Effect of synbiotic supplementation on production performance and severity of necrotic enteritis in broilers during an experimental necrotic enteritis challenge

Abstract

To evaluate the efficacy of synbiotic during a necrotic enteritis (NE) infection, a total of 360 day-old chicks were randomly assigned into 4 experimental groups in a 2 × 2 factorial setup: control, challenge, synbiotic (1 g/kg), and challenge + synbiotic, with 6 replicates. NE was induced by gavaging 1 × 10⁴Eimeria maxima oocysts and 1 × 10⁸ CFU/mL of Clostridium perfringens on d 14 (D14) and D19, 20, and 21, respectively. At D35, the NE challenge decreased the BW gain (P < 0.001) and increased feed conversion ratio (P = 0.03), whereas synbiotic supplementation decreased the feed intake (P = 0.04). At D21, NE challenge increased gut permeability (P < 0.001), decreased regulatory T cells (Tregs) in the cecal tonsil (CT) (P = 0.02), increased Tregs in the spleen (P = 0.02), decreased nitric oxide (NO) production in the spleen (P = 0.04) and decreased IL-10 expression in CT (P = 0.02), whereas synbiotic supplementation increased CD4+:CD8+ T cells in the spleen (P < 0.001) and decreased interferon (IFN)-γ expression in the jejunum (P = 0.07), however, synbiotic supplementation during NE challenge decreased mid-gut lesion score (P < 0.001), increased CD4+:CD8+ T cells in CT and decreased IgA production in bile (P < 0.001), compared to the control group. At D28, synbiotic supplementation decreased CD4+:CD8+ T cells in CT (P < 0.001), whereas synbiotic supplementation during NE challenge decreased Tregs in CT (P < 0.001) and increased NO production in the spleen (P = 0.04), compared to the control group. At D35, the NE challenge decreased CD4+:CD8+ T cells in the spleen (P = 0.03), decreased IgA production in bile (P = 0.02), decreased IL-10 expression in CT (P = 0.04), and decreased IL-10 (P = 0.009), IFN-γ (P = 0.03) and inducible nitric oxide synthase (P = 0.02) expression in the jejunum, whereas synbiotic supplementation increased Tregs in the spleen (P = 0.04), compared to control group. Synbiotic supplementation during the NE challenge decreased both IL-1β (P = 0.02) and IFN-γ (P = 0.001) expression in CT, compared to the control group. It can be concluded that synbiotic supplementation increases production performance by decreasing mid-gut lesions and enhancing protective immunity against NE, and efficiency of synbiotic could be improved by blending additional probiotics and prebiotics.

INTRODUCTION

Necrotic enteritis (NE) is an infectious disease in poultry caused by rod-shaped, encapsulated, anaerobic, spore-forming, gram-positive bacteria, Clostridium perfringens. Each year, an estimated loss of $6 billion is due to NE on the poultry industry worldwide (Timbermont et al., 2011). In poultry, α-toxin, β-toxin, and necrotic enteritis B-like (NetB) toxins are critically associated with NE (Keyburn et al., 2008). Typically, C. perfringens is part of the commensal gut microbial population. An estimated normal count in healthy chicken is between 10^1.5 and 10^4.8 CFU per gram of wet intestinal scrapping (Long et al., 1974). However, several predisposing factors, such as coccidial infection, high stocking density, immunosuppression, and gut dysbiosis, lead to the rapid proliferation of C. perfringens and the development of NE (Fathima et al., 2022).

Previously, antimicrobial growth promoters (AGPs) were used to improve production performance and control the incidence of infectious diseases in poultry production. Extensive and continued use of AGPs in poultry diets resulted in antimicrobial-resistant bacteria and remnants of residue in poultry products, compromising human and animal health (Mehdi et al., 2018). These consequences led to the ban of AGPs in the poultry diet, especially the antimicrobials which were also medically critical to the humans (FDA, 2013). In addition, the removal of AGPs in poultry diet has led to altered digestion and absorption of nutrients in the intestine and increased the risk of uncontrolled proliferation of intestinal pathogens, resulting in poor production performance, high mortality, increased production cost, compromised welfare, and unacceptable meat quality (Gaucher et al., 2015). Therefore, the poultry industry needs to find a suitable alternative to AGPs. Several studies suggested probiotics and prebiotics as potential alternatives to AGPs in controlling NE infection in poultry (Mortada et al., 2020; Sharma et al., 2022).

Probiotics are defined as “live microorganisms which, when administered in adequate amounts, confer a health benefit on the host” (Hill et al., 2014). Probiotics compete with pathogenic bacteria in the intestine for successive colonization (Poudel et al., 2022), produce several natural antimicrobial compounds such as bacteriocins, organic acids, hydrogen peroxide, and short chain fatty acid (SCFA) (Bizani and Brandelli, 2002), enhance intestinal barrier, and enhance host immunity (Yang et al., 2012). Prebiotics are defined as “a selectively fermented ingredient that results in specific changes in the composition and activity of the gastrointestinal microbiota, thus conferring benefit(s) upon host health” (Gibson et al., 2010). Numerous experiments have shown that probiotics and prebiotics could improve production performance, reduce mortality, improve gut integrity, modulate the mucosal immune response, and increase the colonization of beneficial bacteria in ceca and ileal mucosa (Shojadoost et al., 2022).

Synbiotic, a mixture of probiotics and prebiotics, synergistically enhances the gut health of the host. Synbiotic benefits the host through competitive inclusion, production of antimicrobial compounds, modulating the immune response by production of antibodies, enhancing the phagocytosis by immune cells, stimulating the activity of natural killer cells, and production of anti-inflammatory cytokines. Additionally, synbiotic also promotes the probiotic component of the intestine and enhance the production of SCFA, which serves as an energy source for intestinal cells and maintains the intestinal integrity. There are minimal studies available on synbiotic supplementation during NE infection. Some of them found the role of synbiotic in improving production performance, improving tissue repair, maintaining intestinal integrity, inducing humoral mucosal immunity, and reducing the load of C. perfringens in ceca (Shanmugasundaram et al., 2020b). Therefore, there is huge potential for synbiotic as an effective alternative to AGPs through the synergistic effect of both probiotics and prebiotics, which requires further exploration.

This study aims to evaluate the impact of synbiotic supplementation on broilers under an experimentally induced NE infection. Specifically, we will evaluate the role of synbiotic supplementation on production performance, intestinal integrity, humoral mucosal immune response, cell-mediated mucosal immune response, and systemic immune response.

MATERIALS AND METHODS

All animal protocols were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Georgia (IACUC protocol # A2021 06-002-A2).

Birds, Diet, and NE Infection

A total of 360 day-old male broiler chicks were randomly distributed into 4 treatment groups in a 2 × 2 factorial setup resulting in the following treatments: Control, Challenge, Synbiotic, and Synbiotic + Challenge. Each treatment was randomly allocated into 6 pen replicates (n = 6), with 15 birds per pen. The birds in the control group were fed corn- and soybean-based basal diets (Table 1), which meets the minimum requirement by National Research Council (NRC, 1994). The birds in the synbiotic group were fed with basal diets supplemented with synbiotic (1 g/kg) (PoultryStar ME, Biomin America, Inc., Exton, PA), which contained 4 live strains from the adult chickens (Limosilactobacillus reuteri, Enterococcus faecium, Bifidobacterium animalis, and Pediococcus acidilactici) along with prebiotic, Fructooligosaccharide (FOS). The birds in the challenge group were orally gavaged with 1 × 10⁴ Eimeria maxima oocysts on D14, followed by 1 × 10⁸ CFU/mL of C. perfringens (CP 6, netB and TpeL positive) on D19, D20, and D21. The birds in nonchallenged birds were gavaged with the same volume of 1× PBS. Body weight and feed intake were measured weekly, and body weight gain and feed conversion ratio (FCR) were calculated by adjusting the mortality. A bird from each pen was sacrificed on D21, D28, and D35, and samples were collected.

Table 1.

Basal diets; starter and finisher with ingredients and nutrient composition.

	Basal diet
Ingredients	Starter (D0–D14) %	Finisher (D15–D35) %
Corn	55.25	64.35
Soybean meal	38.18	29.29
Soybean oil	2.07	2.5
Dical	1.62	1.32
Limestone	1.34	1.17
NaCl	0.43	0.38
D.L. Methionine	0.42	0.4
L Lysine	0.26	0.19
Choline chloride	0.25	0.22
Vitamins premix1	0.1	0.1
Trace mineral premix2	0.08	0.08
Total	100	100
Calculated nutrient composition
ME, kcal/kg	3050	3168
Crude protein, %	21.44	18.94
Crude fat, %	4.55	4.05
Lysine, %	1.31	1.05
Calcium, %	0.95	0.76
TSAA, %	0.91	0.82
Threonine, %	0.87	0.71
Methionine, %	0.56	0.55
Available phosphorus, %	0.45	0.38

¹Vitamin mix provided the following per kg of diet: 2.4 mg thiamin-mononitrate, 44 mg nicotinic acid, 4.4 mg riboflavin, 12 mg D-Ca pantothenate, 12 g vitamin B12, 2.7 mg pyridoxine-HCl, 0.11 mg D-biotin, 0.55 mg folic acid, 3.34 mg menadione sodium bisulfate complex, 220 mg choline chloride, 1,100 IU cholecalciferol, 2,500 IU trans-reinyl acetate, 11 IU all-rac-tocopherol acetate, and 150 mg ethoxyquin.

²Trace mineral mix provided the following per kg of diet: 101 mg MnSO₄.H₂O, 20 mg FeSO₄.7H₂O, 80 mg Zn, 3 mg CuSO₄.5H₂O, 0.75 mg ethylene diamine dihydroiodide, 20 mg MgO, and 0.3 mg sodium selenite.

Effect of Synbiotic Supplementation on Gut Permeability

On D21, D28, and D35 of the study, a bird from each pen was orally gavaged with 2.2 mg/mL of fluorescein isothiocyanate-dextran (FITC-d; 100 mg, MW 4,000; Sigma-Aldrich, Ontario, Canada). Two hours later, the birds were sacrificed, and blood was collected from the heart and stored in opaque tubes. After serum separation, 100 mL of blood serum was added in duplicates in a 96-well black plate. The FITC-d in blood serum was measured using a microplate reader (BioTek, Winooski, VT) at the wavelength of 485 nm and emission wavelength of 528 nm. The concentration of FITC-d/mL in blood serum was calculated using a standard curve, with a high FITC-d concentration meaning greater gut permeability.

Effect of Synbiotic Supplementation on CD4+:CD8+ T Cells and Regulatory T Cells

On D21, D28, and D35 of the study, a cecal tonsil (CT) and half of the spleen of 1 bird per pen were collected in a 5 mL tube containing 3 mL of incomplete RPMI-1640 medium, stored on ice, and transported to the laboratory. Flow cytometry for CD4+, CD8+, and Tregs was performed as described previously (Shanmugasundaram and Selvaraj, 2012) with minute modifications. Approximately 1 × 10⁶ cells were incubated with primary phycoerythrin-linked mouse anti-chicken CD25 (Shanmugasundaram and Selvaraj, 2010) at 1:10 dilution, FITC conjugated mouse anti-chicken CD4 cells (Catalog number 8210-90, Southern Biotech, Birmingham, AL) at 1:250 dilution or FITC conjugated mouse anti-chicken CD8 cells (Catalog number 8220-02, Southern Biotech) at 1:450 dilution, and unlabeled mouse IgG at 1:100 dilution for 20 min at 4°C. The unbound primary antibodies were removed by centrifuging at 400 × g at 10°C for 5 min. The percentage of CD4+, CD8+, and CD4+CD25+ (Tregs) T cells in CT and spleen was identified by reading the plates on a flow cytometer (Guava EasyCyte, Millipore, Billerica, MA). The percentage of CD4+, CD8+, and CD4+CD25+ T cells was evaluated after gating cells based on forward-scatter and side-scatter plots for lymphocytes, and the CD4+:CD8+ ratio was calculated. Tregs percentage is expressed as the percentage of CD4+ cells.

Effect of Synbiotic Supplementation on Nitric Oxide Production From Splenocyte Mononuclear Cells

On D21 and D28 of the study, the spleen from 1 bird per pen was dissected, and half of the spleen was collected in a 5 mL tube containing 3 mL of incomplete RPMI-1640 medium, stored on ice, and transported to the laboratory. Nitrite (stable breakdown product of nitric oxide) production by splenocyte mononuclear cells (MNCs) was determined by nitric oxide assay as described previously (Annamalai and Selvaraj, 2012) with some modifications. A single-cell suspension was prepared by straining the spleen through a 45 mm cell strainer (Corning, NY), and 10 mL of single-cell suspension was enriched for MNCs by density centrifugation over Histopaque (1.077 g/mL, Sigma-Aldrich, St. Louis, MO) for 10 min at 1,200 × g at 10°C without breaks. The MNCs were washed and resuspended in 5 mL of complete RPMI-1640 medium (supplemented with 2% FBS, 2% chicken serum, and 0.5% penicillin + streptomycin) in T75 cell culture flask and incubated in a 5% CO₂ incubator at 41°C for 24 h. After incubation, the nonadhered cells were washed with 1× PBS, and nonadhered cells were detached by trypsinization (5 mL of 0.4% trypsin supplemented with 0.025% EDTA) which was further neutralized and washed by complete RPMI-1640 medium (10% fetal bovine serum, 2% chicken serum, and 0.5% penicillin + streptomycin). The MNCs were reseeded in duplicates in two 96-well plates (100 mL/well of 1 × 10⁵ cells/mL) and then stimulated with complete RPMI-1640 media (2% fetal bovine serum, 2% chicken serum, and 0.5% penicillin + streptomycin) supplemented with 1 mg/mL of C. perfringens lipopolysaccharide. Then each 96-well plate was then incubated for 24 h and 48 h, respectively. At each time point, the respective 96-well plate was centrifuged at 650 × g for 4 min at 10°C, and the supernatant was removed. The nitrite level in the supernatant was determined by the Griess method (Green et al., 1982). In the supernatant, 100 mL of sulfanilamide/N-(1-Naphthyl) ethylenediamine dihydrochloride solution (#R2233500, Ricca Chemical Company, Arlington, TX) was added and incubated in the dark at room temperature for 5 min. After incubation, absorbance was measured at 540 nm using an Epoch microplate spectrophotometer (BioTek), and optical density (OD) values at 540 nm were recorded. Nitrite concentrations were determined from a standard curve prepared by plotting different concentrations of sodium nitrite solutions against their OD values at 540 nm.

Effect of Synbiotic Supplementation on C. Perfringens Load in the Cecal Content

In D21 and D28 of the study, whole ceca from 1 bird per pen were collected aseptically into a stomacher bag, stored on ice, and transported to the laboratory. C. perfringens load in cecal content was determined by the method described previously (Mortada et al., 2020) with minute modifications. The cecal weight was taken, and the same amount of 1× PBS was added to the stomacher bag, macerated with a wooden mallet, and homogenized for 1 min. A volume of 100 mL of each sample was serially diluted into 1× PBS to obtain 1 × 10⁻¹ to 1 × 10⁻⁶ dilutions. A volume of 100 mL from each dilution was plated into CM0587 perfringens agar base supplemented with egg yolk and TSC, placed in an anaerobic chamber along with an anaerobic gas pack, and incubated at 42°C for 24 h. After incubation, the colonies were counted, and the data were transformed into Log10 CFU/mL. Samples from presumptive positive colonies were confirmed using SyBr green quantitative PCR and primers targeting the alpha-toxin and NetB gene.

Effect of Synbiotic Supplementation on Lesion Score in the Intestine

On D21 of the study, 3 birds from each pen were randomly selected, sacrificed, and the mid-gut was inspected to examine the lesion score. The scoring was performed on a scale of 0 to 3, with 0 as normal and 3 as most severe, where 0 = no gross lesion, 1 = thin-walled or friable, 2 = focal necrosis or ulceration, and 3 = large patches of necrosis (Zhang et al., 2010a). The lesion score data were analyzed by Wilcoxon/Kruskal–Wallis test, and score rank means, and their difference was calculated.

Effect of Synbiotic Supplementation on Anti-Clostridium IgA Antibodies in the Bile

On D21, D28, and D35 of the study, 1 bird per pen was sacrificed, and bile was collected aseptically into a 2 mL Eppendorf tube, stored on ice, and transported to the laboratory. The level of anti-Clostridium IgA antibodies in bile was determined by ELISA as described previously (Shanmugasundaram et al., 2020a) with some modifications. The C. perfringens protein for coating was prepared by 6 consecutive freeze-thaw-lyse cycles of pure culture of C. perfringens. The culture was mechanically lysed using glass beads of size 425 to 600 mm in a tissue lyser for 5 min at 50 Hz. A 96-well ELISA plate was coated with 10 mg/mL of C. perfringens protein diluted in 0.1M carbonate buffer (pH 9.6) and left overnight at 4°C. Next day, the plate was washed, and the coating was blocked by adding PBS containing 8% nonfat dry milk and a tween. Bile was diluted 1:100 in PBS containing 8% nonfat dry milk and 0.05% tween. The Horseradish peroxidase conjugated anti-chicken IgA diluted 1:100,000 in PBS containing 5% nonfat dry milk and 0.05% tween. The substrate 3,3,5,5-tetramethylbenzidine solution was added, and the reaction was stopped by using 1N HCl. The OD values at 450 nm were measured using a microplate ELISA reader (BioTek), and anti-Clostridium IgA antibody values were reported as mean OD values.

Effect of Synbiotic Supplementation on the Expression of Cytokine Genes in Cecal Tonsil, and Expression of Cytokine Gene and Tight Junction Proteins in the Jejunum

One bird per pen was sacrificed on D21, D28, and D35 of the study, and CT and jejunal section was collected aseptically into RNA later. Five days later, the tissue section was removed from RNA later and stored at −20°C. Total RNA from the tissue section was extracted using a Tri reagent per the manufacturer's instruction. The RNA quality and quantity were measured using a nanodrop spectrophotometer. The RNA was reverse transcribed into cDNA using oligodt primers and was analyzed for IL-1β, IL-10, interferon (IFN)-γ, and inducible nitric oxide synthase (iNOS) in CT, including claudin 4 (CL-4) and occludin (OCC) in jejunum by real-time (rt) PCR (CFX96 Touch Real-Time System, BioRad, CA) using SyBr green after normalizing for ribosomal protein S13 (RPS13). As explained previously, the relative fold change of target genes was determined (Shanmugasundaram et al., 2019). Primer sequences for the housekeeping gene and target genes are described in Table 2.

Table 2.

Primer sequences of the housekeeping gene, cytokines, and tight junction proteins for real-time PCR.

Gene name	Primer sequence (5′-3′)	Ta	References
RPS-13	F: CAAGAAGGCTGTTGCTGTICG	55.50°C	(Hutsko et al., 2016)
	R: GGCAGAAGCTGTCGATGATT
IL-1β	F: TCCTCCAGCCAGAAAGIGA	57.00°C	(Shanmugasundaram et al., 2013)
	R: CAGGCGGTAGAAGATGAAGC
IL-10	F: GAGGAGCAAAGCCATCAAGC	57.50°C	(Shanmugasundaram et al., 2013)
	R: CTCCTCATCAGCAGGTACTCC
IFN-γ	F: GTGAAGAAGGTGAAAGATATCATGGA	57.00°C	(Shanmugasundaram et al., 2013)
	R: GCTTTGCGCTGGATTCICA
iNOS	F: AGTGGTATGCTCTGCCTGCT	60.00°C	(Selvaraj and Klasing, 2006)
	R: CCAGTCCCATTCTTCTTCC
CL-4	F: ATGGCGTCTATGGGACTACA	57.00°C	(Acharya et al., 2004)
	R: TTACACATAGTTGCTGGCGG
OCC	F: GCCTTTTGCTTCATCGCTTCC	57.00°C	(Balbuena et al., 2011)
	R: AACAATGATTAAAGCAAAAG

Primer sequence: F = forward; R = reverse | T_a = Annealing temperature.

Statistical Analysis

Statistical analysis for all the parameters was performed using the software Jmp Pro 16 (JMP Statistical Discovery LLC, NC). The analysis for production performance, intestinal permeability, flow cytometry, ELISA, nitric oxide assay, a cecal load of C. perfringens, and rt-PCR was performed using 2-way factorial ANOVA to determine the interaction well as the main effect of both the factors as, that is, NE challenge and synbiotic. The analysis for lesion score was performed using the nonparametric Kruskal–Wallis test. Pen was considered as an experimental unit. The significance level was set to P ≤ 0.05, and the mean was separated using a Student t test.

RESULTS

Effect of Synbiotic Supplementation on Production Parameters

There was no difference in BW gain, feed intake, and FCR on D14 of age in all the treatment groups (Table 3). There was no interaction effect of challenge and synbiotic on BW gain at D21. There were significant main effects of both challenge (P < 0.001) and synbiotic (P = 0.01) on BW gain at D21 and a significant main effect of challenge on BW gain at D28 (P < 0.001) and D35 (P < 0.001). At D35 of age, birds in the challenge group had a 200 g decrease in BW gain, whereas the birds in challenge + synbiotic group had 190 g decrease in BW gain, when compared to the birds in the control group.

Table 3.

Effect of synbiotic supplementation on production parameters.

Parameter	Control		Synbiotic		SEM	P Value
	Control	Challenge	Synbiotic	Challenge		Challenge × Synbiotic	Challenge	Synbiotic
Before challenge (0–14 d)
BW gain (kg)	0.36	0.35	0.34	0.33	0.01	0.96	0.39	0.06
Feed intake (kg)	0.67	0.65	0.62	0.65	0.01	0.16	0.87	0.07
FCR	1.86	1.86	1.83	1.95	0.07	0.39	0.43	0.74
After challenge (14–35 d)
BW gain (kg)
0–21 d	0.81	0.73	0.76	0.68	0.02	0.97	<0.001	0.01
0–28 d	1.44	1.33	1.44	1.23	0.04	0.26	<0.001	0.30
0–35 d	2.09	1.89	2.09	1.9	0.05	0.97	<0.001	0.97
Feed intake (kg)
0–21 d	1.35	1.29	1.29	1.29	0.02	0.20	0.29	0.25
0–28 d	2.35	2.32	2.28	2.28	0.04	0.71	0.71	0.16
0–35 d	3.31	3.38	3.27	3.09	0.07	0.11	0.47	0.04
FCR
0–21 d	1.66	1.78	1.69	1.91	0.05	0.32	<0.001	0.10
0–28 d	1.64	1.77	1.58	1.85	0.07	0.30	<0.001	0.87
0–35 d	1.59	1.81	1.57	1.63	0.06	0.24	0.03	0.14

Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10³ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. On d 14, 21, 28, and 35, average body and feed weights were recorded to evaluate production parameters. Bars (± SEM) with no common superscript differ significantly (P < 0.05).

P values in bold are significantly different.

There was no interaction effect of challenge and synbiotic on feed intake at D21, D28, and D35 of age. Synbiotic had a significant main effect on feed intake (P = 0.04) at D35 of age (Table 3). The birds in the synbiotic group had a 40 g decrease in feed intake, whereas the birds in challenge + synbiotic group had a 22 g decrease in feed intake, when compared to birds in the control group.

There was no interaction effect of challenge and synbiotic on FCR at D21, D28, and D35 of age. There was a significant main effect of challenge in FCR on D21 (P < 0.001), D28 (P < 0.001), and D35 (P = 0.03) (Table 3). At D35 of age, the birds in the challenge group had a 0.22 increase in FCR, whereas the birds in challenge + synbiotic group had a 0.04 increase in FCR, when compared to birds in the control group.

Effect of Synbiotic Supplementation on Gut Permeability

There was no interaction effect of challenge and synbiotic on FITC-d concentration in the blood serum of birds at D21, D28, and D35 of age. There was a significant main effect of challenge (P < 0.001) on FITC-d concentration in the blood serum of birds on D21 (Figure 1). The bird in the challenge group has a 0.1 μg/mL of increase in serum FITC-d concentration than birds in the control group. No difference was seen in the concentration of FITC-d in blood serum on D28 in all the treatment groups. However, there was a significant main effect of challenge (P = 0.002) on FITC-d concentration in the blood serum of birds on D35. The birds in challenge group had 10 μg/mL of increase in serum FITC-d concentration than birds in the control group.

Figure 1.

Effect of synbiotic supplementation on gut permeability of broiler birds under an experimental NE challenge. Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. At d 21, 28, and 35, gut integrity was measured by FITC-d permeability. Bars (± SEM) with no common superscript differ significantly (P < 0.05). P-values for D21: Challenge × Synbiotic = 0.73, Challenge < 0.001, Synbiotic = 0.98; D28: Challenge × Synbiotic = 0.04, Challenge = 0.71, Synbiotic = 0.99; D35: Challenge × Synbiotic = 0.73, Challenge = 0.002, Synbiotic = 0.97.

Effect of Synbiotic Supplementation on CD4+:CD8+ T Cells in Cecal Tonsil

There was a significant interaction effect of challenge and synbiotic (P < 0.001) on ratio of CD4+ and CD8+ T cells in the cecal tonsil on D21 (Figure 2). The birds in the challenge group had a 0.11% decrease, whereas the birds in the challenge + synbiotic group had a 0.43% increase in the ratio of CD4+ and CD8+ T cells compared with the control group. Similarly, on D28, there was a significant main effect of synbiotic supplementation (P < 0.001) on the ratio of CD4+ and CD8+ T cells in the cecal tonsil. The birds in the synbiotic group had a 0.23% decrease in the ratio of CD4+ and CD8+ T cells when compared with the control group. No difference was seen in the ratio of CD4+ and CD8+ T cells in the cecal tonsil of birds on D35 in all the treatment groups.

Figure 2.

Effect of synbiotic supplementation on CD4+ and CD8+ T cells in the cecal tonsil of broiler birds under an experimental NE challenge. Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. Flow cytometry was performed on d 21, 28, and 35 to identify the percentage of CD4+ and CD8+ T cells in the cecal tonsil. Bars (± SEM) with no common superscript differ significantly (P < 0.05). P-values for D21: Challenge × Synbiotic < 0.001, Challenge = 0.07, Synbiotic = 0.01; D28: Challenge × Synbiotic = 0.84, Challenge = 0.1, Synbiotic < 0.001; D35: Challenge × Synbiotic = 0.20, Challenge = 0.16, Synbiotic = 0.46.

Effect of Synbiotic Supplementation on Regulatory T Cells in Cecal Tonsil

There was no interaction effect of challenge and synbiotic on the percentage of regulatory T cells in the cecal tonsil of birds at D21. There was a significant main effect of challenge (P = 0.02) on the percentage of regulatory T cells in the cecal tonsil of birds on D21 (Figure 3). The birds in the challenge group had a 0.47% increase in regulatory T cells compared to birds in the control group. Similarly, there was a significant interaction effect of challenge and synbiotic (P < 0.001) on the percentage of regulatory T cells in the cecal tonsil of birds on D28. The birds in the challenge group had a 0.06% increase, whereas the birds in the challenge + synbiotic group had a 0.19% decrease in regulatory T cells compared to the control group. No difference was seen in the percentage of regulatory T cells in the cecal tonsil of birds on D35 in all the treatment groups.

Figure 3.

Effect of synbiotic supplementation on regulatory T cells in cecal tonsil of broiler birds under an experimental NE challenge. Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. On d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. Flow cytometry was performed on d 21, 28, and 35 to identify the percentage of regulatory T cells (CD4+&CD25+) in the cecal tonsil. Bars (± SEM) with no common superscript differ significantly (P < 0.05). P-values for D21: Challenge × Synbiotic = 0.24, Challenge = 0.02, Synbiotic = 0.11; D28: Challenge × Synbiotic < 0.001, Challenge < 0.001, Synbiotic = 0.66; D35: Challenge × Synbiotic = 0.72, Challenge = 0.73, Synbiotic = 0.83.

Effect of Synbiotic Supplementation on CD4+:CD8+ T Cells in the Spleen

There was no interaction effect of challenge and synbiotic on the ratio of CD4+ and CD8+ T cells in the spleen of birds at D21, D28, and D35 of age. There was a significant main effect of synbiotic (P < 0.001) on the ratio of CD4+ and CD8+ T cells in the spleen on D21 (Figure 4). The birds in the synbiotic group had a 0.14 increase in the ratio of CD4+ and CD8+ T cells compared to the control group. No difference was seen in the percentage of the ratio of CD4+ and CD8+ T cells in the spleen of birds on D28 in all the treatment groups. Though, there was a significant main effect of challenge (P = 0.03) on the ratio of CD4+ and CD8+ T cells in the spleen at D35. The bird in the challenge group had a 0.28-point decreased ratio of CD4+ and CD8+ T cells compared to the control group.

Figure 4.

Effect of synbiotic supplementation on CD4+ and CD8+ T cells ratio in the spleen of broiler birds under an experimental NE challenge. Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. Flow cytometry was performed on d 21, 28, and 35 to identify the percentage of CD4+ and CD8+ T cells in the spleen. Bars (± SEM) with no common superscript differ significantly (P < 0.05). P-values for D21: Challenge × Synbiotic = 0.39, Challenge = 0.14, Synbiotic < 0.001; D28: Challenge × Synbiotic = 0.75, Challenge = 0.93, Synbiotic = 0.66; D35: Challenge × Synbiotic = 0.29, Challenge = 0.03, Synbiotic = 0.33.

Effect of Synbiotic Supplementation on Regulatory T Cells in the Spleen

There was no interaction effect of challenge and synbiotic on the percentage of regulatory T cells in the spleen of birds at D21, D28, and D35 of age. There was a significant (P = 0.02) main effect of challenge on the percentage of regulatory T cells in the spleen of birds on D21 (Figure 5). The birds in the challenge group had a 0.16% increase in regulatory T cells compared to birds in the control group. No significant difference was seen in the percentage of regulatory T cells in the spleen of birds on D28 in all the treatment groups. There was a significant (P = 0.04) main effect of synbiotic on the percentage of Tregs in the spleen of birds on D35. The birds in the synbiotic group had a 0.37% increase in Tregs compared to birds in the control group.

Figure 5.

Effect of synbiotic supplementation on regulatory T cells in the spleen of broiler birds under an experimental NE challenge. Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. Flow cytometry was performed on d 21, 28, and 35 to identify the percentage of regulatory T cells (CD4+&CD25+) in the spleen. Bars (± SEM) with no common superscript differ significantly (P < 0.05). P-values for D21: Challenge × Synbiotic = 0.87, Challenge = 0.02, Synbiotic = 0.56; D28: Challenge × Synbiotic = 0.51, Challenge = 0.81, Synbiotic = 0.14; D35: Challenge × Synbiotic = 0.23, Challenge = 0.8, Synbiotic = 0.04.

Effect of Synbiotic Supplementation on Nitric Oxide Production by Splenocyte Mononuclear Cells In Vitro

There was no interaction effect of challenge and synbiotic on the NO production by splenocyte MNCs of birds at D21 of age. There was a significant (P = 0.04) main effect of challenge on NO production by splenocyte MNCs on D21 (Figure 6). The birds in the challenge group had a 2.39 μM decrease in NO concentration compared to the control group. Similarly, there was a significant (P = 0.04) interaction effect of challenge and synbiotic on NO production by splenocyte MNCs on D28. The birds in the challenge group had a 3.1 μM decrease in the concentration of NO, whereas the birds in the challenge + synbiotic group had an 8.13 μM increase in the concentration of NO when compared with the control group.

Figure 6.

Effect of synbiotic supplementation on in vitro nitric oxide production by splenocyte MNCs of broiler birds under an experimental NE challenge. Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. At d 21 and 28, the splenocyte MNCs (1.5 × 10⁵ cells) were challenged in vitro with LPS (1 mg/mL) for 48 h, and then nitric oxide production was measured using the Griess assay. Bars (± SEM) with no common superscript differ significantly (P < 0.05). P-values for D21: Challenge × Synbiotic = 0.40, Challenge = 0.04, Synbiotic = 0.12; D28: Challenge × Synbiotic = 0.04, Challenge = 0.48, Synbiotic < 0.001.

Effect of Synbiotic Supplementation on C. Perfringens Load in the Cecal Content

There was no significant interaction as well as main effect of challenge or synbiotic, and no significant difference was seen in the population of C. perfringens in the ceca of birds on D21 and D28 (Figure 7).

Figure 7.

Effect of synbiotic supplementation on C. perfringens load in the ceca of broiler birds under an experimental NE challenge. Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. On d 21 and 28, cecal contents were pulled and stomached for enumeration by plating on Perfringens TSC Agar Base (Thermo Scientific Oxoid). C. perfringens enumeration data were recorded as CFU/mL of cecal content and then transformed into Log10 CFU/mL of cecal contents for data analysis. Bars (± SEM) with no common superscript differ significantly (P < 0.05). P-values for D21: Challenge × Synbiotic = 0.81, Challenge = 0.91, Synbiotic = 0.82; D28: Challenge × Synbiotic = 0.78, Challenge = 0.15, Synbiotic = 0.84.

Effect of Synbiotic Supplementation on Mid-Gut Lesion Scores

At D21 of age, there was no significant difference in rank score means in the mid-gut of birds from control and synbiotic groups, which were comparable (Table 4). However, the rank score means of challenge, and synbiotic + challenge groups were significantly higher (P < 0.001) when compared with both the control and synbiotic group. The rank score means of the synbiotic + challenge group was significantly lower (P < 0.001) than the challenge group.

Table 4.

Effect of synbiotic supplementation on mid-gut lesion scores.

Treatments	Lesion score				Rank score means	n	Chi-square P Value
	0	1	2	3
Control	18	0	0	0	21.5c	18	<0.001
Challenge	0	16	2	0	58.17a	18
Synbiotic	18	0	0	0	21.5c	18
Synbiotic + Challenge	6	12	0	0	44.83b	18

Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. On d 21, 3 birds/pens were sacrificed, and the mid-gut was inspected to determine the lesion scores. Rank score means and difference in rank score means were calculated by Wilcoxon/Kruskal–Wallis test.

Effect of Synbiotic Supplementation on Anti-Clostridium IgA Production in the Bile

There was a significant (P = 0.08) interaction effect of challenge and synbiotic on anti-C. perfringens IgA production in bile on D21 (Figure 8). The birds in the challenge group had a 26.7% increase, while the birds in the challenge + synbiotic group had a 12.12% decrease in anti-C. perfringens IgA production in bile when compared to the control group. No significant difference was seen in anti-C. perfringens IgA production in the bile of birds on D28 in all the treatment groups. In addition, the challenge had a significant (P = 0.02) main effect on anti-C. perfringens IgA production in bile on D35. The birds in the challenge group had a 41.33% decrease in anti-C. perfringens IgA production in bile when compared to the control group.

Figure 8.

Effect of synbiotic supplementation on anti C. perfringens IgA production in the bile of broiler birds under an experimental NE challenge. Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. At d 21, 28, and 35, anti-C. perfringens IgA was measured in bile by indirect ELISA. Bars (± SEM) with no common superscript differ significantly (P < 0.05). P-values for D21: Challenge × Synbiotic < 0.001, Challenge = 0.5, Synbiotic = 0.43; D28: Challenge × Synbiotic = 0.35, Challenge = 0.3, Synbiotic = 0.56; D35: Challenge × Synbiotic = 0.64, Challenge = 0.02, Synbiotic = 0.42.

Effect of Synbiotic Supplementation on Cytokine Gene Expression and Tight Junction Proteins in Cecal Tonsil and Jejunum

There was no interaction effect of challenge and synbiotic on relative expression of IL-1β, IL-10, IFN-γ, and iNOS mRNA at D21 in the CT. No significant differences were seen in the relative expression of IL-1β mRNA on D21 in all treatment groups (Figure 9). In CT, there was a significant main effect of challenge (P = 0.02) and synbiotic (P = 0.02) on the relative expression of IL-10 and IFN-γ mRNA, respectively, on D21 (Figure 9). The birds in the challenge group had 0.44-fold lower IL-10 mRNA expression, and the birds in the synbiotic group had 0.91-fold lower IFN-γ mRNA expression when compared to the control group. No significant differences were seen in the relative expression of iNOS mRNA on D21 in all treatment groups (Figure 9). Similarly, there was no significant difference in the relative expression of IL-1β, IL-10, IFN-γ, and iNOS mRNA on D28 in all the treatment groups. In addition, challenge and synbiotic had a significant interaction effect on the relative expression of IL-1β (P = 0.02) mRNA on D35. The birds in the challenge group had 1.57-fold higher IL-1β expression, whereas the birds in the challenge + synbiotic group had 0.34-fold lower IL-1β expression when compared to the control group. Also, there was a significant main effect of challenge (P = 0.04) on the relative expression of IL-10 mRNA on D35. The birds in the challenge group had 0.30-fold lower IL-10 mRNA expression when compared to the control group. Challenge and synbiotic had a significant interaction effect on the relative expression of IFN-γ (P = 0.001) mRNA on D35. The birds in the challenge group had 2.24-fold higher IFN-γ expression, whereas the birds in the challenge + synbiotic group had 0.85-fold lower IFN-γ expression when compared to the control group. No significant difference was seen in the relative expression of iNOS mRNA on D35 in all treatment groups.

Figure 9.

Effect of synbiotic supplementation on relative gene expression of cytokines in cecal tonsil of broiler birds under an experimental NE challenge. Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. At d 21, 28, and 35, relative expression of the cytokines were measured in cecal tonsil by real-time PCR. Bars (± SEM) with no common superscript differ significantly (P < 0.05). (A): Relative expression of IL-1β in the cecal tonsil. P-values for D21: Challenge × Synbiotic = 0.21, Challenge = 0.29, Synbiotic = 0.58; D28: Challenge × Synbiotic = 0.32, Challenge = 0.77, Synbiotic = 0.21; D35: Challenge × Synbiotic = 0.02, Challenge = 0.22, Synbiotic = 0.93. (B): Relative expression of IL-10 in the cecal tonsil. P-values for D21: Challenge × Synbiotic = 0.45, Challenge = 0.02, Synbiotic = 0.05; D28: Challenge × Synbiotic = 0.52, Challenge = 0.44, Synbiotic = 0.83; D35: Challenge × Synbiotic = 0.69, Challenge = 0.04, Synbiotic = 0.71. (C): Relative expression of IFN-γ in the cecal tonsil. P-values for D21: Challenge × Synbiotic = 0.07, Challenge = 0.78, Synbiotic = 0.02; D28: Challenge × Synbiotic = 0.05, Challenge = 0.21, Synbiotic = 0.66; D35: Challenge × Synbiotic = 0.001, Challenge = 0.80, Synbiotic = 0.40. (D): Relative expression of iNOS in cecal tonsil. P-values for D21: Challenge × Synbiotic = 0.53, Challenge = 0.74, Synbiotic = 0.07; D28: Challenge × Synbiotic = 0.46, Challenge = 0.57, Synbiotic = 0.28; D35: Challenge × Synbiotic = 0.17, Challenge = 0.73, Synbiotic = 0.38.

In the jejunum, there was no significant difference in the relative expression of IL-1β, IL-10, IFN-γ, and iNOS mRNA on D21 and D28 in all treatment groups (Figure 10). Similarly, there was no interaction effect of challenge and synbiotic on relative expression of IL-1β, IL-10, IFN-γ, and iNOS mRNA at D35 in the jejunum. However, there was a significant main effect of challenge on the relative expression of IL-10 (P = 0.009), IFN-γ (P = 0.03), and iNOS (P = 0.02) mRNA on D35. The birds in the challenge group had 0.06-fold lower IL-10 mRNA expression, 0.31-fold lower IFN-γ mRNA expression, and 0.48-fold lower iNOS expression when compared to the control group. In addition, there was no significant difference in the relative expression of tight junction proteins, CL-4, and OCC mRNA on D21, D28, and D35 in all the treatment groups (Figure 10).

Figure 10.

Effect of synbiotic supplementation on relative gene expression of cytokines tight junction proteins in the jejunum of broiler birds under an experimental NE challenge. Birds were challenged and fed synbiotic supplemented feed in a 2 × 2 factorial setup from d 0 to 35 of age. At d 14, birds were challenged with 1 × 10⁴ oocysts of E. maxima and challenged with 1 × 10⁸ CFU C. perfringens on d 19, 20, and 21. At d 21, 28, and 35, relative expression of the cytokines and the tight junction proteins were measured in jejunum by real-time PCR. Bars (± SEM) with no common superscript differ significantly (P < 0.05). (A): Relative expression of IL-1β in the jejunum. P-values for D21: Challenge × Synbiotic = 0.92, Challenge = 0.95, Synbiotic = 0.11; D28: Challenge × Synbiotic = 0.20, Challenge = 0.80, Synbiotic = 0.54; D35: Challenge × Synbiotic = 0.12, Challenge = 0.71, Synbiotic = 0.61. (B): Relative expression of IL-10 in the jejunum. P-values for D21: Challenge × Synbiotic = 0.09, Challenge = 0.21, Synbiotic = 0.73; D28: Challenge × Synbiotic = 0.29, Challenge = 0.30, Synbiotic = 0.54; D35: Challenge × Synbiotic = 0.15, Challenge = 0.009, Synbiotic = 0.18. (C): Relative expression of IFN-γ in the jejunum. P-values for D21 Challenge × Synbiotic = 0.31, Challenge = 0.13, Synbiotic = 0.66; D28: Challenge × Synbiotic = 0.13, Challenge = 0.58, Synbiotic = 0.68; D35: Challenge × Synbiotic = 0.74, Challenge = 0.03, Synbiotic = 0.49. (D): Relative expression of iNOS in the jejunum. P-values for D21: Challenge × Synbiotic = 0.48, Challenge = 0.14, Synbiotic = 0.35; D28: Challenge × Synbiotic = 0.05, Challenge = 0.67, Synbiotic = 0.55; D35: Challenge × Synbiotic = 0.94, Challenge = 0.02, Synbiotic = 0.41. (E): Relative expression of claudin-4 in the jejunum. P-values for D21: Challenge × Synbiotic = 0.99, Challenge = 0.97, Synbiotic = 0.09; D28: Challenge × Synbiotic = 0.18, Challenge = 0.62, Synbiotic = 0.86; D35: Challenge × Synbiotic = 0.08, Challenge = 0.60, Synbiotic = 0.74. (F): Relative expression of occludin in the jejunum. P-values for D21: Challenge × Synbiotic = 0.06, Challenge = 0.53, Synbiotic = 0.32; D28: Challenge × Synbiotic = 0.99, Challenge = 0.46, Synbiotic = 0.27; D35: Challenge × Synbiotic = 0.36, Challenge = 0.56, Synbiotic = 0.52.

DISCUSSION

Synbiotic, a combination of probiotics and prebiotics, could interact synergistically to benefit the host (Gibson and Roberfroid, 1995). Synbiotic could be a potential alternative to AGPs in controlling infectious diseases in poultry, including NE. Necrotic enteritis occurs in acute and subclinical forms, characterized by higher mortality and loss in production performance, respectively (Wu et al., 2010). In our study, the challenge model induced subclinical NE, as challenge groups had no mortality. At D14 of age (before the challenge), synbiotic did not improve the BW gain, feed intake, and FCR, and a similar result was observed by Cason et al. (2023). At D35 of age, the NE challenge significantly decreased the BW and increased the FCR compared to nonchallenged treatment groups. However, synbiotic supplementation during NE challenge helped to gain body mass by eating less feed, ultimately cutting the cost of feed. Synbiotic supplementation increases SCFA production (Śliżewska et al., 2020), which stimulates the secretion of satiety hormone (Puddu et al., 2014), and synbiotic supplementation also increases the absorption of nutrients in the intestine (Bogucka et al., 2019), ultimately reducing the demand of feed intake.

Intestinal permeability measures a leaky gut, and FITC-d is the indicator for paracellular permeability of the intestine in poultry research (Liu et al., 2021). In our study, the poor production performance during the challenge was manifested in increased intestinal permeability at D21, and a similar result was observed by Akerele et al. (2022). Synbiotic supplementation did not recover the birds from intestinal permeability at D21. However, at D21, synbiotic supplementation significantly reduced the mid-gut lesion score in challenged birds. A previous study found that synbiotic supplementation reduced lesion score in the intestine (Prentza et al., 2022) as the probiotic component increases the colonization of Lactobacillus and Bifidobacterium in the intestine (Yang et al., 2012) that reduce inflammation and increase mucus production (de los Santos et al., 2007), strengthening the gut barrier. Thus, a leaky gut reduces birds’ production performance during the challenge (Stewart et al., 2017).

IgA is an antibody generated by B-cells and primarily associated with mucosal immunity. Its main function is safeguarding the intestinal epithelium from being invaded by harmful bacteria (Macpherson et al., 2008; Ohland and MacNaughton, 2010). Synbiotic influences the selective stimulation of beneficial bacteria, which outcompetes pathogenic bacteria like C. perfringens (Wu et al., 2018) and reduces inflammation, leading to decreased IgA production. Also, synbiotic strengthen gut integrity, preventing the translocation of pathogen-associated molecular patterns (PAMPs) into the cell to prevent immune response (Zhang et al., 2010b), which might reduce the IgA in the mucosal surface or bile.

Nitric oxide is an essential functional molecule that plays a crucial role in the defense mechanisms of host cells. It triggers the pro-inflammatory response against intracellular pathogens, facilitates neurotransmission, and recruits immune cells (Snyder and Bredt, 1992). Nitric oxide production is facilitated by an enzyme called iNOS, which helps protect against inflammatory challenges (Xue et al., 2018). In chickens, nitric oxide is predominantly released by macrophages and monocytes and is stimulated by intracellular pathogens, certain tumors, LPS, and IFN-γ (Stüve et al., 2006). In our study, at D21 of age, the NE challenge significantly decreased NO production in splenocyte MNCs. C. perfringens produces toxins, including TpeL, that can interfere with the Ras pathway (Abreu-Blanco et al., 2020). This downregulation in NO production might be due to the inactivation of the Ras pathway and Ras–Raf interaction by the TpeL toxin of C. perfringens (Guttenberg et al., 2012). Blockage of these pathways alters the nuclear factor kappa B (NFkB) pathway downregulating the expression of the associated cytokines (Mayo et al., 2001).

The CD4+:CD8+ T cell is often used to measure immune competence in several species, including chickens (Char et al., 1990). Research has shown that a CD4+:CD8+ T cell ratio greater than 1, indicating a higher percentage of CD4+ T cells relative to CD8+ T cells, is typically observed in healthy individuals. However, numerous studies reported that the CD4+:CD8+ T cell in chickens could be affected by various factors such as age, breed, diet, and diseases (Leshchinsky and Klasing, 2003; Bridle et al., 2006; Dalgaard et al., 2010). At D21 of age, synbiotic supplementation significantly increases the CD4+ and CD8+ T cells ratio in CT of challenged birds. Previous studies reported similar results (Hussain et al., 2019), as prebiotics, probiotics, and C. perfringens elicit the immune response during early infection. The activated immune response boosts T cells’ activity at the infection site by producing inflammatory cytokines. Tregs are a specialized subset of mature T cells critical in suppressing the immune system during infection and promoting immune tolerance (He et al., 2021; Piccioni et al., 2014). During infection, the percentage of Tregs is anticipated to be notably lower during the peak of illness (Ferreira et al., 2017). In our study, the NE challenge significantly reduced the percentage of Tregs in CT at D21. The increased ratio of CD4+ and CD8+ T cells and decreased percentage of Tregs were manifested in decreased IL-10 mRNA expression in CT, which was significantly lower at D21. As IL-10 and Tregs are associated with immunosuppression (Chen et al., 2003), during early infection, host might reduce the expression of IL-10 and eventually Tregs to promote a more effective immune response against NE infection.

At D21, synbiotic supplementation significantly increased the CD4+ and CD8+ T cells ratio in the spleen. This result was similar to (Wang et al., 2018; Hussain et al., 2019) since synbiotic increases the SCFA (Śliżewska et al., 2020), which enter the blood and reaches the spleen to activate and differentiate T cells (Yao et al., 2022). NE challenge significantly increased the percentage of Tregs in the spleen at D21. The reason behind this might be tolerance to infection, as DAMP from inflammation activates the dendritic cells (DC), which enter the spleen and upregulates the production of Tregs to prevent tissue damage from excessive inflammation (Zhao et al., 2016). At D21, synbiotic supplementation significantly decreased the expression of IFN-γ in CT when compared to the control group. A similar result was found in previous studies (Dunislawska et al., 2017; Shanmugasundaram et al., 2019), and decreased IFN-γ reduces the inflammation to induce tolerance against infection (Sławinska et al., 2014).

At D28 of age, synbiotic supplementation significantly decreased the CD4+ and CD8+ T cells ratio in CT. Similarly, synbiotic supplementation also decreased the percentage of Tregs in CT of challenged birds. These results were aligned with the result of gut permeability at D28 when there was comparable gut permeability in all treatment groups. During late infection, normal gut permeability indicates a healthy intestinal lining with minimal inflammation, further indicating decreased CD4+:CD8+ cells. Similarly, decreased Tregs in CT indicate that the body is trying to eliminate the infection through homeostasis. Also, synbiotic supplementation increased NO production by splenocyte MNCs in challenged birds. A similar result was found in the case of serum NO by (Li et al., 2010). Splenocyte MNCs produce NO when activated by PAMP, particularly CpG oligodeoxynucleotides (He et al., 2009). Nitric oxide kills the bacteria, fungi, parasites, and tumor cells through the potent oxidant peroxynitrite, followed by radical–radical reaction with superoxide (Lillehoj and Li, 2004). So, in this study, increased NO indicates the elimination of infection.

At D35 of age, the NE challenge significantly decreased the concentration of IgA in bile, decreased the ratio of CD4+ and CD8+ T cells in the spleen, decreased expression of inflammatory and anti-inflammatory cytokines such as IL-10, IFN-γ, and iNOS in the jejunum and decreased the expression of IL-10 in CT. The decrease in IgA due to challenges during late infection was documented in numerous studies (Wang et al., 2017; Ramadan et al., 2020; Zhao et al., 2022). Also, synbiotic supplementation increased the percentage of Tregs in the spleen and decreased the expression of IL-1β and IFN-γ mRNA in the challenged bird. All these lower expressions of inflammatory and anti-inflammatory cytokines reveal the elimination of infection, and the birds were fully recovered till D35.

This study concludes that synbiotic supplementation improves production performance, reduces lesion score, and elicits a beneficial humoral and cell-mediated immune response against NE challenge. The information from this study will be useful to understand the immune response elicited by the NE challenge, synbiotic as well as interaction of challenge and synbiotic. The results from this study will also help to improve to efficacy of synbiotic in further research.