the guidelines of animal experimentation outlined by Jiangsu Province (SYXK-Su-2020-0023).
Informed Consent Statement
Not applicable.
Data Availability Statement
The figures and tables supporting the results of this study are included in the article and Supplementary Materials, and the original datasets are available from the first author or corresponding author upon request.
Conflicts of Interest
The authors declare that there are no conflict of interest in this article.
Funding Statement
This work was supported by the Jiangsu Agriculture Science and Technology Innovation Fund (CX(21)3130).
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Mettenleiter T.C. Aujeszky’s disease (pseudorabies) virus: The virus and molecular pathogenesis—State of the art, June 1999. Vet. Res. 2000;31:99–115. doi: 10.1051/vetres:2000110. [DOI] [PubMed] [Google Scholar]
- 2.Zheng H., Fu P., Chen H., Wang Z. Pseudorabies virus: From pathogenesis to prevention strategies. Viruses. 2022;14:1638. doi: 10.3390/v14081638. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Gu Z., Hou C., Sun H., Yang W., Dong J., Bai J., Jiang P. Emergence of highly virulent pseudorabies virus in southern China. Can. J. Vet. Res. 2015;79:221–228. [PMC free article] [PubMed] [Google Scholar]
- 4.Bo Z., Miao Y., Xi R., Gao X., Miao D., Chen H., Jung Y.S., Qian Y., Dai J. Emergence of a novel pathogenic recombinant virus from Bartha vaccine and variant pseudorabies virus in China. Transbound Emerg. Dis. 2020;68:1454–1464. doi: 10.1111/tbed.13813. [DOI] [PubMed] [Google Scholar]
- 5.Tan L., Yao J., Lei L., Xu K., Liao F., Yang S., Yang L., Shu X., Duan D., Wang A. Emergence of a novel recombinant pseudorabies virus derived from the field virus and its attenuated vaccine in China. Front. Vet. Sci. 2022;9:872002. doi: 10.3389/fvets.2022.872002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wang J., Song Z., Ge A., Guo R., Qiao Y., Xu M., Wang Z., Liu Y., Zheng Y., Fan H., et al. Safety and immunogenicity of an attenuated Chinese pseudorabies variant by dual deletion of TK&gE genes. BMC Vet. Res. 2018;14:287. doi: 10.1186/s12917-018-1536-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chen F., Wu P., Deng S., Zhang H., Hou Y., Hu Z., Zhang J., Chen X., Yang J.R. Dissimilation of synonymous codon usage bias in virus-host coevolution due to translational selection. Nat. Ecol. Evol. 2020;4:589–600. doi: 10.1038/s41559-020-1124-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Groenke N., Trimpert J., Merz S., Conradie A.M., Wyler E., Zhang H.W., Hazapis O.G., Rausch S., Landthaler M., Osterrieder N., et al. Mechanism of virus attenuation by codon pair deoptimization. Cell Rep. 2020;31:107586. doi: 10.1016/j.celrep.2020.107586. [DOI] [PubMed] [Google Scholar]
- 9.Lorenzo M.M., Nogales A., Chiem K., Blasco R., Martinez-Sobrido L. Vaccinia virus attenuation by codon deoptimization of the A24R gene for vaccine development. Microbiol. Spectr. 2022;10:e0027222. doi: 10.1128/spectrum.00272-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Vaz P.K., Armat M., Hartley C.A., Devlin J.M. Codon pair bias deoptimization of essential genes in infectious laryngotracheitis virus reduces protein expression. J. Gen. Virol. 2023;104:1836. doi: 10.1099/jgv.0.001836. [DOI] [PubMed] [Google Scholar]
- 11.Broadbent A.J., Santos C.P., Anafu A., Wimmer E., Mueller S., Subbarao K. Evaluation of the attenuation, immunogenicity, and efficacy of a live virus vaccine generated by codon-pair bias de-optimization of the 2009 pandemic H1N1 influenza virus, in ferrets. Vaccine. 2016;34:563–570. doi: 10.1016/j.vaccine.2015.11.054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Cai Y., Ye C., Cheng B., Nogales A., Iwasaki M., Yu S., Cooper K., Liu D.X., Hart R., Adams R., et al. A Lassa fever live-attenuated vaccine based on codon deoptimization of the viral glycoprotein gene. mBio. 2020;11:e00039-20. doi: 10.1128/mBio.00039-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Konopka-Anstadt J.L., Campagnoli R., Vincent A., Shaw J., Wei L., Wynn N.T., Smithee S.E., Bujaki E., Te Yeh M., Laassri M., et al. Development of a new oral poliovirus vaccine for the eradication end game using codon deoptimization. NPJ Vaccines. 2020;5:26. doi: 10.1038/s41541-020-0176-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Mueller S., Stauft C.B., Kalkeri R., Koidei F., Kushnir A., Tasker S., Coleman J.R., Mueller S., Stauft C.B., Kalkeri R., et al. A codon-pair deoptimized live-attenuated vaccine against respiratory syncytial virus is immunogenic and efficacious in non-human primates. Vaccine. 2020;450:132–139. doi: 10.1016/j.vaccine.2020.02.056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Chen J.W., Yang L., Santos C., Hassan S.A., Collins P.L., Buchholz U.J., Le Nouen C. Reversion mutations in phosphoprotein P of a codon-pair-deoptimized human respiratory syncytial virus confer increased transcription, immunogenicity, and genetic stability without loss of attenuation. PLoS Pathog. 2021;17:e1010191. doi: 10.1371/journal.ppat.1010191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lee M.H.P., Tan C.W., Tee H.K., Ong K.C., Sam I.C., Chan Y.F. Vaccine candidates generated by codon and codon pair deoptimization of enterovirus A71 protect against lethal challenge in mice. Vaccine. 2021;39:1708–1720. doi: 10.1016/j.vaccine.2021.02.024. [DOI] [PubMed] [Google Scholar]
- 17.Jacob T., Van den Broeke C., Favoreel H.W. Viral serine/threonine protein kinases. J. Virol. 2011;85:1158–1173. doi: 10.1128/JVI.01369-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Xu M., Zhang C., Liu Y., Chen S., Zheng Y., Wang Z., Cao R., Wang J. A noval strategy of deletion in PK gene for construction of a vaccine candidate with exellent safety and complete protection efficiency against high virulent Chinese pseudorabies virus variant. Virus Res. 2022;313:198740. doi: 10.1016/j.virusres.2022.198740. [DOI] [PubMed] [Google Scholar]
- 19.An T., Peng J., Tian Z., Zhao H., Li N., Liu Y., Chen J., Leng C., Sun Y., Chang D., et al. Pseudorabies virus variant in Bartha-K61-vaccinated pigs, China, 2012. Emerg. Infect. Dis. 2013;19:1749–1755. doi: 10.3201/eid1911.130177. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Sun Y., Zhao L., Fu Z. Effective cross-protection of a lyophilized live gE/gI/TK-deleted pseudorabies virus (PRV) vaccine against classical and variant PRV challenges. Vet. Microbiol. 2022;267:109387. doi: 10.1016/j.vetmic.2022.109387. [DOI] [PubMed] [Google Scholar]
- 21.Jiang C., Ma Z., Bai J., Sun Y., Cao M., Wang X., Jiang P., Liu X. Comparison of the protective efficacy between the candidate vaccine ZJ01R carrying gE/gI/TK deletion and three commercial vaccines against an emerging pseudorabies virus variant. Vet. Microbiol. 2023;276:109623. doi: 10.1016/j.vetmic.2022.109623. [DOI] [PubMed] [Google Scholar]
- 22.Cong X., Lei J., Xia S., Wang Y., Li Y., Li S., Luo Y., Sun Y., Qiu H. Pathogenicity and immunogenicity of a gE/gI/TK gene-deleted pseudorabies virus variant in susceptible animals. Vet. Microbiol. 2016;182:170–177. doi: 10.1016/j.vetmic.2015.11.022. [DOI] [PubMed] [Google Scholar]
- 23.Li L., Du Y., Zhang Y., Li P., Liu X., Zhang X., Li J., Zhang T., Li X., Xiao D., et al. Comprehensive evaluation of the safety and immunogenicity of a gene-deleted variant pseudorabies virus attenuated vaccine. Vet. Res. 2022;53:73. doi: 10.1186/s13567-022-01091-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Sun L., Tang Y., Yan K., Zhang H., Sun L., Tang Y., Yan K., Zhang H. Construction of a quadruple gene-deleted vaccine confers complete protective immunity against emerging PRV variant challenge in piglets. Virol. J. 2022;19:19. doi: 10.1186/s12985-022-01748-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Eschke K., Trimpert J., Osterrieder N., Kunec D. Attenuation of a very virulent Marek’s disease herpesvirus (MDV) by codon pair bias deoptimization. PLoS Pathog. 2018;14:e1006857. doi: 10.1371/journal.ppat.1006857. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sehl J., Portner S., Klupp B.G., Granzow H., Franzke K., Teifke J.P., Mettenleiter T.C. Roles of the Different isoforms of the pseudorabies virus protein kinase pUS3 in nuclear egress. J. Virol. 2020;94:e02029-19. doi: 10.1128/JVI.02029-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Olsen L.M., Ch’ng T.H., Card J.P., Enquist L.W. Role of pseudorabies virus Us3 protein kinase during neuronal infection. J. Virol. 2006;80:6387–6398. doi: 10.1128/JVI.00352-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Esteves A.D., Koyuncu O.O., Enquist L.W. A pseudorabies virus serine/threonine kinase, US3, promotes retrograde transport in axons via Akt/mToRC1. J. Virol. 2022;96:e0175221. doi: 10.1128/jvi.01752-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Granzow H., Klupp B.G., Mettenleiter T.C. The pseudorabies virus US3 protein is a component of primary and of mature virions. J. Virol. 2004;78:1314–1323. doi: 10.1128/JVI.78.3.1314-1323.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Van den Broeke C., Deruelle M., Nauwynck H.J., Coller K.E., Smith G.A., Van Doorsselaere J., Favoreel H.W. The kinase activity of pseudorabies virus US3 is required for modulation of the actin cytoskeleton. Virology. 2009;385:155–160. doi: 10.1016/j.virol.2008.11.050. [DOI] [PubMed] [Google Scholar]
- 31.Xie J., Zhang X., Chen L., Bi Y., Idris A., Xu S., Li X., Zhang Y., Feng R. Pseudorabies virus US3 protein inhibits IFN-beta production by interacting with IRF3 to block its activation. Front. Microbiol. 2021;12:761282. doi: 10.3389/fmicb.2021.761282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Bouma A., Zwart R.J., De Bruin M.G., De Jong M.C., Kimman T.G., Bianchi A.T. Immunohistological characterization of the local cellular response directed against pseudorabies virus in pigs. Vet. Microbiol. 1997;58:145–154. doi: 10.1016/S0378-1135(97)00168-5. [DOI] [PubMed] [Google Scholar]
- 33.van Rooij E.M., de Bruin M.G., de Visser Y.E., Middel W.G., Boersma W.J., Bianchi A.T. Vaccine-induced T cell-mediated immunity plays a critical role in early protection against pseudorabies virus (suid herpes virus type 1) infection in pigs. Vet. Immunol. Immunopathol. 2004;99:113–125. doi: 10.1016/j.vetimm.2004.01.004. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The figures and tables supporting the results of this study are included in the article and Supplementary Materials, and the original datasets are available from the first author or corresponding author upon request.