Skip to main content
NCBI home page
Environmental Microbiology Reports logoLink to Environmental Microbiology Reports
. 2023 May 16;15(5):370–382. doi: 10.1111/1758-2229.13169

Transinfected Wolbachia strains induce a complex of cytoplasmic incompatibility phenotypes: Roles of CI factor genes

Jing Li 1, Bei Dong 2, Yong Zhong 3, Zheng‐Xi Li 1,✉
PMCID: PMC10472523  PMID: 37194361

Abstract

Wolbachia can modulate the reproductive development of their hosts in multiple modes, and cytoplasmic incompatibility (CI) is the most well‐studied phenotype. The whitefly Bemisia tabaci is highly receptive to different Wolbachia strains: wCcep strain from the rice moth Corcyra cephalonica and wMel strain from the fruit fly Drosophila melanogaster could successfully establish and induce CI in transinfected whiteflies. Nevertheless, it is unknown what will happen when these two exogenous Wolbachia strains are co‐transinfected into a new host. Here, we artificially transinferred wCcep and wMel into the whitefly and established double‐ and singly‐transinfected B. tabaci isofemale lines. Reciprocal crossing experiments showed that wCcep and wMel induced a complex of CI phenotypes in the recipient host, including unidirectional and bidirectional CI. We next sequenced the whole genome of wCcep and performed a comparative analysis of the CI factor genes between wCcep and wMel, indicating that their cif genes were phylogenetically and structurally divergent, which can explain the crossing results. The amino acid sequence identity and structural features of Cif proteins may be useful parameters for predicting their function. Structural comparisons between CifA and CifB provide valuable clues for explaining the induction or rescue of CI observed in crossing experiments between transinfected hosts.

INTRODUCTION

Wolbachia as maternally inherited obligate intracellular endosymbionts are widespread in terrestrial arthropods (Pannebakker et al., 2007; Saridaki & Bourtzis, 2010; Zug & Hammerstein, 2012). Wolbachia induce multiple reproductive manipulations in their hosts (Ant et al., 2018; Gong et al., 2020; Kambris et al., 2009; O'Neill et al., 1997; Pan et al., 2012; Zug & Hammerstein, 2015), which can be used for biocontrol of crop pests and blocking virus transmission (Bourtzis, 2008; Rio et al., 2006; Sinkins & Gould, 2006; Zabalou et al., 2004).

Cytoplasmic incompatibility (CI) is the most widely studied phenotype induced by Wolbachia: uninfected females are sterilised by males infected with a Wolbachia strain (unidirectional CI), but the females infected with the same strain will be rescued (Werren et al., 2008). Insects infected with different Wolbachia strains may display unidirectional or bidirectional CI. Embryonic lethality induced by either strain in males cannot be rescued by the other strain in females (bidirectional CI), forming a reproductive barrier between insect hosts (Brucker & Bordenstein, 2012).

The CI factors (Cifs), including cifA and cifB, are involved in CI induction and rescue in host insects (Beckmann et al., 2017; Chen et al., 2019; LePage et al., 2017; Shropshire et al., 2018). Transgenic expression of both cifA and cifB genes, or cifB alone, in the germline of male hosts induced sterility that is highly similar to CI induced by Wolbachia (Adams et al., 2021; Beckmann et al., 2017; LePage et al., 2017; Shropshire & Bordenstein, 2019; Sun et al., 2022). This embryonic lethality could be rescued by crossing transgenic males with Wolbachia‐infected females or those with a transgenic cifA gene expressed in the germline (Chen et al., 2019; Shropshire et al., 2018). Recent studies have found that the cif genes from bidirectional CI‐inducing Wolbachia pairs were highly divergent, with only 29%–68% amino acid identity (LePage et al., 2017). These results were supported by transgenic research using cif genes of wMel, wRi, and wRec from D. melanogaster, D. simulans, and D. recens (Shropshire et al., 2021). The cifA and cifB genes are co‐divergent (Bonneau et al., 2018; LePage et al., 2017; Lindsey et al., 2018), and have been proposed to account at least in part for bidirectional incompatibility probably by modulating CifA‐CifB binding (Beckmann et al., 2017; Chen et al., 2019).

Wolbachia co‐infections are common in arthropods (Funkhouser‐Jones et al., 2015; Łukasik et al., 2013; Machtelinckx et al., 2012; Moutailler et al., 2016; Nguyen et al., 2017; Wamwiri et al., 2013; Zhang et al., 2016; Zytynska & Weisser, 2016), although phenotypic effects of co‐infections are multifarious. Some studies found an enhanced effect or a novel phenotype in co‐infections (Jamnongluk et al., 2002; Kondo et al., 2002; Mouton et al., 2004). For example, in Cadra cautella, dual infection with Supergroup A and B Wolbachia strains induced complete CI, whereas in Ephestia kuehniella, single infection with Supergroup A exhibited only partial CI (Sasaki et al., 2005). In the two‐spotted spider mite Tetranychus urticae, Wolbachia infection alone induced weak CI, while double‐infected males with Wolbachia and Cardinium caused strong CI (Xie et al., 2016). In natural populations of the butterfly Eurema hecabe, individuals singly infected with wHecCI exhibited strong CI, but double‐infected individuals with wHecCI and wHecFem displayed a phenotype of feminization (Narita et al., 2007).

Bemisia tabaci (Hemiptera: Aleyrodidae) is a polyphagous agricultural pest feeds on more than 60 plant species and is a devastating pest insect worldwide. The unfertilised eggs of B. tabaci, a haplodiploid species, develop into male offspring, and thus CI can induce a male‐biased offspring sex ratio (Hu & Li, 2015). Our previous studies have shown that it is highly receptive to Wolbachia infection: the Wolbachia wCcep strain from the rice moth Corcyra cephalonica and the wMel strain from the fruit fly D. melanogaster could successfully establish and induce CI in B. tabaci, which has implications for biological control of pest insects based on Wolbachia‐induced CI. Here, we established a stable double‐transinfected (DT) isofemale line of B. tabaci with wCcep and wMel. Our purpose was to use this model to examine the CI phenotypes induced by co‐infecting Wolbachia strains, and further explore the molecular mechanism underlying CI induction. Our results found that DT Wolbachia strains can induce a complex of CI phenotypes, including unidirectional and bidirectional CI, which is consistent with genomic analysis based on cif genes. Furthermore, our data provide valuable clues for explaining the induction or rescue of CI observed in crossing experiments using host insects transinfected with different Wolbachia strains.

RESULTS

Establishment of transinfected B. tabaci isofemale lines and trans‐generational maintenance

Fifteen (five DT and 10 singly‐transinfected [ST]) transinfected B. tabaci isofemale lines were established, which were trans‐generationally maintained for 10 generations from G1 to G10. As detected by polymerase chain reaction (PCR) using the ftsZ primers specific to Supergroup A and B Wolbachia, the individuals collected from G3 to G10 tested positive for both wMel and wCcep. In addition, a strong signal for wMel and wCcep was detected in the individuals from G6 and G10 in a stable manner, although no signal was detected in the individuals from G1 and G2 (Figure 1A,B). In ST isolines, wMel or wCcep was detected in the individuals collected from G3 to G10 (Figure 1C,D).

FIGURE 1.

FIGURE 1

Open in a new tab

PCR detection of transinfected B. tabaci whitefly isolines from G0 to G10 using the primers targeting ftsZ of Supergroup A and B Wolbachia. (A) ftsZ primer pair Adf/Adr targeting Supergroup A Wolbachia in double‐transinfected (DT) individuals. Lane 1: positive control (D. malanogaster adult infected with wMel); lane 2: negative control (wild‐type B. tabaci); lane 3–13: B. tabaci individuals collected from G0 to G10, respectively. (B) ftsZ primer pair Bf/Br targeting Supergroup B Wolbachia in DT individuals. Lane 1: positive control (C. cephalonica adult infected with wCcep); lane 2: negative control (wild‐type B. tabaci); lane 3–13: B. tabaci individuals collected from G0 to G10, respectively. (C) ftsZ primer pair Adf/Adr targeting Supergroup A Wolbachia in wMel singly‐transinfected (ST) individuals. Lane 1: positive control; lane 2: negative control; lane 3–13: B. tabaci individuals collected from G0 to G10, respectively. (D) ftsZ primer pair Bf/Br targeting Supergroup B Wolbachia in wCcep ST individuals. Lane 1: positive control; lane 2: negative control; lane 3–13: B. tabaci individuals collected from G0 to G10, respectively. M, DNA molecular marker.

Crossing experiments and CI phenotypes

We performed a total of nine groups of crossing experiments. The results showed that there was no significant difference in the number of offspring per female among different crossing groups (Student–Newman–Keuls [SNK], F = 0.686, p = 0.703), while the percentages of males produced among crossing groups were significantly different (SNK, F = 241.295, p < 0.001; Table 1). Specifically, there was a very high percentage of males (97.4%–100%) in wC‐ST♀ × wM‐ST♂, wM‐ST♀ × wC‐ST♂, wM‐ST♀ × wMC‐DT♂, wC‐ST♀ × wMC‐DT♂, WT♀ × wM‐ST♂, WT♀ × wC‐ST♂ and WT♀ × wMC‐DT♂, representing a high level of CI. Among them, the two crossing groups wC‐ST♀ × wM‐ST♂ and wM‐ST♀ × wC‐ST♂ showed typical bidirectional CI phenotype, in which the male and female were ST with different Wolbachia strains and the reproductive anomaly caused by CI induced by one strain cannot be rescued by the other strain. In contrast, the crossing groups WT♀ × wM‐ST♂, WT♀ × wC‐ST♂ and WT♀ × wMC‐DT♂ exhibited unidirectional CI phenotype (Figure 2).

TABLE 1.

Crossing experiments between double‐transinfected, singly‐transinfected and wild‐type B. tabaci whiteflies.

Crossing (♀ × ♂) No. of crosses No. of progenies Percentage of males (%)
WT × WT 10 14.6 ± 3.14a 54.7 ± 3.98c
wMC‐DT × wMC‐DT 10 13.5 ± 2.52a 58.8 ± 2.72b
wC‐ST × wM‐ST 10 15.4 ± 4.33a 98.7 ± 2.36a
wM‐ST × wC‐ST 10 14.8 ± 3.45a 100 ± 0.00a
wM‐ST × wMC‐DT 10 11.0 ± 2.75a 100 ± 0.00a
wC‐ST × wMC‐DT 11 13.9 ± 3.12a 97.4 ± 2.96a
WT × wM‐ST 13 12.5 ± 3.59a 99.6 ± 0.80a
WT × wC‐ST 10 14.5 ± 2.16a 98.0 ± 2.50a
WT × wMC‐DT 11 13.1 ± 2.55a 100 ± 0.00a
Open in a new tab

Note: Data are means ± SE of three biological replicates. Different lowercase letters in the same column indicate significant difference based on One‐way ANOVA followed by Student–Newman–Keuls test (p < 0.05).

FIGURE 2.

FIGURE 2

Open in a new tab

Crossing experiments between double‐transinfected (DT), singly‐transinfected (ST) and wild‐type B. tabaci whiteflies. A total of nine groups of crossings are performed. WT, wild‐type; wMC‐DT, DT with wMel and wCcep; wC‐ST, ST with wCcep; wM‐ST, singly‐transinfected with wMel. The means are indicated by vertical lines.

Genome sequence of wCcep

The complete circular genome of wCcep was assembled using long‐read PacBio sequencing at 500× median coverage (GenBank acc.no. CP087954; Figure S1). The total length of wCcep genome was 1,359,904 bp, with an average GC content of 34.0%, within the range of a typical Wolbachia genome (31.7%–38.3%). Annotation of the genome identified 1278 CDSs, 1190 protein‐coding genes, 34 tRNA genes that can transfer all 20 amino acids, three rRNA (5S, 16S and 23S rRNA) genes, and one sRNA gene (Table 2). Phylogenetic analysis based on Wolbachia genome sequences confirmed that wCcep belonged to Supergroup B (Figure S2; Table S1).

TABLE 2.

Genome statistics of Wolbachia wCcep strain (host: C. cephalonica).

Number
Genome size 1,381,880
Total no. of nucleotides (bp) 1,359,904
GC content (%) 34.0
No. of proteins 1190
No. of CDSs 1278
No. of tRNAs 34
No. of rRNAs 3
No. of sRNA 1
Average gene length 1047.7
Open in a new tab

Identification of cif genes in w Ccep and phylogenetic analysis

Genomic analysis identified five cif genes in the wCcep genome, including cifA1 (GenBank acc. no. OP767524), cifB1 (GenBank acc. no. OL539522), cifA2 (GenBank acc. no. OP767525), cifB2 (GenBank acc. no. OP767526) and an incomplete cifA. Phylogenetic analysis using the four Cif proteins of wCcep and reference Cifs showed that CifA1 wCcep and CifA wMel were clustered in a clade belonging to Type I CifA, and CifA2 wCcep was clustered in a clade belonging to CifA Type IV (Martinez et al., 2021; Figure 3A). CifB1 wCcep and CifB wMel were clustered in a clade of Type I CifB, while CifB2 wCcep was grouped in Type IV CifB (Figure 3B).

FIGURE 3.

FIGURE 3

Open in a new tab

Phylogenetic analysis of CIF proteins using maximum likelihood method on MEGA 7.1. The CIF proteins used in the analysis are listed in Table S2. (A) CifA. (B) CifB. The CIF proteins of wCcep are indicated by solid squares, and those of wMel by solid stars.

Structural comparison of CIF proteins between wCcep and wMel

Structural prediction revealed the putative domains of CIF proteins. There was variation only in the length of domains between CifA I wCcep and CifA I wMel, and between CifB I wCcep and CifB I wMel (Figure 4A,C), while substantial structural differentiation was observed between CifA I and CifA IV, and between CifB I and CifB IV (Figure 4B,D). CifA I contained a putative catalase‐related (catalase‐rel) domain, a domain that shares homology with Puf family RNA‐binding proteins and a sterile‐like transcription factor (STE) domain (Figure 4A), whereas CifA IV contained a longer Puf domain but no catalase‐rel domain (Figure 4B). In contrast, CifB I contained two PD‐(D/E)XK superfamily of nucleases domains and a Ulp1 ubiquitin protease module with deubiquitylase (DUB) activity (Figure 4C), but CifB IV contained no Ulp1 domain (Figure 4D).

FIGURE 4.

FIGURE 4

Open in a new tab

Comparisons of the organisations and domains of CIF proteins between wMel and wCcep. (A) CifA I wCcep and CifA I wMel; (B) CifA IV wCcep and CifA I wMel; (C) CifB I wCcep and CifB I wMel; (D) CifB IV wCcep and CifB I wMel. The domains include a putative catalase‐related (catalase‐rel) domain (gold), a domain sharing homology with Puf family RNA‐binding proteins (green), a sterile‐like transcription factor (STE) domain (brown), a Ulp1 deubiquitinase module (indigo blue), and a PDDEXK nuclease domain (dark brown). The numbers indicate the start and stop positions of each domain.

Comparison of the tertiary structures of CIF proteins between wCcep and wMel

The tertiary structures of CIF proteins were generated by AlphaFold. The confidence of the structures was evaluated by Local Distance Difference Test (lDDT; Figure S3). The results showed that the lDDT scores of all of the six Cif proteins of wCcep and wMel ranged between 68.4 and 84.0, suggesting a confident structural prediction based on the full‐length sequences using the AlphaFold programme, except for CifB I wMel containing a DUB domain with a low predicted mass (Table 3; Figure S4). Only two PD‐(D/E)XK‐nuclease domains of CifB were analysed because they were shared across all types of Cif proteins (Shropshire et al., 2022), and it was difficult to make a direct determination of the structure of CifB wMel because its expression in Escherichia coli was poor (Wang et al., 2022). To evaluate the similarity between the tertiary structures of CIF proteins, the template modelling (TM) scores were calculated (Xu & Zhang, 2010). The results showed that the TM score between CifA I wCcep and CifA I wMel was 0.86, while they shared an amino acid sequence identity (AA identity) of 67.1%; the TM score between CifB I wCcep and CifB I wMel was 0.63, while shared an AA identity of 57.3%. Although CifA IV wCcep and CifA I wMel shared an AA identity of only 26.3%, the TM score between them was 0.76. The TM score between CifB IV wCcep and CifB I wMel was 0.66, but they shared an AA identity of only 20.3% (Table 4; Figure 5).

TABLE 3.

Alphafold structural confidence of CIF proteins.

Protein Length Mean lDDT ± SD a
CifA I wCcep 475 81.1 ± 0.79
CifA I wMel 474 82.0 ± 0.83
CifA IV wCcep 445 84.0 ± 1.42
CifB I wCcep 1107 71.9 ± 1.90
CifB I wMel 1166 68.4 ± 2.47
CifB IV wCcep 732 82.1 ± 1.17
Open in a new tab
a

lDDT scores range from 0 to 100: lDDT > 90, high confidence; 90 > lDDT > 70, confident; 70 > lDDT > 50, low confidence, and lDDT < 50, very low confidence.

TABLE 4.

TM‐scores of CIF proteins.

AA identity% TM score CifA I wCcep CifA I wMel CifA IV wCcep CifB I wCcep CifB I wMel CifB IV wCcep
CifA I wCcep – 67.1 – – – –
CifA I wMel 0.86 – 26.3 – – –
CifA IV wCcep – 0.76 – – – –
CifB I wCcep – – – – 57.3 –
CifB I wMel – – – 0.63 – 20.3
CifB IV wCcep – – – – 0.66 –
Open in a new tab

Note: AA identities are shown above the diagonal. TM‐scores are shown below the diagonal. TM‐scores are calculated by the Zhanglab Server and range from 0 to 1: TM > 0.5, a very similar fold; 0.5 > TM > 0.17, significant similarity and TM < 0.17, random structural similarity.

FIGURE 5.

FIGURE 5

Open in a new tab

Overlapping CIF proteins of wMel and wCcep generated by Alphafold programme. (A) Overlapped CifA I wCcep and CifA I wMel; (B) Overlapped CifA IV wCcep and CifA I wMel; (C) Overlapped CifB I wCcep and CifB I wMel; (D) Overlapped CifB IV wCcep and CifB I wMel. The domains include a putative catalase‐related (catalase‐rel) domain (grey), a domain sharing homology with Puf family RNA‐binding proteins (green), a sterile‐like transcription factor (STE) domain (brown), a Ulp1 deubiquitinase module (gold), and a PDDEXK nuclease domain (light grey).

CifAI wCcep binds CifBI wCcep through a large distinct interface

A model for the CifA I wCcep‐CifB I wCcep 2ND complex was built by using AlphaFold‐Multimer (Figure 6A). CifB I wCcep 2ND comprised residues 1 through 752, which was predicted to contain two PD‐(D/E)XK (pseudo) nuclease domains. The obtained end‐to‐end model was further optimised by molecular dynamics (MD) simulations. The trajectories were performed and achieved equilibrium within 100 ns. The root mean square deviation (RMSD) for one of the simulation trajectories was recorded (Figure S5A). The complex also predicted many hydrogen bonds and salt bridges between CifA I wCcep and CifB I wCcep 2ND at the three interfaces (Figure 6B–E) and only 0.46% of the residues were Ramachandran outliers (Figure S5B), demonstrating that the side chains of the predicted model have been reliably predicted and thus the complex of CifA I wCcep‐CifB I wCcep 2ND is reasonable.

FIGURE 6.

FIGURE 6

Open in a new tab

Interaction between CifA and CifB proteins through a large conserved tripartite interface. (A) A structural model of CifA I wCcep in complex with CifB I wCcep 2ND generated by AlphaFold‐Multimer. CifA I wCcep binds to CifB I wCcep 2ND through three regions shown in green, pink and cyan for Interface I, II and III, respectively. (B–E) Each interface of the CifA I wCcep‐ CifB I wCcep 2ND complex involves a pair of structural motifs. Representative residues directly involved in the interaction are labelled and tabulated. 2ND, two PD‐(D/E)XK nuclease domains.

The interface between CifA I wCcep and CifB I wCcep 2ND was divided into three regions (Figure 6A), and each region mainly involves one pair of structural motifs. In the first region (Interface I), the helices consisting of the residues 38–143 of CifA I wCcep interact with a loop in CifB I wCcep 2ND (residues 402–425) through a network of hydrogen bonds (Figure 6B). At interface I, three residues (ASN144, ARG108 and THR140) from CifA I wCcep interact with the residues from CifB I wCcep 2ND (GLN452, GLY455 and GLU458; Figure 6B). Interface II is located between the helices from CifA I wCcep (residues 38–43) and CifB I wCcep 2ND (residues 399–402), and the residues (GLU37, HIS38 and Lys43) from CifA I wCcep interact with the residues from CifB I wCcep 2ND (ASN409, GLU399 and GLU402) through a network of four hydrogen bonds and two salt bridges (Figure 6C). Interface III involves CifA I wCcep (residues 208, 242–249, 289–297, 337 and 392–398) and a cross‐cutting helix (residues 244–254, 377–382) in CifB I wCcep 2ND to stabilise the interaction. Multiple residues interact between CifA I wCcep and CifB I wCcep 2ND and there are 12 hydrogen bonds and six salt bridges at Interface III (Figure 6D,E).

DISCUSSION

We established stable double‐ and ST B. tabaci isofemale lines with wMel and wCcep. These isolines were used for reciprocal crossing experiments, showing that a complex of CI phenotypes was induced, including unidirectional and bidirectional CI. B. tabaci is a haplodiploid species, and it is capable of laying haploid eggs that develop into males (arrhenotokous parthenogenesis) when CI is induced (Hu & Li, 2015; Zhou & Li, 2016). A high male‐biased offspring sex ratio indicates a high CI level. Here, the percentages of males produced in the crossing groups wC‐ST♀ × wM‐ST♂, wM‐ST♀ × wC‐ST♂, wM‐ST♀ × wMC‐DT♂, wC‐ST♀ × wMC‐DT♂, WT♀ × wM‐ST♂, WT♀ × wC‐ST♂ and WT♀ × wMC‐DT♂ were 100% or nearly 100%, indicating that a complete or nearly complete CI had been induced in these crossings. As expected, no CI phenotype was observed in wMC‐DT♀ × wMC‐DT♂, which might have been restored through what is usually called “the rescue (resc) function” in the eggs infected with the same Wolbachia strains. In wC‐ST♀ × wM‐ST♂ and wM‐ST♀ × wC‐ST♂, the male and female were ST with different Wolbachia strains and the reproductive anomaly caused by CI induced by one strain cannot be rescued by the other strain, which represents a typical bidirectional CI phenotype. In contrast, the crossing groups WT♀ × wM‐ST♂, WT♀ × wC‐ST♂ and WT♀ × wMC‐DT♂ exhibited unidirectional CI phenotype, in which transinfected males induced CI in wild‐type females.

It has been shown that the Cifs (CifA and CifB) were determinants for CI induction and rescue (Adams et al., 2021; Shropshire & Bordenstein, 2019; Sun et al., 2022), and the expression of CifA in female was sufficient for rescuing CI (Shropshire et al., 2018). We, therefore, sequenced the whole genome of wCcep, identifying two cifA and two cifB genes. In contrast, the genome of wMel contained only one cifA and one cifB (Wu et al., 2004). Crossing experiments showed that both wCcep and wMel are CI‐inducing Wolbachia strains, and the strength of CI induced by wCcep (WT × wC‐ST) was not significantly different from that by wMel (WT × wM‐ST; Table 1). It seems that the higher copy number of cif genes in wCcep cannot significantly differentiate it from wMel in CI induction. Similarly, the strength of CI induced by DT males is not significantly different from that by ST males, although the CI phenotype induced by double transinfection is more stable than single transinfections.

Previous studies showed that the amino acid similarity between CifA proteins influenced the rescue of CI phenotype. The rescue happened only when the cif genes were closely related between different Wolbachia strains (Bonneau et al., 2018; LePage et al., 2017; Shropshire et al., 2018). For instance, wRi could rescue wMel‐induced CI in a homozygous cross, because the amino acid sequences of their CifA proteins were nearly identical (99% AA identity) (Shropshire et al., 2021). In contrast, wHa could not rescue CI induced by wMel, and vice versa, because the AA identity between their CifA proteins was only 67% (LePage et al., 2017). In our study, the AA identities between CifA I wCcep and CifA I wMel and between CifB I wCcep and CifB I wMel were 67.1% and 57.3%, respectively. The divergence of Cif proteins between wCcep and wMel can explain the bidirectional CI observed in wC‐ST♀ × wM‐ST♂ and wM‐ST♀ × wC‐ST♂, in which CI induced by one strain cannot be rescued by the other. It is noteworthy that the AA identities between CifA IV wCcep and CifA I wMel and between CifB IV wCcep and CifB I wMel were only 26.3% and 20.3%, respectively. The substantial divergence between these Cif proteins may enhance the incompatibility between the two Wolbachia strains.

Structural comparisons of Cif proteins between wCcep and wMel revealed that CifA I and CifB I proteins of wCcep and wMel are structurally similar, containing common domains of CIF proteins. However, substantial structural variation was observed in CifA IV and CifB IV of wCcep, with some missing domains (Figure 4). It is still unknown whether they are functionally incompetent or not before further functional studies are carried out. Interestingly, a comparison of the tertiary structures of Cif proteins between wCcep and wMel resulted in a high TM score (0.86) between CifA I wCcep and CifA I wMel, whereas a moderate TM score (0.63) was obtained between CifB I wCcep and CifB I wMel, even lower than the TM scores between CifA IV wCcep and CifA IV wMel (0.76) and between CifB IV wCcep and CifB IV wMel (0.66). Crossing experiments using transgenic models are needed for functional verification of these cif genes.

Previous studies suggested that the interfacial residues of the CifA‐CifB complex that simulated CifA‐CifB binding in the female were essential for the rescue of CI in transgenic D. melanogaster (Wang et al., 2022; Xiao et al., 2021). In this study, CifA I wCcep‐CifB I wCcep 2ND complex (except for the DUB domain) built by homology modelling is very similar to the structure of CidA wMel‐CidB wMel ND1‐ND2 complex in which CidA binding does not block the DUB domain of CidB catalytic activity (Beckmann et al., 2017). Both of two complexes form three binding sites in similar positions. Interestingly, the residues involved in the interactions at the three interfaces are very different between the both complexes (Wang et al., 2022; Figure 2C–E), which helps explain their cognate‐specific binding.

In summary, we established stable transinfected B. tabaci isofemale lines. Successful establishment of DT isolines demonstrated that wCcep and wMel can co‐exist in the same recipient host, confirming that B. tabaci is highly receptive to Wolbachia infection. This research model is useful for deciphering the molecular mechanisms underlying CI induction by Wolbachia. We performed a series of crossing experiments using these transinfected isolines, and a complex of CI phenotypes were induced. We therefore sequenced the whole genome of wCcep and identified four Cif genes in its genome. Comparative analysis revealed that the CI phenotypes induced by wCcep and wMel can be explained by the divergence between their cif genes. Our study confirmed that the amino acid sequence identity is an important parameter for defining CI phenotypes. Nonetheless, structural comparisons in terms of the interfacial residues in the binding regions of the CifA‐CifB complex can provide valuable clues for explaining the induction or rescue of CI observed in crossing experiments using host insects transinfected with different Wolbachia strains.

EXPERIMENTAL PROCEDURES

Insect rearing and Wolbachia isolation

B. tabaci was reared on the cotton plants in an artificial climate incubator (GXZ‐280C, Jiangnan, China) under a photoperiod of L14:D10 at 28°C and 60%–80% RH. D. melanogaster infected with wMel was maintained on Maize–Agarose–Yeast medium (25°C, 60%–70% 100 RH and 14L:10D). The rice moth C. cephalonica infected with wCcep was maintained on the maize‐rice bran‐sugar medium (25°C, 65% ± 1 RH and 14L:10D). The wMel and wCcep strains were isolated from the hosts using the Percoll density‐gradient centrifugation method (Zhou & Li, 2016). The purified bacterial extract was detected by PCR using the primers 81F/691R and 81F/522R targeting wsp (Wolbachia surface protein) of Supergroup A and B Wolbachia (wsp81F: 5′‐TGG TCCAATAAGTGATGAAGAAAC‐3′, wsp522R: 5′‐ACCAGCTTTTGCTTGATA‐3′ and wsp691R: 5′‐AAAAATTAAACGCTACTCCA‐3′; Zhou et al., 1998).

Transinfection and establishment of double‐ and ST isofemale lines of B. tabaci with wMel and wCcep Wolbachia strains

A volume of 46 nL bacterial suspensions of wCcep and wMel (1:1) in SPG buffer (220 mM sucrose, 4 mM KH2PO4, 9 mM Na2HPO4, 5 mM l‐glutamate, pH 7.4) were injected separately into the fourth‐instar nymph (pseudopupa) of B. tabaci placed in a petri dish (Φ 9 cm) covered with 10% agar on the platform of Nanoliter 2000 (World Precision Instruments, Sarasota, Florida, USA). The pupa was then placed in a climate incubator until adult emergence after injection (25°C, 65% ± 1 RH and 14L:10D). The newly emerged adults were separately maintained on potted cotton plants in pairs (♀/♂; G0), and the offspring (G1) from the pairs tested positive for Wolbachia was kept for establishing isofemale lines. For establishing ST isofemale lines, the wCcep strain or wMel strain was used for transinfection following the same procedures.

Trans‐generational maintenance of transinfected isolines

The established DT and single‐transinfected (ST) B. tabaci isofemale lines (G1), were trans‐generationally maintained for generations. The offspring of DT and ST whiteflies was detected at each generation for the presence of wCcep and wMel by PCR using the primers targeting the ftsZ gene of Wolbachia. The wMel and wCcep strains, belonging to Supergroup A and B (Hu & Li, 2015), respectively, can be discriminated by their ftsZ sequences (Werren et al., 1995). Total genomic DNAs were extracted from DT whiteflies using the KAc method as described (Zhong & Li, 2014). The primers for detecting wMel were as followed: Forward Adf: 5′‐CTCAAGCACTAGAAAAGTCG‐3′; reverse Adr: 5′‐TTAGCTCCTTCGCTTACC TG‐3′; for wCcep, Bf: 5′‐CCGATGCTCAAGCGTTAGAG‐3′; Br 5′‐CCACTTAACT CTTTCGTTTG‐3′ (Werren et al., 1995). PCR was performed in a final reaction volume of 25 μL, including 2 μL of gDNA, 0.2 μL of Taq DNA polymerase, 1 μL each of 10 μM forward and reverse primers, 2.5 μL of 10 × EasyTaq Buffer, and 2.5 μL of 10 μM dNTPs, on an Applied Biosystems Veriti thermal cycler. The PCR cycling programme consisted of 94°C for 2 min, 40 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 2 min, and a final extension for 10 min at 72°C. PCR products were detected by 1% agarose gel electrophoresis (1 × TAE).

Crossing experiments

Two‐day‐old adult male and female whiteflies collected from the 6th–8th generation (G6–G8) were used for crossing experiments. A total of nine groups were set up for reciprocal crossing: DT wMC‐DT ♀ × wMC‐DT♂; ST wC‐ST♀ × wM‐ST♂; wM‐ST♀ × wC‐ST♀; wM‐ST♀ × wMC‐DT♂; wC‐ST♀ × wMC‐DT♂; wild‐type WT♀ × wM‐ST♀; WT♀ × wC‐ST♂, and WT♀ × WT♂ (control group). For each group, the mating pairs were confined in a leaf‐clip cage on a cotton plant for 5 days, and the eggs laid on the plant were then placed into a climate incubator for further development till adult emergence (L14:D10 and 65 ± 1% RH at 28°C). The progenies were collected, and the number of off‐spring per female and the percentage of males were calculated. CI level was assessed as the proportion of male offspring. Three biological replicates were performed for each group.

Genome sequencing and identification of Cif genes in wCcep

The genome of Wolbachia wCcep strain was sequenced by Illumina and PacBio technologies (Ellegaard et al., 2013). For isolation and purification of Wolbachia wCcep, the infected rice moth was allowed to oviposit, and the eggs were collected. The eggs were dechorionated in bleach, rinsed with sterile distilled water, and then homogenised in phosphate‐buffered saline (PBS) buffer with a sterile micropestle. The homogenate was centrifuged at 400 × g for 5 min, and the supernatant was transferred to a new tube and centrifuged at 5400 × g for 5 min. The pellet was resuspended in PBS and then centrifuged at 400 × g for 5 min to remove remaining debris. The supernatant was slowly pushed through a 5 μm pore size filter (Millipore, Bedford, MA) with a syringe, followed by a 2.7 μm pore size filter (Whatman, USA). The filtrate was centrifuged at 6900 × g for 15 min. After decanting the supernatant, a bacterial pellet (Wolbachia cells) was obtained. The purified Wolbachia was confirmed by PCR using the primers 81F/522R targeting wsp of Supergroup B Wolbachia (Zhou et al., 1998), and then quickly ground and transferred to a preheated 50‐mL centrifuge tube containing 15 mL CTAB solution, which was mixed and placed in a constant‐temperature water bath at 65°C, lysed for 60 min, and mixed once every 15 min. The sample was cooled to room temperature before centrifuged at 5000 rpm for 10 min at room temperature. The supernatant was added to an equal volume of phenol/chloroform/isoamyl alcohol and centrifuged. The upper liquid was extracted one more time, and then transferred to a new tube with addition of 2/3 volume of isopropanol and 50 μL 3 M sodium acetate, and placed in a refrigerator (−20°C) overnight for precipitation. The mixture was added with 750 μL ethanol (75%) and centrifuged at 5000 rpm for 5 min. This step was repeated once. The dried pellet was finally dissolved in Tris‐EDTA buffer (10 mM Tris, 1 mM EDTA, pH 8.0) and frozen at −20°C for genome sequencing on a PacBio RS II and Illumina HiSeq 4000 platform (Illumina Inc., San Diego, CA, USA) by Beijing Genomics Institute (Beijing, China).

The draft genome of wCcep was assembled using the Celera Assembler against a high‐quality corrected circular consensus sequence subreads set. The assembled genome was annotated using Prokka version 1.14 (Seemann, 2014) with default parameters. The Cif genes in the genome of wCcep were searched with TBlastN (https://blast.ncbi.nlm.nih.gov/Blast.cgi) using all cif gene sequences available to date.

Phylogenetic analysis of Cif proteins in wCcep and wMel

The Cif proteins encoded by the cif genes identified in the wCcep genome sequenced in this study and retrieved from the wMel genome (GenBank acc. no. GCF_000008025.1) were aligned with reference homologous sequences (Table S2). Phylogenetic analysis was performed using the maximum likelihood algorithm on MEGA7.1. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown at the node. The evolutionary distances were computed using the Poisson correction method. All positions containing gaps and missing data are eliminated.

Structural comparison of CIF proteins between wCcep and wMel

CIF proteins were preliminarily analysed using the SMART programme (http://smart.embl-heidelberg.de/; Schultz et al., 1998). The proteins were further analysed for the presence of putative domains using the HHpred protein domain prediction tool (https://toolkit.tuebingen.mpg.de/#/tools/hhpred) (Söding et al., 2005; Zimmermann et al., 2018) with default parameters, and annotations with p > 80% were recorded (Shropshire et al., 2022). The databases SCOPe70 (v.2.07), Pfam (v.33.1), SMART (v6.0) and COG/KOG (v1.0) (Lindsey et al., 2018; Martinez et al., 2022) were used to confirm SMART‐identified domains and identify additional domain structures.

Comparison of the tertiary structures of Cif proteins between wCcep and wMel

The tertiary structures of CifA I wCcep, CifB I wCcep, CifA IV wCcep, CifB IV wCcep, CifA I wMel and CifB I wMel proteins were generated by AlphaFold2.2.3 as a local server and based on full AlphaFold database (Jumper et al., 2021). The max_template_date was set to ensure that all proteins are generated off the same set of starting templates (last accessed: 21 September 2020). The similarity between tertiary structures was calculated using the Zhanglab TM‐score Server (http://zhanggroup.org/TM-align/; Xu & Zhang, 2010). The structural difference between the CIF proteins of wCcep and wMel was evaluated based on their similarities. AlphaFold‐Multimer (Evans et al., 2021) was used to predict the binding complex of CifA I wCcep – CifB I wCcep full sequences with multiple sequence alignments set as the all genetics database used at CASP14. The prediction of complexes was run fifth with different random seeds and 25 models were obtained. Finally, the complex with the highest quality score (plDDT = 0.726) was selected. Among the complexes, the tail of CifB I wCcep that contained a DUB domain (residue 753–1107) was removed due to being far away from the core and having a low predicted mass, which was consistent with previous studies (Wang et al., 2022). The remainder contained two PD‐(D/E)XK (pseudo) nuclease domains (residue 1–752) for further optimization with subsequent MD simulations.

MD simulations

MD simulations were performed by using Desmond programme of Schrödinger 2021‐3 (Bowers et al., 2006) and the OPLS4 (Lu et al., 2021) protein force field. The binding complex of CifA I wCcep‐CifB I wCcep 2ND obtained in the last step was explicitly solvated with TIP3P (Jorgensen et al., 1983) water molecules under cubic periodic boundary conditions for a 15 Å buffer region. The overlapping water molecules were removed and 0.15 M KCl was added, and the systems were neutralised by adding K+ as counter ions. The electrostatic interactions were calculated under elastic simulations by Verlet and cg algorithms and particle‐mesh Ewald method, and energy minimization was performed using the steepest descent method for the maximum number of steps (50,000 steps). The Coulomb force cut‐off distance and the van der Waals radius cut‐off distance were both 1.4 nm. The system was equilibrated using a regular system (NVT) and an isothermal isobaric system (NPT), followed by 100 ns MD simulations at constant temperature and pressure. The V‐rescale temperature coupling method was used to control the simulation temperature to 300 K. RMSD was used to observe the local site metastability of the system during the simulation and calculated based on C‐alpha atoms. The plot was presented using PyMOL 2.4.1. The Ramachandran plot of the eventual model was generated with Schrödinger 2021‐3.

Data analysis

Statistical differences were analysed using One‐way analysis of variance followed by SNK test and Tukey's post hoc tests (p < 0.05) on SPSS v.27.0 software (SPSS Inc., Chicago, IL, USA).

AUTHOR CONTRIBUTIONS

Jing Li: Investigation (lead); methodology (lead); writing – original draft (lead). Bei Dong: Data curation (equal); investigation (equal). Yong Zhong: Formal analysis (equal); methodology (equal). Zheng‐Xi Li: Conceptualization (lead); funding acquisition (lead); methodology (lead); project administration (lead); supervision (lead); writing – review and editing (lead).

CONFLICT OF INTEREST STATEMENT

The authors declare no conflicts of interest.

Supporting information

Data S1: Supporting information.

Click here for additional data file. (2.5MB, docx)

ACKNOWLEDGEMENTS

This work is supported by the National Natural Science Foundation of China (Grant nos. 31772169 and 31972267) and the Natural Science Foundation of Guangxi Province (Grant no. 2018GXNSFAA294016).

Li, J. , Dong, B. , Zhong, Y. & Li, Z.‐X. (2023) Transinfected Wolbachia strains induce a complex of cytoplasmic incompatibility phenotypes: Roles of CI factor genes. Environmental Microbiology Reports, 15(5), 370–382. Available from: 10.1111/1758-2229.13169

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are openly available in GenBank at https://ncbi.nlm.nih.gov (acc.no. CP087954).

REFERENCES

  1. Adams, K.L. , Abernathy, D.G. , Willett, B.C. , Selland, E.K. , Itoe, M.A. & Catteruccia, F. (2021) Wolbachia cifB induces cytoplasmic incompatibility in the malaria mosquito vector. Nature Microbiology, 6(12), 1575–1582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ant, T.H. , Herd, C.S. , Geoghegan, V. , Hoffmann, A.A. & Sinkins, S.P. (2018) The Wolbachia strain wAu provides highly efficient virus transmission blocking in Aedes aegypti . PLoS Pathogens, 14(1), e1006815. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Beckmann, J.F. , Ronau, J.A. & Hochstrasser, M. (2017) A Wolbachia deubiquitylating enzyme induces cytoplasmic incompatibility. Nature Microbiology, 2(5), 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bonneau, M. , Atyame, C. , Beji, M. , Justy, F. , Cohen‐Gonsaud, M. , Sicard, M. et al. (2018) Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia . Nature Communications, 9(1), 1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bourtzis, K. (2008) Wolbachia‐based technologies for insect pest population control. Transgenesis and the Management of Vector‐Borne Disease, 627, 104–113. [DOI] [PubMed] [Google Scholar]
  6. Bowers, K.J. , Chow, E. , Xu, H. , Dror, R.O. , Eastwood, M.P. , Gregersen, B.A. et al. (2006) Scalable algorithms for molecular dynamics simulations on commodity clusters. In Proceedings of the 2006 ACM/IEEE Conference on Supercomputing (pp. 84‐es).
  7. Brucker, R.M. & Bordenstein, S.R. (2012) Speciation by symbiosis. Trends in Ecology & Evolution, 27(8), 443–451. [DOI] [PubMed] [Google Scholar]
  8. Chen, H. , Ronau, J.A. , Beckmann, J.F. & Hochstrasser, M. (2019) A Wolbachia nuclease and its binding partner provide a distinct mechanism for cytoplasmic incompatibility. Proceedings of the National Academy of Sciences of the United States of America, 116(44), 22314–22321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ellegaard, K.M. , Klasson, L. , Näslund, K. , Bourtzis, K. & Andersson, S.G. (2013) Comparative genomics of Wolbachia and the bacterial species concept. PLoS Genetics, 9(4), e1003381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Evans, R. , O'Neill, M. , Pritzel, A. , Antropova, N. , Senior, A. , Green, T. et al. (2021) Protein complex prediction with AlphaFold‐Multimer. BioRxiv, 2021‐10. 10.1101/2021.10.04.463034 [DOI] [Google Scholar]
  11. Funkhouser‐Jones, L.J. , Sehnert, S.R. , Martinez‐Rodriguez, P. , Toribio‐Fernández, R. , Pita, M. , Bella, J.L. et al. (2015) Wolbachia co‐infection in a hybrid zone: discovery of horizontal gene transfers from two Wolbachia supergroups into an animal genome. PeerJ, 3, e1479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gong, J.T. , Li, Y. , Li, T.P. , Liang, Y. , Hu, L. , Zhang, D. et al. (2020) Stable introduction of plant‐virus‐inhibiting Wolbachia into planthoppers for rice protection. Current Biology, 30(24), 4837–4845. [DOI] [PubMed] [Google Scholar]
  13. Hu, H.Y. & Li, Z.X. (2015) A novel Wolbachia strain from the rice moth Corcyra cephalonica induces reproductive incompatibility in the whitefly Bemisia tabaci: sequence typing combined with phenotypic evidence. Environmental Microbiology Reports, 7(3), 508–515. [DOI] [PubMed] [Google Scholar]
  14. Jamnongluk, W. , Kittayapong, P. , Baimai, V. & O'neill, S.L. (2002) Wolbachia infections of tephritid fruit flies: molecular evidence for five distinct strains in a single host species. Current Microbiology, 45(4), 255–260. [DOI] [PubMed] [Google Scholar]
  15. Jorgensen, W.L. , Chandrasekhar, J. , Madura, J.D. , Impey, R.W. & Klein, M.L. (1983) Comparison of simple potential functions for simulating liquid water. The Journal of Chemical Physics, 79(2), 926–935. [Google Scholar]
  16. Jumper, J. , Evans, R. , Pritzel, A. , Green, T. , Figurnov, M. , Ronneberger, O. et al. (2021) Highly accurate protein structure prediction with AlphaFold. Nature, 596(7873), 583–589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kambris, Z. , Cook, P.E. , Phuc, H.K. & Sinkins, S.P. (2009) Immune activation by life‐shortening Wolbachia and reduced filarial competence in mosquitoes. Science, 326(5949), 134–136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kondo, N. , Nikoh, N. , Ijichi, N. , Shimada, M. & Fukatsu, T. (2002) Genome fragment of Wolbachia endosymbiont transferred to X chromosome of host insect. Proceedings of the National Academy of Sciences, 99(22), 14280–14285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. LePage, D.P. , Metcalf, J.A. , Bordenstein, S.R. , On, J. , Perlmutter, J.I. , Shropshire, J.D. et al. (2017) Prophage WO genes recapitulate and enhance Wolbachia‐induced cytoplasmic incompatibility. Nature, 543(7644), 243–247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lindsey, A.R.I. , Rice, D.W. , Bordenstein, S.R. , Brooks, A.W. , Bordenstein, S.R. & Newton, I.L.G. (2018) Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia . Genome Biology and Evolution, 10(2), 434–451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lu, C. , Wu, C. , Ghoreishi, D. , Chen, W. , Wang, L. , Damm, W. et al. (2021) OPLS4: improving force field accuracy on challenging regimes of chemical space. Journal of Chemical Theory and Computation, 17(7), 4291–4300. [DOI] [PubMed] [Google Scholar]
  22. Łukasik, P. , Guo, H. , Van Asch, M. , Ferrari, J. & Godfray, H.C.J. (2013) Protection against a fungal pathogen conferred by the aphid facultative endosymbionts Rickettsia and Spiroplasma is expressed in multiple host genotypes and species and is not influenced by co‐infection with another symbiont. Journal of Evolutionary Biology, 26(12), 2654–2661. [DOI] [PubMed] [Google Scholar]
  23. Machtelinckx, T. , van Leeuwen, T. , van de Wiele, T. , Boon, N. , de Vos, W.H. , Sanchez, J.A. et al. (2012) Microbial community of predatory bugs of the genus Macrolophus (Hemiptera: Miridae). BMC Microbiology, 12(1), 1–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Martinez, J. , Ant, T.H. , Murdochy, S.M. , Tong, L. , da Silva Filipe, A. & Sinkins, S.P. (2022) Genome sequencing and comparative analysis of Wolbachia strain wAlbA reveals Wolbachia‐associated plasmids are common. PLoS Genetics, 18(9), e1010406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Martinez, J. , Klasson, L. , Welch, J.J. & Jiggins, F.M. (2021) Life and death of selfish genes: comparative genomics reveals the dynamic evolution of cytoplasmic incompatibility. Molecular Biology and Evolution, 38(1), 2–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Moutailler, S. , Valiente Moro, C. , Vaumourin, E. , Michelet, L. , Tran, F.H. , Devillers, E. et al. (2016) Co‐infection of ticks: the rule rather than the exception. PLoS Neglected Tropical Diseases, 10(3), e0004539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Mouton, L. , Dedeine, F. , Henri, H. , Boulétreau, M. , Profizi, N. & Vavre, F. (2004) Virulence, multiple infections and regulation of symbiotic population in the Wolbachia‐Asobara tabida symbiosis. Genetics, 168(1), 181–189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Narita, S. , Nomura, M. & Kageyama, D. (2007) Naturally occurring single and double infection with Wolbachia strains in the butterfly Eurema hecabe: transmission efficiencies and population density dynamics of each Wolbachia strain. FEMS Microbiology Ecology, 61(2), 235–245. [DOI] [PubMed] [Google Scholar]
  29. Nguyen, D.T. , Morrow, J.L. , Spooner‐Hart, R.N. & Riegler, M. (2017) Independent cytoplasmic incompatibility induced by Cardinium and Wolbachia maintains endosymbiont coinfections in haplodiploid thrips populations. Evolution, 71(4), 995–1008. [DOI] [PubMed] [Google Scholar]
  30. O'Neill, S.L. , Pettigrew, M.M. , Sinkins, S.P. , Braig, H.R. , Andreadis, T.G. & Tesh, R.B. (1997) In vitro cultivation of Wolbachia pipientis in an Aedes albopictus cell line. Insect Molecular Biology, 6(1), 33–39. [DOI] [PubMed] [Google Scholar]
  31. Pan, X. , Zhou, G. , Wu, J. , Bian, G. , Lu, P. , Raikhel, A.S. et al. (2012) Wolbachia induces reactive oxygen species (ROS)‐dependent activation of the toll pathway to control dengue virus in the mosquito Aedes aegypti . Proceedings of the National Academy of Sciences, 109(1), E23–E31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Pannebakker, B.A. , Loppin, B. , Elemans, C.P. , Humblot, L. & Vavre, F. (2007) Parasitic inhibition of cell death facilitates symbiosis. Proceedings of the National Academy of Sciences of the United States of America, 104(1), 213–215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Rio, R.V. , Wu, Y.N. , Filardo, G. & Aksoy, S. (2006) Dynamics of multiple symbiont density regulation during host development: tsetse fly and its microbial flora. Proceedings of the Royal Society B: Biological Sciences, 273(1588), 805–814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Saridaki, A. & Bourtzis, K. (2010) Wolbachia: more than just a bug in insects genitals. Current Opinion in Microbiology, 13(1), 67–72. [DOI] [PubMed] [Google Scholar]
  35. Sasaki, T. , Massaki, N. & Kubo, T. (2005) Wolbachia variant that induces two distinct reproductive phenotypes in different hosts. Heredity, 95(5), 389–393. [DOI] [PubMed] [Google Scholar]
  36. Schultz, J. , Milpetz, F. , Bork, P. & Ponting, C.P. (1998) SMART, a simple modular architecture research tool: identification of signaling domains. Proceedings of the National Academy of Sciences of the United States of America, 95(11), 5857–5864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Seemann, T. (2014) Prokka: rapid prokaryotic genome annotation. Bioinformatics, 30(14), 2068–2069. [DOI] [PubMed] [Google Scholar]
  38. Shropshire, J.D. & Bordenstein, S.R. (2019) Two‐by‐one model of cytoplasmic incompatibility: synthetic recapitulation by transgenic expression of cifA and cifB in Drosophila . PLoS Genetics, 15(6), e1008221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Shropshire, J.D. , Hamant, E. , Conner, W.R. & Cooper, B.S. (2022) cifB‐transcript levels largely explain cytoplasmic incompatibility variation across divergent Wolbachia . PNAS Nexus, 1(3), pgac099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Shropshire, J.D. , On, J. , Layton, E.M. , Zhou, H. & Bordenstein, S.R. (2018) One prophage WO gene rescues cytoplasmic incompatibility in Drosophila melanogaster . Proceedings of the National Academy of Sciences of the United States of America, 115(19), 4987–4991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Shropshire, J.D. , Rosenberg, R. & Bordenstein, S.R. (2021) The impacts of cytoplasmic incompatibility factor (cifA and cifB) genetic variation on phenotypes. Genetics, 217(1), 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Sinkins, S.P. & Gould, F. (2006) Gene drive systems for insect disease vectors. Nature Reviews Genetics, 7(6), 427–435. [DOI] [PubMed] [Google Scholar]
  43. Söding, J. , Biegert, A. & Lupas, A.N. (2005) The HHpred interactive server for protein homology detection and structure prediction. Nucleic Acids Research, 33(suppl_2), W244–W248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Sun, G. , Zhang, M. , Chen, H. & Hochstrasser, M. (2022) The CinB nuclease from wNo Wolbachia is sufficient for induction of cytoplasmic incompatibility in Drosophila . MBio, 13(1), e03177‐21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wang, W., Cui, W., & Yang, H. (2022) Toward an accurate mechanistic understanding of Wolbachia‐induced cytoplasmic incompatibility. Environmental Microbiology, 24(10), 4519–4532. [DOI] [PubMed] [Google Scholar]
  46. Wamwiri, F.N. , Alam, U. , Thande, P.C. , Aksoy, E. , Ngure, R.M. , Aksoy, S. et al. (2013) Wolbachia, Sodalis and trypanosome co‐infections in natural populations of Glossina austeni and Glossina pallidipes . Parasites & Vectors, 6(1), 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Werren, J.H. , Baldo, L. & Clark, M.E. (2008) Wolbachia: master manipulators of invertebrate biology. Nature Reviews Microbiology, 6(10), 741–751. [DOI] [PubMed] [Google Scholar]
  48. Werren, J.H. , Zhang, W. & Guo, L.R. (1995) Evolution and phylogeny of Wolbachia: reproductive parasites of arthropods. Proceedings of the Royal Society of London. Series B: Biological Sciences, 261(1360), 55–63. [DOI] [PubMed] [Google Scholar]
  49. Wu, M. , Sun, L.V. , Vamathevan, J. , Riegler, M. , Deboy, R. , Brownlie, J.C. et al. (2004) Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PLoS Biology, 2(3), e69. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Xiao, Y. , Chen, H. , Wang, H. , Zhang, M. , Chen, X. , Berk, J.M. et al. (2021) Structural and mechanistic insights into the complexes formed by Wolbachia cytoplasmic incompatibility factors. Proceedings of the National Academy of Sciences of the United States of America, 118(41), e2107699118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Xie, R.R. , Sun, J.T. , Xue, X.F. & Hong, X.Y. (2016) Cytoplasmic incompatibility and fitness benefits in the two‐spotted spider mite Tetranychus urticae (red form) doubly infected with Wolbachia and Cardinium . Systematic and Applied Acarology, 21(9), 1161–1173. [Google Scholar]
  52. Xu, J. & Zhang, Y. (2010) How significant is a protein structure similarity with TM‐score = 0.5? Bioinformatics, 26(7), 889–895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zabalou, S. , Riegler, M. , Theodorakopoulou, M. , Stauffer, C. , Savakis, C. & Bourtzis, K. (2004) Wolbachia‐induced cytoplasmic incompatibility as a means for insect pest population control. Proceedings of the National Academy of Sciences of the United States of America, 101(42), 15042–15045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zhang, Y.K. , Chen, Y.T. , Yang, K. , Qiao, G.X. & Hong, X.Y. (2016) Screening of spider mites (Acari: Tetranychidae) for reproductive endosymbionts reveals links between co‐infection and evolutionary history. Scientific Reports, 6(1), 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Zhong, Y. & Li, Z.X. (2014) Bidirectional cytoplasmic incompatibility induced by cross‐order transfection of Wolbachia: implications for control of the host population. Microbial Ecology, 68(3), 463–471. [DOI] [PubMed] [Google Scholar]
  56. Zhou, X.F. & Li, Z.X. (2016) Establishment of the cytoplasmic incompatibility‐inducing Wolbachia strain wMel in an important agricultural pest insect. Scientific Reports, 6(1), 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Zhou, W. , Rousset, F. & O'Neill, S. (1998) Phylogeny and PCR‐based classification of Wolbachia strains using wsp gene sequences. Proceedings of the Royal Society of London. Series B: Biological Sciences, 265(1395), 509–515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zimmermann, L. , Stephens, A. , Nam, S.Z. , Rau, D. , Kübler, J. , Lozajic, M. et al. (2018) A completely reimplemented MPI bioinformatics toolkit with a new HHpred server at its core. Journal of Molecular Biology, 430(15), 2237–2243. [DOI] [PubMed] [Google Scholar]
  59. Zug, R. & Hammerstein, P. (2012) Still a host of hosts for Wolbachia: analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One, 7(6), e38544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zug, R. & Hammerstein, P. (2015) Bad guys turned nice? A critical assessment of Wolbachia mutualisms in arthropod hosts. Biological Reviews, 90(1), 89–111. [DOI] [PubMed] [Google Scholar]
  61. Zytynska, S.E. & Weisser, W.W. (2016) The natural occurrence of secondary bacterial symbionts in aphids. Ecological Entomology, 41(1), 13–26. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1: Supporting information.

Click here for additional data file. (2.5MB, docx)

Data Availability Statement

The data that support the findings of this study are openly available in GenBank at https://ncbi.nlm.nih.gov (acc.no. CP087954).

Articles from Environmental Microbiology Reports are provided here courtesy of Wiley

RESOURCES