Abstract
Cerebral infarction (CI) is characterised by high morbidity, mortality, and disability rates. Recently, Chinese medicine has been widely used and has gained satisfactory results in the treatment of CI. Our previous study showed that gastrodin could facilitate the recovery of neurological function in middle cerebral artery occlusion (MCAO) rats. This study explores this mechanism. SD rats were separated into control, sham, model, and gastrodin groups. After MCAO surgery, the gastrodin group was administered gastrodin (100 mg/kg), and after 1/3/7 days, the ischaemic hemisphere and serum was collected, and then we extracted the circulating exosomes from the serum. We then tested the levels of XIAP (x-linked inhibitor of apoptosis protein), IAP binding proteins (SMAC, HtrA2, ARTs), and miR-20a-5p (a gastrodin potential effect target) in the brain tissues, circulating exosomes, and serum using various methods. Our results showed that circulating exosomes can penetrate the blood-brain barrier (BBB) and that gastrodin can upregulate the amount of miR-20a-5p in circulating exosomes. The circulating exosomes penetrate the BBB and upregulate the expression of XIAP in the ischaemic hemisphere. Gastrodin can also decrease the amount of IAP binding proteins (SMAC, HtrA2, ARTs). Gastrodin can increase the amount of miR-20a-5p in circulating exosomes, which penetrates the BBB and upregulates XIAP expression in the ischaemic hemisphere. By inhibiting apoptosis of neurones, it can facilitate the recovery of neurological function in MCAO rats.
Keywords: Blood-brain barrier, cerebral infarction, exosome, gastrodin
Introduction
Cerebral infarction is characterized by high morbidity, mortality, and disability rates, and is the leading cause of death and disability among adults in China, with ischaemic stroke accounting for 84% of stroke cases [1]. Symptoms of acute cerebral infarction include unsmooth speech, numbness of limb, hemiplegic parelysis, dizziness, etc. And easy to exacerbate and change during acute phase. In the view of traditional Chinese Medicine, cerebral infarction is classified as wind syndrome due to its characteristics of being easy to swing, sudden and change fast, and wind extinguishing method is an important treatment in the acute stage of cerebral infarction. Gastrodia elata is a famous herbal medicine, and it is primarily used for ‘calming the liver and extinguishing wind’. Gastrodin is organic compounds extracted from dried root of Gastrodia elata. It is a phenolic glycoside and the main bioactive constituent of Gastrodia elata. Gastrodin is widely used in neurological disease [2].
Modern medicine has developed integrated treatment methods for stroke, however, their effects are unsatisfactory [3,4]. According to the China National Stroke Database, 70% of patients with cerebral infarction are treated with traditional Chinese medicine (TCM), and TCM is widely used in clinical practice [5]. Multiple methods of TCM, like TCM decoction, and acupuncture, show encouraging clinical effect in treating stroke through various pathways and mechanisms [6–9]. However, the clinical promotion of TCM is limited by the lack of a clear understanding of its mechanisms. Therefore, it is of great significance to explore the mechanisms of TCMs and provide solid experimental evidence of these mechanisms [10].
Modern study reveals pathology of cerebral infarction mainly include neuron apoptosis and inflammation [11,12]. Neuronal apoptosis is the key reason that causes neurological damage in acute cerebral infarction, also inhibiting neuronal apoptosis is the key target of the Extinguishing wind method.
‘Extinguishing wind’ in the early stage of stroke is crucial for the recovery of neurological function [13]. Based on our previous study, gastrodin can boost the recovery of neurological function in middle cerebral artery occlusion (MCAO) rats, and the mechanism is related to the inhibition of neuronal apoptosis [14]. However, gastrodin penetrates the blood-brain barrier (BBB) with difficulty. Thus, the mechanism of inhibition of neuronal apoptosis is unclear.
Recently, exosomes have gained worldwide attention owing to their ability to freely traverse the BBB and mediate intercellular communication [15]. Numerous study demonstrated exosome played crucial role in pathology and treatment of ischaemic stroke [16,17]. Therefore, we hypothesised that gastrodin regulates neuronal apoptosis after cerebral infarction through the exosome pathway. After careful literature research, miR-20a-5p was screened as effect target, which can regulate XIAP downstream [18,19]. XIAP is considered as an important role in regulating apoptosis after stroke, it can inhibit endogenous or exogenous apoptosis in multiple ways [20].
So our working hypothesis was that gastrodin facilitated recovery of neurological function in MCAO rats by regulating the miR-20a-5p/XIAP pathway via exosomes, exosome can penetrate BBB and take effect. Accordingly, we conducted experiments to verify our hypothesis.
Materials and methods
Reagents
Gastrodin (GAS) was purchased from Shanghai Tongtian Pharmaceutical Corporation. GAS was dissolved in saline and administered intraperitoneally once daily at a dose of 100 mg/kg. After MCAO, GAS was immediately administered intraperitoneally. Anti-XIAP antibody was purchased from Abcam Corporation (USA), Cat. No. ab229050. Anti-SMAC antibody was purchased from Abcam Corporation, Cat. No. ab32023. Anti HtrA2 antibody was purchased from Abcam Corporation, Cat. No. ab75982. Anti-ARTs antibody was purchased from Abcam Corporation, Cat. No. ab124669. Secondary antibody was purchased from MDL corporation, Cat. No. MD912577. XIAP Elisa kit was purchased from Jingmei Biotechnology corporation, Cat. No. JM-11100R.
Animals
SPF male Sprague–Dawley rats (body weight, 250–300 g) were purchased from Vital River Laboratory Animal Technology Co. Ltd., Beijing, China. The animals were kept under a 12 h/12 h light/dark cycle with controlled temperature and humidity levels and provided food and water ad libitum. All animal procedures were performed according to the China Animal Welfare Legislation and approved by the Capital Medical University Committee on the Care and Use of Laboratory Animals.
Induction of transient focal cerebral ischaemia
The MCAO model is a common animal model for brain research [21]. By blocking middle cerebral artery, it can simulate real stroke. Then we can study molecule mechanism after ischaemic stroke and search for potential therapeutic measures.
Focal cerebral ischaemia was induced by MCAO with an intraluminal filament, as described previously [5]. Briefly, rats were anaesthetised by administering 2% isoflurane with 2 L/min oxygen through a face mask. A six-0 monofilament nylon suture with a rounded tip (Beijing, Shandong) was inserted through a small incision on the right common carotid artery and forwarded into the internal carotid artery until a small resistance was felt. The filament was fixed using a silk suture knot on the common carotid artery. The rats in the sham group did not receive MCAO; they were anaesthetised with 2% isoflurane and had their carotid arteries exposed.
Extraction of exosomes
Rat serum samples were collected in serum tubes, and exosomes were separated by differential over-speed centrifugation. Low-speed (300g) centrifugation was applied for 10 min to remove the cells, and the supernatant was collected and subjected to 2000g centrifugation for 10 min to remove the dead cells. Then, the supernatant was subjected to 10 000g centrifugation for 30 min to remove the cell debris. Next, the supernatant was collected for the following procedure. Ultra-centrifugation (100 000g) was performed for 60 min, and the crude exosome precipitation was obtained. The precipitate was resuspended in PBS and centrifuged again (100 000g, 60 min), and the pure exosome precipitation was obtained and stored at −80 °C for further experiments.
Exosome tracer-labelling technology
A sutiable amount of extracted exosome was prepared to measure the concentration. Then 1 μM staining working solution was added to exosome solution and subjected to nano-flow detection. Uncombined dyestuff and impurities were removed by resuspending the exosome solution in sterile PBS 3 times. The sediment was resuspend by 100 μl PBS and subjected to nano-flow detection again. Fluorescence efficiency was detected. After that, DiR-labelled exosome was injected into SD rat by tail vein injection. Then SD rat was sacrificed to make brain slices. After that, we observed the distribution of exosome and took photos by confocal fluorescence microscope for further analysis.
Neurological deficit evaluation
Neurological deficits were monitored after MCAO surgery and at 1, 3, 5, and 7 days after MCAO. Rats with Bederson score higher than 5 were included in Model or GAS group. The Bederson method was applied to monitor neurological deficits every other day following the MCAO surgery. This method involves measuring four aspects:
Performance of the left forelimb (scored from 1–4). 1: Adduction non-adjacent to the skin; 2: adduction adjacent to the skin; 3: adduction adjacent to the skin with an upward curl; 4: whole body turns round to the left.
Muscular tension of both forelimbs (0–2). 0: Both forelimbs can grasp, myodynamia is normal; 1: left forelimb is weak, still can grasp; 2: left forelimb cannot grasp.
Resistance when pushing while on a smooth surface (0–2). 0: No difference in resistance when pushing the right or left side; 1: less resistance when pushing the left side; 2: can be pushed over when pushing the left side.
Right upper eyelid excretion. 0: normal; 2: right blepharoptosis; the right eye has more excretion.
Western blot analysis
Western blot analysis was performed as described previously [22]. Equal amounts of protein were loaded for immunoblotting. SDS-PAGE was performed to separate different protein sizes. After electrophoresis, proteins were transferred to nitrocellulose membranes using a wet transfer system (Bio-Rad). The membrane was blocked with 5% non-fat milk (Bio-Rad) for 1 h at room temperature. This was followed by incubation with the primary antibody at 4 °C overnight. After washing the membranes with TBST, the membranes were incubated with a secondary antibody (1:3000) at room temperature for 1 h. The membranes were washed 3 times with TBST. Finally, protein signals were detected using an ECL kit (Bio-Rad) and a UVP GelDoc image system (UVP). Images were analysed using ImageJ software (NIH, Bethesda, Maryland , USA).
Total RNA extraction and qPCR
Total RNA was isolated from brain tissue and exosome using the TRIzol Reagent (GibcoBRL, Grand Island, New York, USA) according to the manufacturer’s instructions. Then, 200 ng of total RNA was reverse-transcribed in a 10-μl reaction using a reverse-transcription system. Amplification and detection were performed under the following conditions: an initial hold at 95 °C for 10 s, followed by 40 cycles at 95 °C for 30 s, 62 °C for 30 s, and 72 °C for 1 min. PCR products subjected to 1.2% agarose gel electrophoresis were visualised by EB staining under UV illumination. The gel was scanned, and the band intensity was measured using densitometry. U6 was used as an internal control. Primer sequence list as follows: U6-F CGATACAGAGAAGATTAGCATGG, U6-R ATATGGAACGCTTCACGAA; XIAP-F AAATGATTGGGCAGAT, XIAP-R CCAGGGTTTGACACG; miR-20a-5p-FTAAAGTGCTTATAGTGCAG, miR-20a-5p-RCAGTGCAGGGTCCGAGGTA.
Histology and immunohistochemistry
The brain slices were fixed in 4% paraformaldehyde (PFA) overnight and then cryoprotected in 30% sucrose solution for 3 days. After antigen retrieval in sodium citrate buffer, the sections were incubated with anti-rat XIAP antibody (Abcam Corporation) overnight at 4 °C or at 37 °C. Sections were then incubated with biotinylated secondary antibody (1:200, Solarbio, China) at 37 °C for 30 min, followed by 3 times PBS rinse. Then, fresh diaminobenzidine (DAB) was added for coloration for 1–2 min to visualize the antibody-antigen complexes. Images were acquired by a Leica DM3000 microscope (Leica, Germany). At least 3 representative images were selected for analysing, then we measured IOD by ImageJ.
ELISA
Serum of rats in each group were collected respectively and centrifuged at 10 000 rpm for 20 min at 4 °C (Sigma refrigerated centrifuge, 3–30 K), after which the levels of XIAP were measured by ELISA kits. All the procedures were performed according to the manufacturer’s instructions.
Statistical analysis
All experiments were conducted 3 times at least. Data are presented as mean ± SEM. Comparisons between different groups were analyzed using SPSS 17.0 software via ANOVA. P < 0.05 was considered statistically significant.
Results
Gastrodin can facilitate recovery of neurological function in MCAO rats
In order to detect the effect of gastrodin in MCAO rats, we adopted Bederson’s score to evaluate neurological deficits after surgery. High Bederson’s score represents severe neurological damage. As the result showed (Fig. 1), neurological score in both model group and GAS group decreased gradually in a week. There was no significant difference between model group and gastrodin group within 1day. However, after 3 days, Bederson’s score of gastrodin group was significantly lower than model group. Indicating gastrodin can facilitate recovery of neurological function in MCAO rats. Sham group had no neurological damage, so Bederson’s score was 0.
Fig. 1.
Bederson’s score in gastrodin group is lower than in model group after MCAO surgery. The data are expressed as mean ± SEM (n = 6 per group). *P < 0.05 compared to model group. Model refers to model group, GAS refers to gastrodin group.
Permeability of the circulating exosome
To investigate role of exosome after stroke, we used exosome tracer-labelling technology to observe the distribution of circulating exosomes. After extracting exosomes from the serum, we labelled it with a pre-prepared fluorescence label; then, caudal intravenous injection was performed, sending back fluorescence labelling exosomes. After 24 h, we prepared brain sections from SD rats and observed them using a fluorescence microscope. Many fluorescence-labelled exosomes were observed in the brain sections (Fig. 2), indicating that circulating exosomes can penetrate the BBB.
Fig. 2.
Fluorescence labelling exosome in brain tissue of SD rats. Green fluorescence indicates exosome (red arrow), blue fluorescence indicates nucleus (white arrow). Red bar represents 200 μm, white bar represents 50 μm.
Gastrodin can increase the amount of miR-20a-5p in both the ischaemic hemisphere and circulating exosomes of MCAO rats
The qPCR data showed that the amount of miR-20a-5p in the ischaemic hemisphere decreased sharply 1 d after MCAO surgery, followed by a gradual increase. Gastrodin treatment accelerated this trend (Fig. 3a), the amount of miR-20a-5p in Gas group was significantly higher than that in model group. In addition, we extracted exosomes from serum and then measured the amount of miR-20a-5p present, with similar results observed (Fig. 3b).
Fig. 3.
The amount of miR-20a-5p is higher in gastrodin group than in model group in both the serum and exosomes. (a) Amount of miR-20a-5p in brain increased after GAS treatment. (b) Amount of miR-20a-5p in circulating exosome increased after GAS treatment. The data are expressed as mean ± SEM (n = 3 per group). **P < 0.01 compared to model group. Model refers to model group, GAS refers to gastrodin group, Sham refers to sham group, Control refers to control group.
Gastrodin can increase the amount of XIAP in the ischaemic hemispheres of MCAO rats
To investigate the amount of XIAP in the ischaemic hemispheres of MCAO rats, we performed western blotting, which showed that levels of XIAP were significantly increased 1 d after MCAO surgery and remained stable after 3 days. The level of XIAP in the gastrodin group was higher than that in the model group 1 and 7 days after MCAO surgery (Fig. 4a). The qPCR results showed the same tendency; the mRNA level of XIAP in the gastrodin group was higher than that in the model group at three time points (Fig. 4b). At the same time, we also detected the concentration of XIAP using ELISA on the serum extracted from the different groups. The results showed that the concentration of XIAP in serum increased sharply 1 d after MCAO surgery and then remained stable for 1 week. In addition, XIAP concentration in the gastrodin group (1/3/7 d) was higher than that in the model group (Fig. 4c).
Fig. 4.
XIAP levels is higher in gastrodin group than in model group in ischaemic hemispheres and serum. (a) Western blot showing that gastrodin can increase XIAP levels in ischaemic hemispheres 1 and 7 days after MCAO surgery. (b) qPCR results showing that gastrodin can increase XIAP mRNA levels in ischaemic hemispheres. (c) ELISA results showing that gastrodin can increase XIAP levels in serum after stroke. Data are expressed as the mean ± SEM (n = 3 per group). *P < 0.05, **P < 0.01 compared to model group.
We also performed immunohistochemistry to detect the expression levels of XIAP in the brain. The results showed that XIAP in the gastrodin group was higher than that in the model group after MCAO surgery (Fig. 5a and b).
Fig. 5.
Immunohistochemistry results of XIAP levels in ischaemic hemispheres of MCAO rats. (a) Representative photomicrograph of brain slices in each group. Positive staining is blue spots. Bar represents 200 μm. (b) Quantitative image analysis was performed based on integrated optical density (IOD) of positive immunostaining of XIAP. Data are expressed as the mean ± SEM (n = 3 per group). *P < 0.05 compared to model group.
Gastrodin can decrease levels of IAP binding proteins in ischaemic hemispheres of MCAO rats
To investigate the amount of IAP binding proteins in the brain tissue of MCAO rats, we performed western blotting 1/3/7 days after MCAO surgery. The results revealed that SMAC levels increased sharply 1 d after MCAO surgery. It then demonstrated a gradual downward trend throughout 1 week. In addition, SMAC levels in the gastrodin group were lower than in the model group after MCAO surgery. At 7 days, these two groups showed significant differences (Fig. 6a).
Fig. 6.
Levels of IAP binding proteins in ischaemic hemispheres is lower in gastrodin group than in model group. (a) Amount of SMAC decreased after GAS treatment in brain. (b) Amount of HtrA2 decreased after GAS treatment in brain. (c) Amount of ARTs decreased after GAS treatment in brain. Data are expressed as the mean ± SEM (n = 3 per group). *P < 0.05 compared to model group.
The mitochondrial serine-protease regulating factor HtrA2 and pro-apoptotic ARTs protein showed the same trend. HtrA2 levels in the gastrodin group were significantly lower than those in the model group at 1/3/7 days (Fig. 6b), and the ARTs level of the gastrodin group was significantly lower than that of the model group at 7 days (Fig. 6c).
Discussion
According to traditional Chinese medicine, cerebral infarction is a complex pathological process, the main pathogenesis of which is wind, fire, phlegm, qi, deficiency, and blood stasis. It causes imbalance of Yin and Yang as well as disorder of qi and blood in the body, which leads to damage to the brain. Among these pathogenic factors, wind is a guide to the brain. A preliminary syndrome survey indicated that wind syndrome accounted for 89.8% of all patients within 72 h after the onset of cerebral infarction and was closely related to neurological function deficits [23]. Thus, ‘wind syndrome’ is the initial factor of cerebral infarction and it is a key factor affecting prognosis.
Gastrodia elata is the primary TCM used to calm the liver and extinguish wind, and gastrodin is its most effective monomer. A meta-analysis of 12 randomized controlled trials of gastrodin treatment for cerebral infarction showed that gastrodin combined with conventional Western medicine can effectively reduce a patient’s degree of neurological impairment [24]. In terms of fundamental research, Li et al. proved that gastrodin can inhibit the activation of microglial cells and reduce BBB damage [25]. Qiu et al. found that gastrotin promotes nerve regeneration through the Wnt/β-catenin pathway [26]. Gastrodin also exerts anti-inflammatory and anti-oxygenation effects through multiple pathways in vitro and in vivo [27,28]. Sui et al. demonstrated that gastrodin can resist inflammation via the STAT3 and NF-κB pathways [29]. Liu et al. found that gastrodin inhibits neuronal apoptosis and inflammation in MCAO rats [30]. Our previous study showed that gastrodin could improve the neurological function of MCAO rats, decrease protein and mRNA levels of Bax, increase protein and mRNA levels of Bcl-2, and decrease the transcription level of caspase-3 mRNA, indicating that the mechanism by which gastrodin improves neurological function is related to the inhibition of neuronal apoptosis [5].
Gastrodin presents poor BBB permeability and is rapidly metabolised. The current study cannot fully explain its efficacy in the central nervous system. Pharmacological studies have shown that gastrodin is a water-soluble drug, and it is difficult to permeate the BBB via intravenous injection or oral administration. Its BBB permeation index is −2.29 (less than −0.3 is considered unable to permeate the BBB). After administration, the amount of gastrodin in the brain is very small, and it is rapidly degraded and metabolised [31]. In the past, it was thought that gastrodin may act by degrading into gastrodin aglycones, which can pass through the BBB more easily; however, this hypothesis has since been overturned and gastrodin has been determined to act alone [32]. It is still not clear how gastrodin penetrates the BBB and inhibits neuronal apoptosis. Recently, exosomes have been shown to penetrate the BBB and mediate intercellular communication [33]; therefore, we performed an in-depth study on it.
Exosomes are a type of extracellular vesicle with a diameter of approximately 30–100 nm. It is widely distributed in various body fluids, and almost all types of cells can secrete exosomes. The vesicle contains endogenous lipids, proteins, RNA, and many cell surface markers [34]. Exosomes can transport various substances, such as RNA and proteins, and can affect pathological processes by mediating miRNA and protein. Exosomes can also sort various biomolecules carried by them, strictly regulate the transmission of information molecules, and thus have targeted regulatory effects on cells [35]. Exosomes play a crucial role in the diagnosis and treatment of cerebral infarction due to their characteristics [6].
The large amounts of miRNAs in exosomes extensively participate in oxidative stress after cerebral ischaemia, apoptosis, metabolic disorders, and immune inflammatory damage, and also play a role in endothelial cell regeneration after ischaemia, vascular remodelling, neuronal regeneration, and synaptic plasticity [36]. Among these miRNAs, miR-20a-5p plays a key role in regulating cell apoptosis [37], and is probably a new target of apoptosis. Our research demonstrated that gastrodin can upregulate the content of miR-20a-5p in the circulating exosome and ischaemic hemisphere. According to the analysis by a target gene prediction and analysis software, Targetscan 7.2, XIAP is likely the target gene of miR-20a-5p. In addition, XIAP is the core of the mitochondrial pathway and plays an important role in regulating apoptosis.
Neuronal apoptosis is mainly carried out through the mitochondria-dependent pathway, and the IAP family is an important part of the mitochondrial pathway [38]. XIAP is the most powerful protein in the IAP family and can inhibit endogenous or exogenous apoptosis in multiple ways [39]. XIAP functions by inhibiting downstream IAP binding proteins, such as SMAC, HtrA2, and ARTs.
SMAC is a pro-apoptotic protein mainly located in the mitochondria and its role involves blocking the activation of caspase-9 and caspase-3. HtrA2 is an apoptosis promoter of mitochondrial serine protease, which can promote cell apoptosis by inhibiting IAPs and activating cysteine aspartic acid protease and serine protease. ARTs is a pro-apoptotic protein located in mitochondria that can directly bind to XIAP and recombine into ARTs-XIAP immunoprecipitate proteins to play a pro-apoptotic role. Our study demonstrated that gastrodin can increase the XIAP content in the ischaemic hemispheres of MCAO rats, inhibit the amount of IAP binding protein downstream, rescue neurones, and facilitate recovery of neurological function.
In this study, we found for the first time that gastrodin may play a role in promoting neurological recovery after cerebral infarction by regulating miRNA in exosomes. The results showed that gastrodin could significantly upregulate the content of miR-20a-5p in serum exosomes in the acute stage of cerebral infarction. Exosomes penetrate the BBB into the ischaemic hemisphere and then rapidly upregulate XIAP. As a result, it can inhibit neuronal apoptosis in the penumbra and facilitate the recovery of neurones. However, the mechanism by which miR-20a-5p targets XIAP and how they interact with each other needs verification. In our study, bioinformatics analysis showed XIAP was target gene of miR-20a-5p, further experiments such as high-throughput sequencing, relevant experiment of inhibitors and activators will be done in further study.
Acknowledgements
This study was supported by grants from the National Natural Science Foundation of China (No. 82104578) awarded to S. Wang.
Conflicts of interest
There are no conflicts of interest.
Footnotes
Bin Zhu is equally contributed to this article.
References
- 1.Wu S, Wu B, Liu M, Chen Z, Wang W, Anderson CS, et al.; China Stroke Study Collaboration. Stroke in China: advances and challenges in eptdemiology, prevention, and management. Lancet Neurol 2019; 18:394–405. [DOI] [PubMed] [Google Scholar]
- 2.Liu Y, Gao J, Peng M, Meng H, Ma H, Cai P, et al. A review on central nervous system effects of gastrodin. Front Pharmacol 2018; 9:24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Campbell BCV, De Silva DA, Macleod MR, Coutts SB, Schwamm LH, Davis SM, et al. Ischaemic stroke. Nat Rev Dis Primers 2019; 5:70. [DOI] [PubMed] [Google Scholar]
- 4.Kumar S, Selim MH, Caplan LR. Medical complications after stroke. Lancet Neurol 2010; 9:105–118. [DOI] [PubMed] [Google Scholar]
- 5.Liu T, Ding Y, Wen A. Traditional Chinese medicine for ischaemic stroke. Lancet Neurol 2018; 17:745. [DOI] [PubMed] [Google Scholar]
- 6.Zhu T, Wang L, Feng Y, Sun G, Sun X. Classical active ingredients and extracts of chinese herbal medicines: pharmacokinetics, pharmacodynamics, and molecular mechanisms for ischemic stroke. Oxid Med Cell Longev 2021; 2021:8868941. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Li XH, Yin FT, Zhou XH, Zhang AH, Sun H, Yan GL, et al. The signaling pathways and targets of natural compounds from traditional Chinese Medicine in treating ischemic stroke. Molecules 2022; 27:3099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Wang RQ, Huang CH, Wu QZ. Network meta-analysis on different acupuncture therapies for post-stroke spastic hemiplegia. World J Acupunct Moxibustion 2022; 32:78–84. [Google Scholar]
- 9.Cao X, Pu XL, Ma WJ, Xu G, Zhang WH. Kāiqiàotōngluò acupuncture combined with repetitive transcranial magnetic stimulation for the treatment of hand dysfunction after stroke. World J Acupunct Moxibustion 2022; 32:137–141. [Google Scholar]
- 10.Bu L, Dai O, Zhou F, Liu F, Chen JF, Peng C, et al. Traditional Chinese medicine formulas, extracts, and compounds promote angiogenesis. Biomed Pharmacother 2020; 132:110855. [DOI] [PubMed] [Google Scholar]
- 11.Campbell BCV, Khatri P. Stroke. Lancet 2020; 396:129–142. [DOI] [PubMed] [Google Scholar]
- 12.Tuo QZ, Zhang ST, Lei P. Mechanisms of neuronal cell death in ischemic stroke and their therapeutic implications. Med Res Rev 2022; 42:259–305. [DOI] [PubMed] [Google Scholar]
- 13.Wang SQ, Fan YP. Brief discussion on the application of wind extinguishing method in the acute stage of ischemic stroke. Chin J Integr Tradit West Med Cardio Cerebrovasc Dis 2017; 15:1845–1847. [Google Scholar]
- 14.Wang S, Nan Y, Zhu W, Yang T, Tong Y, Fan Y. Gastrodin improves neurological score in MCAO rat by inhibiting inflammation and apoptosis, promoting revascularization. Int J Clin Exp Pathol 2018; 11:5343–5350. [PMC free article] [PubMed] [Google Scholar]
- 15.Azarmi M, Maleki H, Nikkam N, Malekinejad H. Transcellular brain drug delivery: a review on recent advancements. Int J Pharm 2020; 586:119582. [DOI] [PubMed] [Google Scholar]
- 16.Jiang L, Chen W, Ye J, Wang Y. Potential role of exosomes in ischemic stroke treatment. Biomolecules 2022; 12:115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Li Y, Tang Y, Yang GY. Therapeutic application of exosomes in ischaemic stroke. Stroke Vasc Neurol. 2021; 6:483–495. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Gao H, Zhang Y, Xue H, Zhang Q, Zhang Y, Shen Y, et al. Long non-coding RNA Peg13 alleviates hypoxic-ischemic brain damage in neonatal mice via miR-20a-5p/XIAP axis. Neurochem Res 2022; 47:656–666. [DOI] [PubMed] [Google Scholar]
- 19.Chen LT, Jiang CY. MicroRNA expression profiles identify biomarker for differentiating the embolic stroke from thrombotic stroke. Biomed Res Int 2018; 2018:4514178. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Robertson GS, Crocker SJ, Nicholson DW, Schulz JB. Neuroprotection by the inhibition of apoptosis. Brain Pathol 2000; 10:283–292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Fluri F, Schuhmann MK, Kleinschnitz C. Animal models of ischemic stroke and their application in clinical research. Drug Des Devel Ther 2015; 9:3445–3454. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Nan Y, Wang S, Jia W. Caspase independent cleavages of TDP-43 generates 35kD fragment that cause apoptosis of breast cancer cells. Biochem Biophys Res Commun 2018; 497:51–57. [DOI] [PubMed] [Google Scholar]
- 23.Wang SQ, Gao Y. Preliminary study on the correlation between syndrome elements and prognosis of ischemic stroke. Chin J Tradit Chin Med 2016; 31:4794–4797. [Google Scholar]
- 24.Zhou BH, Chen P, Luo Y. Efficacy and safety of gastrodin injection in the treatment of acute cerebral infarction: a meta-analysis. Chin Med 2018; 13:1655–1660. [Google Scholar]
- 25.Li S, Bian L, Fu X, Ai Q, Sui Y, Zhang A, et al. Gastrodin pretreatment alleviates rat brain injury caused by cerebral ischemic-reperfusion. Brain Res 2019; 1712:207–216. [DOI] [PubMed] [Google Scholar]
- 26.Qiu CW, Liu ZY, Zhang FL, Zhang L, Li F, Liu S-Y, et al. Post-stroke gastrodin treatment ameliorates ischemic injury and increases neurogenesis and restores the Wnt/β-Catenin signaling in focal cerebral ischemia in mice. Brain Res 2019; 1712:7–15. [DOI] [PubMed] [Google Scholar]
- 27.Peng Z, Wang S, Chen G, Cai M, Liu R, Deng J, et al. Gastrodin alleviates cerebral ischemic damage in mice by improving anti-oxidant and anti-inflammation activities and inhibiting apoptosis pathway. Neurochem Res 2015; 40:661–673. [DOI] [PubMed] [Google Scholar]
- 28.Jiang G, Hu Y, Liu L, Cai J, Peng C, Li Q. Gastrodin protects against MPP(+)-induced oxidative stress by up regulates heme oxygenase-1 expression through p38 MAPK/Nrf2 pathway in human dopaminergic cells. Neurochem Int 2014; 75:79–88. [DOI] [PubMed] [Google Scholar]
- 29.Sui Y, Bian L, Ai Q, Yao Y, Yu M, Gao H, et al. Gastrodin inhibits inflammasome through the STAT3 signal pathways in TNA2 astrocytes and reactive astrocytes in experimentally induced cerebral ischemia in rats. Neuromolecular Med 2019; 21:275–286. [DOI] [PubMed] [Google Scholar]
- 30.Liu B, Li F, Shi J, Yang D, Deng Y, Gong Q. Gastrodin ameliorates subacute phase cerebral ischemia-reperfusion injury by inhibiting inflammation and apoptosis in rats. Mol Med Rep 2016; 14:4144–4152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Mi Y, Wang M, Liu M, Cheng H, Li S. Pharmacokinetic comparative study of GAS with different concentration of tetramethylpyrazine and ferulic acid on liver-yang hyperactivity migraine model by blood-brain microdialysis method. J Pharm Biomed Anal 2020; 191:113643. [DOI] [PubMed] [Google Scholar]
- 32.Long Y, Yang Q, Xiang Y, Zhang Y, Wan J, Liu S, et al. Nose to brain drug delivery - A promising strategy for active components from herbal medicine for treating cerebral ischemia reperfusion. Pharmacol Res 2020; 159:104795. [DOI] [PubMed] [Google Scholar]
- 33.Elliott RO, He M. Unlocking the power of exosomes for crossing biological barriers in drug delivery. Pharmaceutics 2021; 13:122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Marostica G, Gelibter S, Gironi M, Nigro A, Furlan R. Extracellular vesicles in neuroinflammation. Front Cell Dev Biol 2021; 8:623039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Azizi F, Askari S, Javadpour P, Hadjighassem M, Ghasemi R. Potential role of exosome in post-stroke reorganization and/or neurodegeneration. EXCLI J 2020; 19:1590–1606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Mens MMJ, Heshmatollah A, Fani L, Ikram MA, Ikram MK, Ghanbari M. Circulatory microRNAs as potential biomarkers for stroke risk: the Rotterdam Study. Stroke 2021; 52:945–953. [DOI] [PubMed] [Google Scholar]
- 37.Qin X, Zhou M, Lv H, Mao X, Li X, Guo H, et al. Long noncoding RNA LINC00657 inhibits cervical cancer development by sponging miR-20a-5p and targeting RUNX3. Cancer Lett 2021; 508:73–75. [DOI] [PubMed] [Google Scholar]
- 38.Kumar S, Fairmichael C, Longley DB, Turkington RC. The multiple roles of the IAP super-family in cancer. Pharmacol Ther 2020; 214:107610. [DOI] [PubMed] [Google Scholar]
- 39.Zhang H, Wang X, Huang H, Wang Y, Zhang F, Wang S. Hsacirc0067997 promotes the progression of gastric cancer by inhibition of miR-515-5p and activation of Xchromosome-linked inhibitor of apoptosis (XIAP). Artif Cells Nanomed Biotechnol 2019; 47:308–318. [DOI] [PubMed] [Google Scholar]






