Abstract
This examination studied if Esculeoside A (ESA) alleviates reproductive toxicity in a type 1 diabetes mellitus (T1DM) rat model and if activating Nrf2 underlies this protection. T1DM was established by a single injection of STZ. Aged-matched adult control and STZ-DM rats were administered either the vehicle (5% carboxymethyl cellulose) or ESA (100 mg/kg). An additional group [STZ-DM + ESA (100 mg) + brusatol (2 m/kg] was added. All treatments were conducted for 16 weeks. ESA failed to attenuate weight loss, hyperglycemia, and hypoinsulinemia but significantly attenuated the associated dyslipidemia in STZ-DM rats. In parallel, ESA also enhanced total sperm count, motility, survival, reduced head and tail sperm abnormalities, increased circulatory concentrations of follicular stimulating hormone (FSH), testosterone, and Luteinizing hormone (LH), and stimulated the testicular expression of several steroidogenic enzymes (StAR, CYP11A1, CYP17A1, 3β-HSD1) in STZ-DM rats. These observations were associated with a higher testicular increase in the transcription, protein levels, and nuclear activities of Nrf2 that coincided with a reduction in the total levels of MDA and keap1 and a significant increase in the total levels of some antioxidants such as HO-1, SOD, and GSH. In concomitance, ESA reduced the testicular mRNA and nuclear concentrations of NF-κB and depressed the levels of TNF-α and IL-6. Brusatol prevented all these protective effects of ESA. In conclusion, activation of Nrf2 triggers the protective potential of ESA against reproductive toxicity in STZ-DM rats.
Keywords: Esculeoside A, T1DM, Testis, Sperm, Oxidative stress, Nrf2
1. Introduction
Type 1 DM (T1DM) is a common metabolic disease that affects people of all ages and races dues to auto-immune destruction of the pancreatic β cells (Saeedi et al., 2019). T1DM results in an extreme deficiency in the circulatory levels of insulin, adversely affecting the function of multiple organs and systems and leading to diverse vascular and non-vascular complications (Papatheodorou et al., 2018, Banday et al., 2020). The streptozotocin (STZ) diabetic animal model induced by single or multiple doses of STZ remains the most acceptable model that resembles T1DM and causes similar clinical complications of this disorder (Furman, 2021).
It is well-established that DM is also a major cause of higher rates of subfertility and infertility in adult males (He et al., 2021). Available data have shown that about 50% of diabetic patients are experiencing some degree of infertility or subfertility. In this regard, it was shown that T1DM and T2DM can lead to male reproductive dysfunction and toxicity by acting through two central mechanisms, named oxidative stress and impaired hypothalamic-pituitary gonadal axis (HPGA) (He et al., 2021). By these two mechanisms, DM leads to testicular atrophy, retrograde ejaculation, loss of libido, poor erection, damaged seminiferous tubule and reproductive cells (i.e., Leyding and Sertoli cells), impaired spermatogenesis and sex hormone production, and reduction in the sperm parameters (Condorelli et al., 2018, He et al., 2021). A full description of which DM induces oxidative stress in the testis, epididymis, and sperms and how it impairs the HPGA is discussed in excellent reviews and studies (Aitken et al., 2016, Condorelli et al., 2018, Maresch et al., 2018, Rakhshandeh et al., 2022, He et al., 2021).
Nonetheless, the majority of mammalian cells can fight oxidative stress and resist cell death. Nrf2 (the nuclear factor (erythroid-derived 2)-like 2) is the most commonly reported transcription factor in the cell that upregulates glutathione (GSH) and the expression of antioxidant genes by binding to the antioxidant response element (ARE) (Matsumaru and Motohashi, 2021). The transactivation of Nrf2 under normal conditions remains restricted due to its cytoplasmic binding to keap1, which enhances its proteasome degradation (Matsumaru and Motohashi, 2021). However, under oxidative stress, keap1 dissociates from Nrf2, which is then translocated to the nuclear to initiate the transcriptional process (McMahon et al., 2003; Matsumaru and Motohashi, 2021). In T1DM, studies have shown that subfertility, testicular oxidative stress/inflammatory cells injury and degeneration, reduced sperm count, and higher sperm are correlated with disturbing the signaling of Nrf2. Indeed, several authors have reported a reduction in the testicular transcription and activation of Nrf2, and drugs that can stimulate Nrf2 are novel protective agents that can preserve the reproductive function of these diabetic male animals (Saeedan et al., 2021, Arkali et al., 2021, ALTamimi et al., 2021, Samir et al., 2021).
Tomatoes (Solanum lycopersicum) are a major component of our daily diet and can be consumed as whole plants, juice, soup, and paste (Collins et al., 2022). During the last decades, the health benefits of tomatoes have been extensively studied. They showed antioxidant and anti-inflammatory pharmacological activities against cancer, DM, hypertension, and skin, renal, hepatic, and cardiovascular disorders (Collins et al., 2022). Major ingredients underlying these protections include lycopene, α-tomatine, resveratrol, and kaempferol, vitamins, and phenolic acids (e.g., homovanillic acid, cimetidine, caffeic acids). Interestingly, tomatoes' anti-infertility and reproductive protective effects were also documented in the literature. Within this view, tomato extract, juice, or paste prevented Leyding and Sertoli cell damage, stimulated spermatogenesis, improved thickening of the seminiferous tubules, and enhanced sexual performance in animal models of lead poisoning and those exposed to unilateral torsion (Salawu et al., 2009; Septiani et al., 2022).
ESA is a newly discovered spirosolane steroidal glycoside isolated from tomatoes, and ESA is a major component of ripe tomatoes and is present at a four-fold higher content than that of lycopene, the main tomato carotenoid (Yang et al., 2019). ESA is produced from the oxidation of tomatine at C-23 and C-27 is oxidized to tomatoes, whereas tomatine is more dominant in green tomatoes (Katsumata et al., 2011). The pharmacological properties of ESA were not studied well. Available data have hypoglycemic, insulin-sensitizing, anti-allergic, antioxidant, anti-inflammatory, and hypolipidemic effects (Fujiwara et al., 2007, Zhou et al., 2016, Yang et al., 2019).
The protective effect of ESA against testicular damage was never studied before in any animal model. This study aimed to evaluate if the treatment with ESA can alleviate STZ-T1DM-induced testicular damage in adult male rats. In addition, we sought to examine if ESA affords this protection by activating the Nrf2/antioxidant axis.
2. Materials and methods
2.1. Animals
Adult males of Wistar albino (9-week-old rats, 142 ± 17 g) were provided by Experimental Animal Center Care, KSU. Animal housing conditions were 4 rats/cage, 12 h/dark/light repetitive cycles, and 23 ± 1℃. The animal protocols adopted and performed in this study received institutional ethical approval from Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia (IRB: 20–0096).
2.2. Establishment of STZ diabetic animal model
To induce insulin efficiency in rats, we have followed the protocols of others who previously used STZ (Song et al., 2020; Saeedan et al., 2021; Shokri et al., 2023). Briefly, the STZ powder (Cat. No. S0130), which was provided by Sigma Aldrich (MO, USA), was prepared in 0.1% Na-citrate buffer (pH = 5.5). Twelve hours fasted rats were injected with STZ (60 mg/kg/i.p./once) and given 2 ml of 0.5% glucose solution to avoid death from sudden hypoglycemia. After three days, fasting blood glucose (FBG) levels were evaluated in each rat using a tail-collected sample (100 µl) by an Accu-Chek glucometer. Those rats with T1DM were selected and included in the experimental procedure if their FBG was higher than 350 mg/kg.
2.3. Preparation of the ESA
The preparation of the pure extract of ESA from fresh ripe tomatoes was performed as described in the literature (Fujiwara et al., 2007, Zhou et al., 2022). The fresh local ripe tomato was purchased from the vegetable market in Riyadh City, Kingdom of Saudi Arabia, during the cultivation period. The fruits were washed with water and then smashed and filtered. The filtrate was centrifuged at low speed for 10 min (500 × g/room temperature), the supernatants were isolated, and ESA was isolated using the column chromatography using Diaion HP20 (Cat. # 13616, Aldrich, St Louis, MO, US), which were then eluted with 60% methanol. All samples were next collected after passing a reverse silica gel column. The organic layer was removed under pressure. This protocol yielded 0.057% of ESA, and the structure of the ESA was similar to the above-mentioned previous reports. At the time of use, the ESA pellet was freshly dissolved in 0.5% carboxymethyl cellulose (CMC).
2.4. Experimental design
All rats were divided into 5 groups (n = 8 each/total 40 rats). These include control + CMC (vehicle)-treated rats, control + ESA (100 mg/kg), STZ model, STZ + ESA (100 mg/kg), and STZ + ESA + brusatol (an Nrf2 inhibitor, 2 mg/kg). Treatments with the vehicle of the ESA were given daily. Brusatol was administered in two doses/week. The diet contained 70%, 20%, and 10% carbohydrates, proteins, and fats, respectively with a total energy of 4057 Kcal/kg. The experimental procedure continued for a total period of 12 weeks.
2.5. Selection of treatment regimen
The selection of 12 weeks was based on our previous studies, which reported greater oxidative testicular oxidative damage, reduced sperm count and motility, a decline in sex hormone levels, depletion of antioxidants, and suppression of Nrf2 signaling at the end of this period post-STZ injection at this dose (ALTamimi et al., 2021). ESA dose (100 mg/kg) was chosen by other authors who shown a therapeutic effect of this dose to alleviate hyperglycemia and insulin resistance (IR) and prevent hyperlipidemia in dp/dp mice and ApoE-Deficient Mice, respectively (Fujiwara et al., 2007, Zhou et al., 2022). This dose also showed maximum protection against testicular damage and the maximum increase in antioxidant levels in diabetic rats after 4 weeks of injection of STZ (data not shown). We have also used a similar dose of brusatol to suppress the activation of Nrf2 in the same animal model (ALTamimi et al., 2021).
2.6. Biochemical analysis in blood
On the last treatment day, all rats were overnight-fasted were anesthetized with xylazineAcepromazine/ketamine (10 mg/kg, 3 mg/kg, 100 mg/kg) (Rakhshandeh et al., 2022). Two ml blood samples were collected by heart puncturing and placed in sodium-fluoride or gel-containing tubes to collect plasma and serum, respectively (500 × g/room temperature/10 min). All samples were preserved at −20 until use. The glucose and insulin levels in the plasma samples were assayed using commercial glucose and ELISA insulin assay kits (Cat. # 10009582, Cayman Chemicals, CA, USA, and Cat # ERINS, ThermoFisher, USA). Serum concentrations of luteinizing hormone (LH), testosterone, and follicular stimulating hormone (FSH) were measured by ELISA (cat # CSB-E12654r, cat # CSB-E05100r, and cat # CSB-E05100r, CUSABIO, TX, USA). Serum levels of triglycerides (TGs), cholesterol (CHOL), and low-density lipoprotein cholesterol (LDL-c) were analyzed using colorimetric kits (Cat # 10010303, Cayman chemicals, Michigan, USA, Cat. # 79980, Crystal chem, Il- USA, and Cat. # BA0064 AssayGenie, Dublin, Ireland). Samples were analyzed as 8 per group, in duplicate, and as per given instructions.
2.7. Study of sperm parameters
This procedure was conducted as our previous reports and studies of others. In brief, neck dislocation was used for euthanasia. The caudal epididymides were isolated and perforated using a needle and then minced in a petri dish with a needle in 2 ml of normal saline (37℃). After liquefaction, this mince was used to evaluate sperm parameters, including morphology, count, viability, and motility. The sperm count was performed using a 10 µl of this solution which was counted under a Neubauer hemocytometer and a light microscope (400 X). To determine sperm motility, a sample (10 µl) was examined on a pre-warmed plain glass slide (35℃) to calculate motility in 4 different fields. Sperm motility was calculated as [% of mobile sperms/immobile sperms]. To investigate sperm viability and percentage of dead sperm, the semen sample (10 µl) was placed on a glass plain slide and mixed with 2 drops of 1% eosin stain, which was left for 30 s and then mixed with another 2 drops of 30% Nigrosin. The percentage of dead sperm (stained pink) was presented to live sperm (unstained). To examine morphology and sperm abnormalities, the semen sample (10 µl) was placed on a warmed slide. Then, the sample was stained with 1% Eosin and incubated for 30 min. Then, the extra stain was removed, and samples were visualized under a light microscope (400X). Eight samples were analyzed per group in duplicates.
2.8. Testicular homogenates and biochemical analysis
Both testes were isolated on ice and de-capsulated, placed in liquid nitrogen, and then cut into smaller parts. Homogenization in PBS (ice-cold, pH = 7.4) followed by centrifugation at 4℃ (12000 × g) was used to prepare the total testicular homogenates for all samples. All collected supernatants were preserved at −80℃. The nuclear and cytoplasmic proteins were prepared from the frozen parts of the testis of each rat using a commercially available nuclear/cytoplasmic tissue kit (Cat. # NT-032; Invent Biotechnologies, MN, USA) as per instructed by the manufacturer. Testicular homogenate concentration of interleukin 6 (IL-6) was evaluated by ELISA (Cat. # MBS269892 MyBioSorces, CA, USA). The tumor necrosis factor-alpha (TNF-α) concentration in the homogenates was estimated using an ELISA kit (Cat. # MBS9501941, MyBioSorces, CA, USA). Total concentrations of lipid peroxides in all testicular homogenates were estimated as malondialdehyde (MDA) levels using a colorimetric kit (Cat. # K739-100, Biovision, TX, USA). The evaluation of the concentrations of heme oxygenase-1 (HO-1) in these homogenates was conducted using ELISA (Cat # ADI-EKS-810A; ENZO, IL, USA). The total levels of superoxide dismutase-1 (Cu/Zn; SOD1) were analyzed using specialized SOD-1 ELISA kits (Cat. No. E1444Ra, Bioassay Technology Laboratory, Shanghai, China). The concentration of total glutathione (GSH) levels was analyzed using a rat-specific GSH ELISA kit (Cat. # RTEB1811, AssayGenie, Dublin, Ireland). The concentrations of NF-κb p65 and Nrf2 in the cytoplasmic and nuclear fractions were evaluated by ELISA (Cat. # CSB-E13148r, CUSABIO, Tx, USA and Cat. # NBP3-08161, Novus biologicals, CO, USA, respectively). Eight samples per group were used for the analyses, and all measurements were done in duplicate per each kit's instructions.
2.9. Real-time quantitative polymerase chain reaction (q-pCR)
This protocol was performed to measure the mRNA (transcript) levels of several targets including steroidogenic genes 3β-HSD, CYP17A, StAR, CYP11A1, 17α-hydroxylase/17, CYP17A1, NF-κB and Nrf2, Bax, Bcl2, and caspase-3, and β-actin (reference gene). The pair sequence of the primers used to amplify Nrf2, NF-κB, and β-actin is given in Table 1. The pair sequence of the primers used to amplify all other genes is adopted for the study of Ijaz et al. (2023). In brief, TRIZOL reagent was used as per instruction to isolate the total RNA from the frozen testicular tissues. Isolated RNA was treated freshly with DNAses to remove precipitated DNA, and the purity of all samples was considered if absorbance (Abs) at 260/280 nm was > 1.8. The RevertAid First Strand kit (Cat. # K1621, ThermoFisher Scientific, USA) was used to prepare the first strand cDNA. qPCR was performed using the Ssofast Evergreen master mix (Cat. # 172–5200, BioRad, USA) in a CFX95 machine according to the steps established by the supplier. All amplifications were performed as n = 8 samples/group and were performed in duplicate.
Table 1.
Primers used in the q-PCR reaction.
| Target | Primers sequence 5′→3′ | Accession No. | Base pair length |
|---|---|---|---|
| Nrf2 | F:AAAATCATTAACCTCCCTGTTGAT R: CGGCGACTTTATTCTTACCTCTC |
NM_031789 | 118 |
| NF-κB | F:GTGCAGAAAGAAGACATTGAGGTG R:AGGCTAGGGTCAGCGTATGG |
XM_342346.4 | 176 |
| Keap1 | F:CTTCGGGGAGGA GGAGTTCT R: CGTTCAGATCATCGCGGCTG |
NM_057152.2 | 122 |
| β-actin | F: CGAGTACAACCTTCTTGCAGC R: CCTTCTGACCCATACCCACC |
NM_031144.3 | 209 |
2.10. Testis histology
All testes were routinely stained with hematoxylin and eosin (H&E) stains, as previously described in our laboratory (ALTamimi et al., 2021). Briefly, freshly collected samples (1 mm3) of all testes of all groups of rats were preserved in 10% buffered formalin samples for 30 h. Preservations of the samples were done in a 10% buffered formalin solution. Further treatments included ethanol rehydration, Xyline clearance, and paraffin embedding. Sections of 3 µm were prepared by a rotary microtome. All slides were examined under a light microscope under 200 x.
2.11. Statistical analysis
GraphPad Prism statistical software package (version 8) was used for the statistical analysis of all data of this study. Testing of the data normality was performed using the Kolmogorov-Smirnov test. The comparison was done using the one-way ANOVA test. The levels of significance were detected using Tukey’s test (p < 0.05). Data are presented and graphed as mean ± SD.
3. Results
3.1. ESA ameliorates hyperlipidemia and fails to modulate fasting glucose and insulin levels in STZ-DM rats
There were no significant differences when final body weights, FBG, and FPI were compared between the control and ESA-treated rats (p > 0.5) (Table 2). Higher levels of FPG, FPI, CHOL, TGs, and LDL-c were seen in the plasma and serum of STZ-DM rats and were parallel with lower serum levels of HDL-c (p < 0.05) (Table 2). Final body weights, FPG, and FPI showed no significant variations (p > 0.05) between STZ-DM, STZ-DM + ESA, and STZ-DM + ESA + brusatol-treated rats (Table 2). Samples from ESA and STZ-DM + ESA-treated rats had lower fasting concentrations of TGs, CHOL, and LDL-c (p < 0.01) and higher concentrations of HDL-c (p < 0.05) when compared to the control or STZ-DM rats (Table 2). STZ-DM + ESA + brusatol rats showed lower serum concentrations of HDL-c (p > 0.01) but had higher serum concentrations of all other lipids (p < 0.05) as compared to STZ-DM + ESA-treated rats (Table 2). No significant differences in the serum concentrations of all these lipids were seen between the STZ-DM and STZ-DM + ESA + brusatol-treated rats (P > 0.5) (Table 2).
Table 2.
Levels of some diabetic markers and lipid profiles in all experimental groups of rats.
| Parameter | Control | ESA (100 mg/kg) | STZ-DM | STZ-DM + ESA (100 mg/kg) | STZ-DM + ESA (100 mg/kg) + Brusatol |
|---|---|---|---|---|---|
| Final Bwt (g) | 483.4 ± 56.3 | 502.3 ± 47.3 | 362.2 ± 38.2ab | 350.2 ± 33.9ab | 355.4 ± 43.2ab |
| FPG (mg/dl) | 98.3 ± 7.6 | 103.1 ± 8.4 | 373.2 ± 42.3ab | 363.9 ± 38.2ab | 382.8 ± 44.1ab |
| FPI (µIU/ml) | 4.37 ± 0.73 | 4.64 ± 0.73 | 1.21 ± 0.17ab | 1.34 ± 0.17ab | 1.24 ± 0.24ab |
| TGs (mg/dl) | 82.7 ± 7.6 | 65.4 ± 7.1 | 198.3 ± 15.4ab | 110.1 ± 12.2abc | 183.4 ± 16.5abd |
| CHOL (mg/dl) | 93.4 ± 9.4 | 71.3 ± 6.1ab | 223.5 ± 24.5ab | 112.5 ± 10.7abc | 243.2 ± 33.5abd |
| LDL-c (mg/dl) | 47.8 ± 5.8 | 32.8 ± 4.1ab | 127.3 ± 11.1abc | 51.2 ± 5.0 bc | 118.2 ± 13.2abd |
| HDL-c (mg/dl) | 33.8 ± 4.3 | 44.1 ± 4.8ab | 16.3 ± 2.4ab | 28.3 ± 2.3bc | 19.2 ± 3.1abd |
Data were analyzed by 1-way ANOVA and Tukey’s post-hot and are presented as means ± standard deviation (SD) for n = 8 samples/group. The level of significance was considered at p < 0.05. (a): significantly different from the control rats fed the standard diet. (b): significantly different from the ESA (100 mg/kg)-treated rats. (c): significantly different from STZ-DM ras. (D): significantly different from the STZ + ESA (100 mg/kg)-treated rats. FPG: fasting plasma glucose; FPI: fasting plasma insulin. ESA: Esculeoside A. Brusatol: An Nrf2 inhibitor.
3.2. ESA ameliorates the reduction in circulatory sex hormones in STZ-DM rats
When compared with each other, the control and STZ-treated rats showed no significant differences in the circulatory concentrations of FSH, LH, and testosterone (p > 0.05) (Table 3). STZ-DM rats had lower circulatory concentrations of FSH, LH, and testosterone when compared to the control (p > 0.05). On the opposite, the circulatory concentration of all these hormones measured in the STZ-DM + ESA-treated rats was significantly higher as compared to STZ-DM rats but were significantly lower when compared to STZ-DM + ESA + brusatol-treated rat (p > 0.05) s (Table 3). No statistical difference s(p > 0.05) was seen in the serum levels of FSH, LH, and testosterone between the STZ-DM-treated rats vs. STZ-DM + ESA + brusatol-treated rats.
Table 3.
Circulatory levels of major sex hormones in the serum of all experimental groups of rats.
| Parameter | Control | ESA (100 mg/kg) | STZ-DM | STZ-DM + ESA (100 mg/kg) | STZ-DM + ESA (100 mg/kg) + Brusatol |
|---|---|---|---|---|---|
| Total Testosteron (ng/ml) | 7.62 ± 1.4 | 7.42 ± 1.9 | 2.43 ± 0.39ab | 6.1 ± 0.89 abc | 2.18 ± 0.45abd |
| FSH (mIU/ml) | 1.82 ± 0.24 | 1.71 ± 0.12 | 0.63 ± 0.09ab | 1.63 ± 0.26ab | 0.53 ± 0.06abd |
| LH (mIU/ml) | 4.29 ± 0.58 | 4.63 ± 0.83 | 1.47 ± 0.21ab | 4.18 ± 0.59ab | 1.58 ± 0.31abd |
Data were analyzed by 1-way ANOVA and Tukey’s post-hot and are presented as means ± standard deviation (SD) for n = 8 samples/group. The level of significance was considered at p < 0.05. (a): significantly different from the control rats fed the standard diet. (b): significantly different from the ESA (100 mg/kg)-treated rats. (c): significantly different from STZ-DM ras. (D): significantly different from the STZ + ESA (100 mg/kg)-treated rats. ESA: Esculeoside A. Brusatol: An Nrf2 inhibitor. FSH: follicular stimulating hormone. LH: luteinizing hormone.
3.3. ESA ameliorates the reduction in testes weights and alteration in sperm parameters and morphology in STZ-DM rats
ESA-treated rats have similar non-significant values (p > 0.05) of testicle weights, sperm count, motility, survival rate, and percentages of abnormalities in the sperm head, tail, and neck vs. control rats (Table 4). A significant reduction (p < 0.05) in the testicle weights, sperm count, motility, and survival that is parallel with a significant increment (p < 0.05) in the percentages of sperm abnormal heads, tail, and neck were observed in STZ = DM rats as compared to controls (Table 4). These alterations were significantly reversed (p > 0.05) in STZ-DM + ESA-treated rats (Table 4). Of note, testicle weights, as well as the reductions in the sperm mentioned above parameters, as well as the increase in the above-mentioned sperm parameters were not significantly different (p > 0.05) between the STZ-DM + ESA + brusatol-treated rats and STZ-DM rats (Table 4).
Table 4.
Testicle weights and semen analysis in all experimental groups of rats.
| Parameter | Control | ESA (100 mg/kg) | STZ-DM | STZ-DM + ESA (100 mg/kg) | STZ-DM + ESA (100 mg/kg) + Brusatol |
|---|---|---|---|---|---|
| Testes weights (g) | 3.62 ± 0.57 | 3.72 ± 0.42 | 2.98 ± 0.26ab | 3.51 ± 0.49c | 2.82 ± 0.37abd |
| Sperm count (x106/mm3) | 32.24 ± 4.1 | 29.36 ± 3.6 | 14.28 ± 2.1ab | 28.67 ± 3.2c | 15.27 ± 1.7abd |
| Sperm motility (%) | 68.81 ± 5.4 | 64.33 ± 6.7 | 33.13 ± 3.6ab | 65.38 ± 5.9c | 31.2 4 ± 2.7abd |
| Sperm survival (%) | 85.2 ± 9.5 | 81.9 ± 7.6 | 52.5 ± 4.8ab | 81.3 ± 8.4c | 48.4 ± 4.7abd |
| Sperm morphology abnormalities | |||||
| Headless sperm (%) | 3.14 ± 0.43 | 2.91 ± 0.58 | 7.80 ± 0.63ab | 3.50 ± 0.47bc | 8.48 ± 0.98abd |
| Tailess sperm (%) | 2.56 ± 0.33 | 2.87 ± 0.25 | 11.58 ± 1.3ab | 3.63 ± 0.47abc | 13.29 ± 1.9abd |
| Coiled neck sperm (%) | 2.78 ± 0.28 | 2.57 ± 0.36 | 6.95 ± 0.83ab | 3.11 ± 0.43abc | 7.64 ± 2.77abd |
| Coiled tail sperm (%) | 5.67 ± 0.67 | 5.82 ± 0.48 | 15.42 ± 1.82ab | 5.52 ± 0.72c | 14.36 ± 2.1abd |
| Total abnormalities (%) | 12.78 ± 1.32 | 11.96 ± 1.19 | 39.5 ± 3.16ab | 13.89 ± 1.39c | 41.66 ± 4.53abd |
Data were analyzed by 1-way ANOVA and Tukey’s post-hot and are presented as means ± standard deviation (SD) for n = 8 samples/group. The level of significance was considered at p < 0.05. (a): significantly different from the control rats fed the standard diet. (b): significantly different from the ESA (100 mg/kg)-treated rats. (c): significantly different from STZ-DM ras. (D): significantly different from the STZ + ESA (100 mg/kg)-treated rats. ESA: Esculeoside. Brusatol: An Nrf2 inhibitor.
3.4. ESA reduces lipid peroxidation and inflammation but stimulates endogenous antioxidants in the testes of STZ-DM rats
Significantly higher concentrations (p < 0.05) of lipid peroxides (MDA) and inflammatory markers (TNF-α, & IL-6) with a significant reduction in the concentrations of major antioxidants (HO-1, SOD, & GSH) (p < 0.05) were observed in the testes of STZ-DM rats when compared to control (Fig. 1A-F). Opposing this, the testes of ESA-treated rats and STZ-DM + ESA-treated rats showed significantly lower concentrations of MDA, IL-6, and TNF-α (p < 0.05) and higher content of all antioxidants as mentioned above (p < 0.05) vs control or STZ-DM, respectively. No detectable and significant differences were seen in the levels of all these endpoints were seen between the STZ-DM model rats and those treated as STZ-DM + ESA + brusatol (Fig. 1A-F).
Fig. 1.
Levels of inflammatory and oxidative stress-related parameters in the testicular homogenates of all groups of rats. Data were analyzed by 1-way ANOVA and Tukey’s post-hot and are presented as means ± standard deviation (SD) for n = 8 samples/group. The level of significance was considered at p < 0.05. (a): significantly different from the control rats fed the standard diet. (b): significantly different from the ESA (100 mg/kg)-treated rats. (c): significantly different from STZ-DM ras. (D): significantly different from the STZ + ESA (100 mg/kg)-treated rats. ESA: Esculeoside. Brusatol: An Nrf2 inhibitor. A. IL-6 interleukin 6 (IL-6). TNF-α: tumor necrosis factor-alpha. MDA: malondialdehyde (MDA). HO-1: heme oxygenase-1. SOD: total superoxide dismutase. GSH: total glutathione (GSH).
3.5. ESA stimulates the transcription and nuclear transactivation of Nrf2 and concomitantly downregulates keap1 in the testes of STZ-DM rats
With a significant increment in the mRNA and cytoplasmic levels of keap1 (p < 0.01), the testes of STZ-DM rats showed a significant decline p < 0.01) in mRNA levels, total cytoplasmic protein levels, and nuclear protein concentrations of Nrf2 (Fig. 2A-E). The testes of the ESA-treated rats and those of STZ-DM + ESA-treated rats showed significantly higher transcripts, cytoplasmic and nuclear protein concentrations of Nrf2 (p < 0.01) that coincided with a significant decline in the transcription and cytoplasmic protein levels of keap1 (p < 0.05) as compared with the controls or STZ-DM rats, respectively (Fig. 2A-E). The mRNA, cytoplasmic protein levels, and nuclear concentrations of Nrf2, as well as mRNA levels and total protein levels of keap1, were not statistically varied between the STZ-DM rats and STZ-DM + ESA + bruasatol-treaed rats (Fig. 2A-E).
Fig. 2.
mRNA, cytoplasmic, and nuclear levels of Nrf2 and mRNA and cytoplasmic levels of keap1 in the testicular tissues of all groups of rats. Data were analyzed by 1-way ANOVA and Tukey’s post-hot and are presented as means ± standard deviation (SD) for n = 8 samples/group. The level of significance was considered at p < 0.05. (a): significantly different from the control rats fed the standard diet. (b): significantly different from the ESA (100 mg/kg)-treated rats. (c): significantly different from STZ-DM ras. (D): significantly different from the STZ + ESA (100 mg/kg)-treated rats. ESA: Esculeoside. Brusatol: An Nrf2 inhibitor.
3.6. ESA restores the expression of steroidogenic genes and inhibits the expression and activation of NF-κB in the testes of STZ-DM rats
There was a significant decline in the mRNA levels and the concentrations of NF-κB in the cytoplasm and nuclei in the testes of ESA-treated rats (p < 0.05) as compared to the control group (Fig. 3A-C). There were no significant alterations (p > 0.05) in the mRNA levels of StAR, CYP11A1, CYP17A1, and 3β-HSD1 between the control and STZ-DM rats (Fig. 3 D-G). On the opposite, the testes of the STZ-DM model rats showed significantly higher mRNA levels and nuclear/cytoplasmic concentration of NF-κB and lower mRNA levels of StAR, CYP11A1, CYP17A1, and 3β-HSD1 (p < 0.01) vs. the controls (Fig. 3A-G). The levels/concentrations of all these parameters were significantly reversed (p < 0.05) in testes of STZ-DM + ESA-treated rats when the comparison was done against the STZ-DM model rats (Fig. 3A-G). Also, the mRNA levels, total cytoplasmic protein level, and the concentration of NF-κB in the nuclei, as well as the mRNA levels of StAR, CYP11A1, CYP17A1, and 3β-HSD1, showed no significant variations between the STZ-DM rats and STZ-DM + ESA + brusatol-treated rats (Fig. 3A-G).
Fig. 3.
mRNA, cytoplasmic, and nuclear levels of NF-κB, as well as mRNA of some steroidogenic genes in the testicular tissues of all groups of rats. Data were analyzed by 1-way ANOVA and Tukey’s post-hot and are presented as means ± standard deviation (SD) for n = 8 samples/group. The level of significance was considered at p < 0.05. (a): significantly different from the control rats fed the standard diet. (b): significantly different from the ESA (100 mg/kg)-treated rats. (c): significantly different from STZ-DM ras. (D): significantly different from the STZ + ESA (100 mg/kg)-treated rats. ESA: Esculeoside. Brusatol: An Nrf2 inhibitor.
3.7. ESA prevents intrinsic cell apoptosis in the testes of the STZ-DM rats
The testes of ESA-treated rats showed similar and non-significant levels of apoptotic/anti-apoptotic markers (caspase-3, Bax, & Bcl2, and caspase-3) as compared to controls (Fig. 4A-C). With a significant decline (p < 0.05) in the transcripts of Bcl2 (p < 0.05), the testes of STZ-DM rats had significantly high levels of mRNA of Bax and caspase-3 (P < 0.05) as compared with the control rats, which were significantly reversed again in the testes of STZ-DM + ESA-treated rats (Fig. 4A-C). Also, the mRNA levels of Bax and caspase-3 were significantly higher (p < 0.01). In comparison, the mRNA levels of Bcl2 were significantly lower (p < 0.05) in the testes of STZ-DM + ESA + brusatol-treated rats as compared to STZ + ESA-treated rats (Fig. 4A-C).
Fig. 4.
mRNA of Bax, Bcl2, and caspase-3 in the testicular tissues of all groups of rats. Data were analyzed by 1-way ANOVA and Tukey’s post-hot and are presented as means ± standard deviation (SD) for n = 8 samples/group. The level of significance was considered at p < 0.05. (a): significantly different from the control rats fed the standard diet. (b): significantly different from the ESA (100 mg/kg)-treated rats. (c): significantly different from STZ-DM ras. (D): significantly different from the STZ + ESA (100 mg/kg)-treated rats. ESA: Esculeoside. Brusatol: An Nrf2 inhibitor.
3.8. ESA prevents testicular damage and protects the seminiferous tubules and germ cells in STZ-DM rats
Normal features of seminiferous tubules and the structure of Leydig cells were seen in the testicular tissue of the control and ESA-treated rats (Fig. 5A&B). The seminiferous tubules of these groups showed a normal and abundant count of spermatogonia, primary/secondary spermatocytes, and mature sperms (Fig. 5A&B). Testes of STZ-DM rats showed an increased number of damaged seminiferous tubules that are characterized by disturbed tunica albuginea and a decreased number of spermatogonia, primary/secondary spermatocytes, and mature sperms (Fig. 5C). Almost normal semeniferous tubules with abundant germs cells and centrally mature sperms, as well as normal morphology of Leydig cells, were seen in the testes of STZ-DM + ESA + brusatol-treated rats (Fig. 5D). The testes of the STZ-DM + ESA + brusatol-treated rats showed similar pathological alterations to those seen in STZ-DM rats (STZ-DM) model rats.
Fig. 5.
Histological changes in the testes of all groups of rats. A and B were taken from control and ESA-treated rats and showed normal seminiferous tubule structure containing spermatogonia (SG), primary spermatocytes (PS), secondary spermatocytes (SS), and mature spermatids (ST). The testes of both groups had normal morphology and density of Leydig cells (LC) and intact tunica albuginea (TA) surrounding each seminiferous tubule. C: was taken from the testes of SZT-DM-model rat and showed obvious destruction and loss in LC and damaged seminiferous tubules, which showed damaged TA and reduced number of SG, PS, SS, and ST. D: was taken from STZ-DM + Esculeoside (ESA)-treated rats and shows almost normal testis histology with intact seminiferous tubule structure. The LC and other germ cells, including SG, PP, SS, and ST were seen as normal and in abundant numbers. E: was taken from the testes of STZ-DM + ESA + brusatol (Nrf2 inhibitor)-treated rats and show similar damage and pathological changes to those seen in the STZ-DM rats.
4. Discussion
Hyperglycemia that develops in patients with T1DM is a common prominent cause of multi-organ damage and failure and is a true risk factor for increasing subfertility and infertility in males of all ages (He et al., 2021). Currently, it is largely accepted that plant-derived flavonoids and phenols are major therapeutic agents that can alleviate diabetic complications, including reproductive dysfunction, thanks to their antioxidant and anti-inflammatory protections (Simas et al., 2017, Deka et al., 2022). Herein, and for the first time, the results reveal a potent protective effect of ESA, a tomato-derived spirosolane steroidal glycoside, against STZ-mediated DM-induced testicular damage and impairment in spermatogenesis. However, these effects do not involve modulating glucose or insulin levels. On the opposite, such reproductive protective effect of ESA is mainly due to its Nrf2-dependent hypolipidemic, anti-inflammatory, and antioxidant potentials.
Glucose is the major energy source in the testes that requires intact insulin signaling. In the sperms, the major fuel to produce ATP is glucose, fructose, and sorbitol (Cao et al., 2009, du Plessis et al., 2015). Also, the facilitated glucose uptake in the sperm and other testicular cells depends on the presence of other FSH and testosterone (Maresch et al., 2018). However, insulin remains the central hormone that controls the physiology of reproduction, spermatogenesis, and testicular development by regulating the neuroendocrine axis. In this regard, insulin stimulates the synthesis/secretion of testosterone in the Leydig cells by stimulating the hypothalamic production GnRH (Sliwowska et al., 2014). GnRH in turn enhances the release of FSH and LH from the pituitary gland (Sliwowska et al., 2014). Insulin receptors are abundantly expressed in diverse testicular cells (i.e Leydig, Sertoli cells, & spermatogonia) where insulin signaling initiates glucose uptake, cell development, and differentiation, and spermatogenesis (MacLean et al., 2013, Maresch et al., 2018). On the other hand, hyperglycemia, alone, can collapse sexual function, impairs spermatogenesis, damages sperm and cells of the seminiferous tubules, and induces hypogonadism (low testosterone levels) by exaggerating oxidant/inflammatory cell apoptosis in testicular and extra-testicular distal parts of the reproductive tracts (Maresch et al., 2018, He et al., 2021). Also, hyperglycemia can negatively suppress the release of GnRH from the hypothalamus and induces hypogonadism by similar oxidative and inflammatory mechanisms (Maresch et al., 2018).
Herein, we have validated the successfulness of our STZ-T1DM model by the obvious loss of body mass, polydipsia, higher food consumption, and the increase in circulatory fasting glucose levels that were with the concomitant reduction in fasting insulin levels. These data follow many other previous studies which utilized the same SZ-diabetic animal model to study the pathogenesis of STZ-T1DM on reproductive dysfunction. Further, we confirmed the reproductive toxicity in these diabetic rats by the inability of male rats to impregnate normal female rats (low pregnancy rate and offspring number), the reduction in testicular weight, damaged seminiferous tubules, of Leydig cells, reduced sperm count, abnormal sperm morphology, and reduced circulatory testosterone, FSH, and LH levels. These data are in the same line with many other clinical, systemic, case-controlled, and animal studies which have shown similar effects in diabetic individuals and experimental animals and attributed these effects to long-term hyperglycemia and reduced insulin levels. Meanwhile, ESA didn’t affect the structure of the testes nor hormonal levels and sperm parameters in the control rats, suggesting the safety of this dose. In addition, and despite the observed protective effect on fertility index, testicular morphology, and the alterations in sperms and hormonal levels, the treatment with ESA failed to enhance body weight and to lower food intake, as well as to alter plasma fasting levels of glucose and insulin in diabetic rat. It showed no significant effect on these parameters in control rats too, which administered this drug. These data were our direct evidence ESA reproductive protective potential is not mediated by modulating circulatory glucose or insulin but rather by acting locally on the testes to alleviate other pathological damaging associated pathways such as inflammation and oxidative stress. These data oppose those previously reported by Yang et al. (2019), who confirmed a potent hypoglycemic effect of ESA in dp/dp mice, mediated by improving peripheral insulin sensitivity and mainly through activating AMPK. This variation may be referred to as the variation of the animal model and species where this kind of mouse represents T2DM which is characterized by insulin resistance.
However, ROS-induced oxidative stress is the major and central mechanism leading to testicular and spermatic toxicity by promoting inflammation and caspase-dependent apoptosis (Nna et al., 2020). The high-fat content in the testes makes them high highly vulnerable to oxidative damage (Saez and Drevet, 2019). CHOL is an essential ingredient of the membranes and is needed to maintain integrity, fluidity, and synthesis of sex hormones. Therefore, as for glucose, CHOL hemostasis is indispensable for reproductive function (Saez et al., 2019). Currently, hyperglycemia and hyperlipidemia are listed as two independent factors that can damage the testicular tissues and reproductive cells and are negatively associated with sperm parameters (Amaral et al., 2006, Ergün et al., 2007, Maresch et al., 2018; Hamad Zubi and Hamad Alfarisi, 2021; He et al., 2021). Hyperlipidemia promotes the overproduction of ROS in the testicular tissue by impairing the mitochondria's oxidative phosphorylation and inducing mitochondria damage (Lobaccaro et al., 2012; Hamad Zubi and Hamad Alfarisi, 2021). Also, hyperglycemia induces massive quantities of free radicals in the sperms and the testis by acting NADPH oxidase, damaging the mitochondria, impairing the mitochondrial oxidative phosphorylation, causing lipid peroxidation, promoting endoplasmic reticulum (ER) stress, and increasing glycation of proteins (Volpe et al., 2018, Maresch et al., 2019, Rakhshandeh et al., 2022). Indeed, a diet rich in CHOL or TGs impaired male reproductive function and reduced pregnancy rates in mice and rats by impairing sperm motility and density, increasing sperm abnormalities, damaging the epithelial layer of the caudal epididymis, decreasing circulatory testosterone levels, reducing weights of the seminal vesicle, altering membrane fluidity that required for the acrosomal reaction and capacitation (Zubi and Alfarisi; 2021). However, the net output of hyperlipidemia on FSH and LH was varied, and diet-based studies have shown no change, an increase, or a decrease in their levels (Hamad Zubi and Hamad Alfarisi, 2021). Similar results and effects on testicular tissues, sperms, and sex hormones were also seen in STZ-diabetic animals (Maresch et al., 2019, He et al., 2021). Overall, ROS can lead to fertility by acting on blood vessels, testicular cells, and sperms to stimulate lipid peroxidation, reduce sperm motility, damage sperm DNA, exhaust antioxidants, deplete Zinc levels which is an antioxidant co-factor, induce fragmentation and apoptosis, and promoting endothelial dysfunction by scavenging nitric oxide (NO) and producing an excessive amount of peroxynitrite (NOO–) (Castela and Costa, 2016, Maresch et al., 2018, Maresch et al., 2019, He et al., 2021). Furthermore, ROS machines inflammation by activating the NF-κB/inflammatory cytokine axis, which exaggerates ROS production in a vicious cycle. In support, ROS-mediated hyperactivation of NF-κB was evidenced in the testicles and sperms of the STZ animal model of DM and involved in further inflammatory and apoptotic damage (Nna et al., 2019, Song et al., 2020).
In this study, STZ treatment promoted hyperlipidemia and significantly led to a higher lipid profile in the serum of model rats. The testicles of the STZ-diabetic rats of this study also showed an increment in the number of lipid peroxides and a reduction in the concentrations of major antioxidants. Also, STZ resulted in tissue inflammation and promoted the activation of inflammation NF-κB/TNF-αIL-6 axis. These findings support many other previous reports which have also shown similar results (Nna et al., 2019, Han et al., 2019, Song et al., 2020, ALTamimi et al., 2021, Rakhshandeh et al., 2022, ElBanna et al., 2023). In addition, the positive effects of ESA on all these pro-oxidant/inflammatory markers were also seen in control rats' testes. ESA. These data allowed us to presume that ESA alleviates reproductive testicular damage and the alterations in sperm parameters and testosterone levels by attenuating hyperlipidemia and exerting strong antioxidant and anti-inflammatory potentials. In addition, we are demonstrating that these effects are mediated by suppressing NF-κB and upregulating GSH and enzymatic antioxidants. Despite the paucity of enough evidence in the literature, the hypolipidemic effect of ESA was demonstrated in apolipoprotein-deficient mice and was shown to be mediated by suppressing the activation of ACAT1/2 (Fujiwara et al., 2007, Yang et al., 2019). However, ESA could also exhibit hypolipidemic effects by regulating hepatic lipogenic transcription factors such as SREBP and PPARγ/α, which regulate lipid synthesis and FA oxidation, respectively. This can’t be concluded based on our data and is a novel target for future studies. In addition, ESA can suppress CD4 + T lymphocytes by modulating Th2/Th1/Treg cell differentiation which underlies its anti-inflammatory effects (Zhou et al., 2022). Herein, we are providing evidence that ESA-mediated anti-inflammatory protection involves suppression of NF-κB which seems to be secondary to its antioxidant effect, as discussed below.
The transactivation of Nrf2 upregulates GSH and increases the transcription and levels of several antioxidant enzymes (Matsumaru and Motohashi, 2020). In addition, Nrf2 can directly repress cell inflammation by deactivating NF-κB by modulating the activity of the IκB kinase (IKK) (Wardyn et al., 2015). Also, Nrf2 can inhibit hepatic lipid synthesis by downregulating and deactivating the liver LXRα and SREBP1 (Kay et al., 2011, Qiu et al., 2022). An interesting notice observed in our study is that the hypolipidemic, antioxidant, and anti-inflammatory of ESA seem to be Nrf2-dependent mechanisms. Indeed, treating STZ-diabetic rats of this study with brusatol reduces the nuclear translocation of Nrf2 and abolishes the inhibitory effects of ESA on lipid profile, NF-κB, and inflammatory markers and its stimulatory effect on antioxidant parameters. Within this view, STZ treatment increased the expression and total content of keap1 while reducing the cytoplasmic content and the ratio of keap1/Nrf2 in the testes of DM rats. This may explain the reduced concentrations of Nrf2 in the nuclei of the cardiomyocytes of these rats. Also, the reduction in mRNA levels of Nrf2 in the testicles of T1DM rats of this study could be explained as a direct effect of hyperglycemia or increased cellular apoptosis and death. These data are per many other previous studies (Saeedan et al., 2021, Arkali et al., 2021, ALTamimi et al., 2021, Samir et al., 2021).
On the other page, the results reported here are direct evidence for the ability of ESA to stimulate not only the mRNA levels but also the total and nuclear translocation of Nrf2. It also shows the potential of ESA to lower the expression and total levels of keap1. These effects of ESA were observed in the testes of both the diabetic and non-diabetic rats, suggesting a regulatory role on these markers. Therefore, we postulated that the antioxidant and anti-inflammatory effects of ESA are mainly due to activation of Nrf2, which seems to be due to stimulating its transcription, inhibiting keep-1/Nrf2 interaction by downregulating keap1, and possibly by decreasing the nuclear export of Nrf2. Such regulation of Nrf2 may control hepatic lipid synthesis and subsequent hyperlipidemia, indirectly correlated with its antioxidant effect. However, since treatment with brusatol completely prevented the hypolipidemic, hypoglycemic, and anti-inflammatory effects of ESA, this study suggests that ESA protective effects are mainly mediated by the activation of Nrf2.
Nonetheless, the mechanism of testosterone production from cholesterol (steroidogenesis) is a tightly regulated mechanism that occurs mainly in the Leydig cells and depends on sufficient levels of FSH and LH and requires an integral set of enzymes such as StAR, CYP11A1, CYP17A1, 3β-HSD1, and 11β-HSD1 (Rahali et al., 2023). However, the role of cellular apoptosis in male reproductive physiology and infertility is well-established (Shukla et al., 2012). In the majority of cells, higher levels of ROS stimulate mitochondria-mediated (intrinsic) cell apoptosis by upregulating and increasing the ratio of Bax/bcl2 (Vitale et al., 2023). Bax is a pro-apoptotic protein that promotes mitochondria membrane damage and activates caspases by increasing the mitochondria's release of cytochrome-c (Vitale et al., 2023). Intrinsic cell apoptosis is well-reported in the testicular tissue of diabetic rodents (Chen et al., 2020, ALTamimi et al., 2021) and was also seen in the testes of the STZ-DM rats of this study. This explains the damage in the seminiferous tubules and Leyding cells and the reduction in testosterone levels and expression StAR, CYP11A1, CYP17A1, 3β-HSD1, and 11β-HSD1a. Such reduction in the transcription of these steroidogenic genes was also observed in similar reports and was correlated with Leyding cell apoptosis (Nna et al., 2019, ALTamimi et al., 2021). As ESA significantly reduced the transcription of Bax and caspase-3 and stimulated the levels of Bcl2 in the testes of diabetic rats alone but not those treated control rats, these data suggest that the anti-apoptotic effect of ESA is secondary to its antioxidant, hypolipidemic, and anti-inflammatory effects which act together to reduce the levels of ROS in these tissues. As a final notice, we have seen no improvements in the circulatory levels of FSH and LH treatment in control or diabetic rats co-treated with ESA. As discussed before, this is due to the inability of ESA to improve circulatory insulin levels. In addition, it could be possible that ESA is unable to penetrate the blood–brain barrier to inhibit hyperglycemia-mediated oxidative damage of the hypothalamus. This requires further examination to be confirmed. This makes us conclude that the observed increment in testosterone levels in the ESA-treated diabetic rats but not in the ESA-treated control rats is due to the inhibitory effect of ESA on Leydig cell apoptosis and its ability to prevent ROS-mediated oxidative damage.
In conclusion, the finding of this study is very interesting to indicate an Nrf2-dependent hypolipidemic, antioxidant, and anti-inflammatory protective effects of ESA against DM-mediated reproductive toxicity in STZ-treated male rats by activation of Nrf2. This may explain the previously reported results showing the protective effects of tomato extract, juice, and paste on testicular morphology and sperm parameters in diverse animal models. Therefore, we could conclude that continuous chronic administration of this newly discovered molecule could be an effective therapy to treat hypogonadism, impaired spermatogenesis, testicular damage, oligozoospermia, and alterations in sperm parameters, that leads to subfertility, not only in diabetic animals but also in other situations that affect reproductive function.
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgments
The authors are grateful to the Deanship of Scientific Research at Princess Nourah bint Abdulrahman University, Research Groups Program (no. RGP-1441-0032) (2). Also, the authors would like to thank Hussain Aldera and Mahmoud Alkhateeb for their help with this work.
Footnotes
Peer review under responsibility of King Saud University.
Contributor Information
Jozaa Z. AlTamimi, Email: jzaltamimi@pnu.edu.sa.
Nora A. AlFaris, Email: naalfaris@pnu.edu.sa.
Ghedeir M. Alshammari, Email: aghedeir@ksu.edu.sa.
Reham I. Alagal, Email: rialagal@pnu.edu.sa.
Dalal H. Aljabryn, Email: dhaljabryn@pnu.edu.
Mohammed Abdo Yahya, Email: mabdo@ksu.edu.sa.
References
- Aitken R.J., Gibb Z., Baker M.A., Drevet J., Gharagozloo P. Causes and consequences of oxidative stress in spermatozoa. Reprod. Fertil. Dev. 2016;28(1–2):1–10. doi: 10.1071/RD15325. [DOI] [PubMed] [Google Scholar]
- ALTamimi, J. Z., AlFaris, N. A., Aljabryn, D. H., Alagal, R. I., Alshammari, G. M., Aldera, H., Alqahtani, S., Yahya, M. A., 2021. Ellagic acid improved diabetes mellitus-induced testicular damage and sperm abnormalities by activation of Nrf2. Saudi J. Biol. Sci. 28(8), 4300–4310. Doi: 10.1016/j.sjbs.2021.04.005. [DOI] [PMC free article] [PubMed]
- Amaral S., Moreno A.J., Santos M.S., Seiça R., Ramalho-Santos J. Effects of hyperglycemia on sperm and testicular cells of Goto-Kakizaki and streptozotocin-treated rat models for diabetes. Theriogenology. 2006;66(9):2056–2067. doi: 10.1016/j.theriogenology.2006.06.006. [DOI] [PubMed] [Google Scholar]
- Arkali G., Aksakal M., Kaya Ş.Ö. Protective effects of carvacrol against diabetes-induced reproductive damage in male rats: Modulation of Nrf2/HO-1 signalling pathway and inhibition of Nf-kB-mediated testicular apoptosis and inflammation. Andrologia. 2021;53(2):e13899. doi: 10.1111/and.13899. [DOI] [PubMed] [Google Scholar]
- Banday M.Z., Sameer A.S., Nissar S. Pathophysiology of diabetes: An overview. Avicenna J. Med. 2020;10(4):174–188. doi: 10.4103/ajm.ajm_53_20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cao W., Aghajanian H.K., Haig-Ladewig L.A., Gerton G.L. Sorbitol can fuel mouse sperm motility and protein tyrosine phosphorylation via sorbitol dehydrogenase. Biol. Reprod. 2009;80(1):124–133. doi: 10.1095/biolreprod.108.068882. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Castela Â., Costa C. Molecular mechanisms associated with diabetic endothelial-erectile dysfunction. Nat. Rev. Urol. 2016;13(5):266–274. doi: 10.1038/nrurol.2016.23. [DOI] [PubMed] [Google Scholar]
- Chen Y., Jiao N., Jiang M., Liu L., Zhu Y., Wu H., Chen J., Fu Y., Du Q., Xu H., Sun J. Loganin alleviates testicular damage and germ cell apoptosis induced by AGEs upon diabetes mellitus by suppressing the RAGE/p38MAPK/NF-κB pathway. J. Cell Mol. Med. 2020;24(11):6083–6095. doi: 10.1111/jcmm.15198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Collins E.J., Bowyer C., Tsouza A., Chopra M. Tomatoes: An extensive review of the associated health impacts of tomatoes and factors that can affect their cultivation. Biology (Basel) 2022;11(2):239. doi: 10.3390/biology11020239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Condorelli, R. A., La Vignera, S., Mongioì, L. M., Alamo, A., Calogero, A. E., 2018. Diabetes Mellitus and Infertility: Different Pathophysiological Effects in Type 1 and Type 2 on Sperm Function. Front Endocrinol. (Lausanne). 9, 268. Doi: 10.3389/fendo.2018.00268. [DOI] [PMC free article] [PubMed]
- Deka H., Choudhury A., Dey B.K. An overview on plant derived phenolic compounds and their role in treatment and management of diabetes. J. Pharmacopunct. 2022;25(3):199–208. doi: 10.3831/KPI.2022.25.3.199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- du Plessis S.S., Agarwal A., Mohanty G., van der Linde M. Oxidative phosphorylation versus glycolysis: what fuel do spermatozoa use? Asian J. Androl. 2015;17(2):230–235. doi: 10.4103/1008-682X.135123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- ElBanna, A. H., Osman, A. S., Hossny, A., ElBanna, H., Abo El-Ela, F. I., 2023. Dose-dependent effects of taurine against testicular damage in a streptozotocin-induced type 1 diabetes mellitus rat model. Int. J. Immunopathol. Pharmacol. 37, 3946320231172745. Doi: 10.1177/03946320231172745. [DOI] [PMC free article] [PubMed]
- Ergün A., Köse S.K., Aydos K., Ata A., Avci A. Correlation of seminal parameters with serum lipid profile and sex hormones. Arch. Androl. 2007;53(1):21–23. doi: 10.1080/01485010600888961. [DOI] [PubMed] [Google Scholar]
- Fujiwara Y., Kiyota N., Hori M., Matsushita S., Iijima Y., Aoki K., Shibata D., Takeya M., Ikeda T., Nohara T., Nagai R. Esculeogenin A, a new tomato sapogenol, ameliorates hyperlipidemia and atherosclerosis in ApoE-deficient mice by inhibiting ACAT. Arterioscler. Thromb. Vasc. Biol. 2007;27(11):2400–2406. doi: 10.1161/ATVBAHA.107.147405. [DOI] [PubMed] [Google Scholar]
- Furman B.L. Streptozotocin-induced diabetic models in mice and rats. Curr. Protoc. 2021;1(4):e78. doi: 10.1002/cpz1.78. [DOI] [PubMed] [Google Scholar]
- Hamad Zubi Z.B., Hamad Alfarisi H.A. Hyperlipidemia and male infertility. Egypt. J. Basic Appl. Sci. 2021;8(1):385–396. [Google Scholar]
- Han X.X., Jiang Y.P., Liu N., Wu J., Yang J.M., Li Y.X., Sun M., Sun T., Zheng P., Jian-Qiang Y.u. Protective effects of Astragalin on spermatogenesis in streptozotocin-induced diabetes in male mice by improving antioxidant activity and inhibiting inflammation. Biomed. Pharmacother. 2019;110:561–570. doi: 10.1016/j.biopha.2018.12.012. [DOI] [PubMed] [Google Scholar]
- He, Z., Yin, G., Li, Q. Q., Zeng, Q., Duan, J., 2021. Diabetes Mellitus Causes Male Reproductive Dysfunction: A Review of the Evidence and Mechanisms. In vivo. 35(5), 2503–2511. Doi: 10.21873/invivo.12531. [DOI] [PMC free article] [PubMed]
- Ijaz M.U., Haider S., Tahir A., Afsar T., Almajwal A., Amor H., Razak S. Mechanistic insight into the protective effects of fisetin against arsenic-induced reproductive toxicity in male rats. Sci. Rep. 2023;13(1):3080. doi: 10.1038/s41598-023-30302-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Katsumata A., Kimura M., Saigo H., Aburaya K., Nakano M., Ikeda T., Fujiwara Y., Nagai R. Changes in esculeoside A content in different regions of the tomato fruit during maturation and heat processing. J. Agric. Food Chem. 2011;59:4104–4110. doi: 10.1021/jf104025p. [DOI] [PubMed] [Google Scholar]
- Kay H.Y., Kim W.D., Hwang S.J., Choi H.S., Gilroy R.K., Wan Y.J., Kim S.G. Nrf2 inhibits LXRα-dependent hepatic lipogenesis by competing with FXR for acetylase binding. Antioxid. Redox. Signal. 2011;15(8):2135–2146. doi: 10.1089/ars.2010.3834. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lobaccaro J.M.A., Brugnon F., Volle D.H., Baron S. Lipid metabolism and infertility: is there a link? Clin. Lipidol. 2012;7(5):485–488. [Google Scholar]
- MacLean J.A., 2nd, Hu Z., Welborn J.P., Song H.W., Rao M.K., Wayne C.M., Wilkinson M.F. The RHOX homeodomain proteins regulate the expression of insulin and other metabolic regulators in the testis. J. Biol. Chem. 2013;288(48):34809–34825. doi: 10.1074/jbc.M113.486340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maresch C.C., Stute D.C., Alves M.G., Oliveira P.F., de Kretser D.M., Linn T. Diabetes-induced hyperglycemia impairs male reproductive function: a systematic review. Hum. Reprod. Update. 2018;24(1):86–105. doi: 10.1093/humupd/dmx033. [DOI] [PubMed] [Google Scholar]
- Maresch C.C., Stute D.C., Fleming T., Lin J., Hammes H.P., Linn T. Hyperglycemia induces spermatogenic disruption via major pathways of diabetes pathogenesis. Sci. Rep. 2019;9(1):13074. doi: 10.1038/s41598-019-49600-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Matsumaru D., Motohashi H. The KEAP1-NRF2 system in healthy aging and longevity. Antioxidants. 2021;10(12):1929. doi: 10.3390/antiox10121929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McMahon M., Itoh K., Yamamoto M., Hayes J.D. Keap1-dependent proteasomal degradation of transcription factor Nrf2 contributes to the negative regulation of antioxidant response element-driven gene expression. J. Biol. Chem. 2003;278(24):21592–21600. doi: 10.1074/jbc.M300931200. [DOI] [PubMed] [Google Scholar]
- Nna V.U., Bakar A.B.A., Ahmad A., Mohamed M. Down-regulation of steroidogenesis-related genes and its accompanying fertility decline in streptozotocin-induced diabetic male rats: ameliorative effect of metformin. Andrology. 2019;7(1):110–123. doi: 10.1111/andr.12567. [DOI] [PubMed] [Google Scholar]
- Nna V.U., Bakar A.B.A., Ahmad A., Mohamed M. Diabetes-induced testicular oxidative stress, inflammation, and caspase-dependent apoptosis: the protective role of metformin. Arch. Physiol. Biochem. 2020;126(5):377–388. doi: 10.1080/13813455.2018.1543329. [DOI] [PubMed] [Google Scholar]
- Nna, V. U., Abu Bakar, A. B., Ahmad, A., Eleazu, C. OMohamed, M., 2019. Oxidative Stress, NF-κB-Mediated Inflammation and Apoptosis in the Testes of Streptozotocin-Induced Diabetic Rats: Combined Protective Effects of Malaysian Propolis and Metformin. Antioxidants (Basel, Switzerland). 8(10), 465. Doi: 10.3390/antiox8100465. [DOI] [PMC free article] [PubMed]
- Papatheodorou K., Banach M., Bekiari E., Rizzo M., Edmonds M. Complications of diabetes 2017. J. Diabetes Res. 2018;2018:3086167. doi: 10.1155/2018/3086167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qiu S., Liang Z., Wu Q., Wang M., Yang M., Chen C., Zheng H., Zhu Z., Li L., Yang G. Hepatic lipid accumulation induced by a high-fat diet is regulated by Nrf2 through multiple pathways. FASEB J.: Off. Publication Fed. Am. Soc. Experimental Biol. 2022;36(5):e22280. doi: 10.1096/fj.202101456R. [DOI] [PubMed] [Google Scholar]
- Rahali D., Dallagi Y., Hupkens E., Veegh G., Mc Entee K., Asmi M.E., El Fazaa S., El Golli N. Spermatogenesis and steroidogenesis disruption in a model of metabolic syndrome rats. Arch. Physiol. Biochem. 2023;129(1):222–232. doi: 10.1080/13813455.2020.1812665. [DOI] [PubMed] [Google Scholar]
- Rakhshandeh H., Rajabi Khasevan H., Saviano A., Mahdinezhad M.R., Baradaran Rahimi V., Ehtiati S., Etemad L., Ebrahimzadeh-Bideskan A., Maione F., Askari V.R. Protective effect of Portulaca oleracea on streptozotocin-induced type I diabetes-associated reproductive system dysfunction and inflammation. Molecules. 2022;27(18):6075. doi: 10.3390/molecules27186075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saeedan A.S., Soliman G.A., Abdel-Rahman R.F., Abd-Elsalam R.M., Ogaly H.A., Foudah A.I., Abdel-Kader M.S. Artemisia judaica L. diminishes diabetes-induced reproductive dysfunction in male rats via activation of Nrf2/HO-1-mediated antioxidant responses. Saudi J. Biol. Sci. 2021;28(3):1713–1722. doi: 10.1016/j.sjbs.2020.12.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saeedi, P., Petersohn, I., Salpea, P., Malanda, B., Karuranga, S., Unwin, N., Colagiuri, S., Guariguata, L., Motala, A. A., Ogurtsova, K., Shaw, J. E., Bright, D., Williams, R., & IDF Diabetes Atlas Committee., 2019. Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9th edition. Diabetes Res. Clin. Pract. 157, 107843. Doi: 10.1016/j.diabres.2019.107843. [DOI] [PubMed]
- Saez F., Drevet J.R. Dietary cholesterol and lipid overload: Impact on male fertility. Oxid. Med. Cell Longev. 2019;2019:4521786. doi: 10.1155/2019/4521786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Salawu E.O., Adeeyo O.A., Falokun O.P., Yusuf U.A., Oyerinde A., Adeleke A.A. Tomato (Lycopersicon esculentum) prevents lead-induced testicular toxicity. J. Hum. Reprod. Sci. 2009;2(1):30–34. doi: 10.4103/0974-1208.51346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Samir S.M., Elalfy M., Nashar E.M.E., Alghamdi M.A., Hamza E., Serria M.S., Elhadidy M.G. Cardamonin exerts a protective effect against autophagy and apoptosis in the testicles of diabetic male rats through the expression of Nrf2 via p62-mediated Keap-1 degradation. Korean J. Physiol. Pharmacol. 2021;25(4):341–354. doi: 10.4196/kjpp.2021.25.4.341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Septiani, R.A., Hamid, I.S., Sabdoningrum, E.K., Ma’ruf, A., Hestianah, E.P. and Mafruchati, M., 2022. Tomato (Lycopersicon esculentum Mill.) juice restored the number of Leydig cells, and the diameter of the seminiferous tubules of mice (Mus musculus) exposed to lead acetate. Anim. Reprod. Sci. 11: 123-129.
- Shokri A., Pourheydar B., Hossein Farjah G., Krimipour M., Pourheydar M. Effects of glibenclamide and troxerutin on the sperm parameters and histopathological changes of testis in streptozotocin-induced diabetic male rats: An experimental study. Int. J. Reprod. Biomed. 2023;21(2):123–138. doi: 10.18502/ijrm.v21i2.12803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shukla K.K., Mahdi A.A., Rajender S. Apoptosis, spermatogenesis and male infertility. Front. Biosci. (Elite Ed.) 2012;4(2):746–754. doi: 10.2741/415. [DOI] [PubMed] [Google Scholar]
- Simas J.N., Mendes T.B., Paccola C.C., Vendramini V., Miraglia S.M. Resveratrol attenuates reproductive alterations in type 1 diabetes-induced rats. Int. J. Exp. Pathol. 2017;98(6):312–328. doi: 10.1111/iep.12251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sliwowska J.H., Fergani C., Gawałek M., Skowronska B., Fichna P., Lehman M.N. Insulin: its role in the central control of reproduction. Physiol. Behav. 2014;133:197–206. doi: 10.1016/j.physbeh.2014.05.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Song J., Gao X., Tang Z., Li H., Ruan Y., Liu Z., Wang T., Wang S., Liu J., Jiang H. Protective effect of Berberine on reproductive function and spermatogenesis in diabetic rats via inhibition of ROS/JAK2/NFκB pathway. Andrology. 2020;8(3):793–806. doi: 10.1111/andr.12764. [DOI] [PubMed] [Google Scholar]
- Vitale I., Pietrocola F., Guilbaud E., Aaronson S.A., Abrams J.M., Adam D., Agostini M., Agostinis P., Alnemri E.S., Altucci L., Amelio I., Andrews D.W., Aqeilan R.I., Arama E., Baehrecke E.H., Balachandran S., Bano D., Barlev N.A., Bartek J., Bazan N.G., Galluzzi L. Apoptotic cell death in disease-Current understanding of the NCCD 2023. Cell Death Differ. 2023;30(5):1097–1154. doi: 10.1038/s41418-023-01153-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Volpe C.M.O., Villar-Delfino P.H., Dos Anjos P.M.F., Nogueira-Machado J.A. Cellular death, reactive oxygen species (ROS) and diabetic complications. Cell Death Dis. 2018;9(2):119. doi: 10.1038/s41419-017-0135-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wardyn J.D., Ponsford A.H., Sanderson C.M. Dissecting molecular cross-talk between Nrf2 and NF-κB response pathways. Biochem. Soc. Trans. 2015;43(4):621–626. doi: 10.1042/BST20150014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang Z., Zhang L., Liu J., Lu F., Wang L., Chen Y., Li D. Hypoglycemic effects of esculeoside A are mediated via activation of AMPK and upregulation of IRS-1. BMC Complement. Altern. Med. 2019;19(1):136. doi: 10.1186/s12906-019-2543-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou J.R., Kanda Y., Tanaka A., Manabe H., Nohara T., Yokomizo K. Anti-hyaluronidase activity in vitro and amelioration of mouse experimental dermatitis by Tomato Saponin. Esculeoside A. J. Agric. Food Chem. 2016;64(2):403–408. doi: 10.1021/acs.jafc.5b05320. [DOI] [PubMed] [Google Scholar]
- Zhou J.R., Yamada R., Huruiti E., Kitahara N., Nakamura H., Fang J., Nohara T., Yokomizo K. Ripe tomato Saponin Esculeoside A and Sapogenol Esculeogenin A suppress CD4+ T lymphocyte activation by modulation of Th2/Th1/Treg differentiation. Nutrients. 2022;14(10):2021. doi: 10.3390/nu14102021. [DOI] [PMC free article] [PubMed] [Google Scholar]
Further reading
- Wu J., Sun X., Jiang Z., Jiang J., Xu L., Tian A., Sun X., Meng H., Li Y., Huang W., Jia Y., Wu H. Protective role of NRF2 in macrovascular complications of diabetes. J. Cell Mol. Med. 2020;24(16):8903–8917. doi: 10.1111/jcmm.15583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kocak, A., Ural, C., Harmanci, D., Oktan, M. A., Afagh, A., Sarioglu, S Yilmaz, O., Birlik, M., Akdogan, G.G. and Cavdar, Z., 2022. Protective effects of alpha-lipoic acid on bleomycin-induced skin fibrosis through the repression of NADPH Oxidase 4 and TGF-β1/Smad3 signaling pathways. Hum. Exp. Toxicol. 41, 09603271211065975. Doi: 10.1177/09603271211065975. [DOI] [PubMed]





