Transgenic expression of Arabidopsis ELONGATION FACTOR-TU RECEPTOR (AtEFR) gene in banana enhances resistance against Xanthomonas campestris pv. musacearum

Mark Adero; Jaindra Nath Tripathi; Richard Oduor; Cyril Zipfel; Leena Tripathi

doi:10.1371/journal.pone.0290884

. 2023 Sep 1;18(9):e0290884. doi: 10.1371/journal.pone.0290884

Transgenic expression of Arabidopsis ELONGATION FACTOR-TU RECEPTOR (AtEFR) gene in banana enhances resistance against Xanthomonas campestris pv. musacearum

Mark Adero ^1,², Jaindra Nath Tripathi ^1,^*, Richard Oduor ², Cyril Zipfel ^3,⁴, Leena Tripathi ^1,^*

Editor: Eugenio Llorens⁵

PMCID: PMC10473477 PMID: 37656732

Abstract

Banana Xanthomonas wilt (BXW) caused by Xanthomonas campestris pv. musacearum (Xcm) is a severe bacterial disease affecting banana production in East and Central Africa, where banana is cultivated as a staple crop. Classical breeding of banana is challenging because the crop is clonally propagated and has limited genetic diversity. Thus, genetic engineering serves as a viable alternative for banana improvement. Studies have shown that transfer of the elongation factor Tu receptor gene (AtEFR) from Arabidopsis thaliana to other plant species can enhance resistance against bacterial diseases. However, AtEFR activity in banana and its efficacy against Xcm has not been demonstrated. In this study, transgenic events of banana (Musa acuminata) cultivar dwarf Cavendish expressing the AtEFR gene were generated and evaluated for resistance against Xcm under greenhouse conditions. The transgenic banana events were responsive to the EF-Tu-derived elf18 peptide and exhibited enhanced resistance to BXW disease compared to non-transgenic control plants. This study suggests that the functionality of AtEFR is retained in banana with the potential of enhancing resistance to BXW under field conditions.

Introduction

Banana (Musa spp.) is a staple food for about 400 million people, a crucial food security crop, and a source of income, especially in low-income countries [1]. The Great Lakes region, including Burundi, Rwanda, Uganda, Kenya, Tanzania, and the Democratic Republic of Congo, is the largest banana producer in Africa. Bananas in this region are produced by small holder farmer mainly for local consumption. The daily consumption is estimated to be 147 kcal daily per person, which is 15 times higher than the global average and six times higher than Africa’s average [2]. Unfortunately, banana production in this region is hindered by banana Xanthomonas wilt (BXW), a systemic bacterial disease caused by Xanthomonas campestris pv. musacearum (Xcm). The disease is the biggest threat to banana production in the region, with economic losses estimated to be US$ 2–8 billion over a decade [3]. Symptoms of BXW disease manifest as premature ripening and rotting of fruits, shriveling of inflorescence, wilting, and yellowing of leaves leading to the death of the infected plant. The bacterial pathogen spread by insect vectors, use of contaminated tools and infected planting materials. The disease is managed through cultural practices, including removing male buds to eliminate insect vectors, removing diseased plants, use of clean pathogen-free planting material, and disinfecting farm tools [4]. Conventional breeding of clonally propagated crops like banana is limited by the lack of genetic diversity and availability of important traits in the gene pool [5]. All cultivated banana varieties are susceptible to BXW disease; however, resistance has been observed in one of the wild banana progenitor Musa balbisiana belonging to the BB genome [3, 6]. Unfortunately, the B genome is laced with banana streak virus (BSV) sequences; during hybridization, recombination of integrated virus sequences sometimes results in BSV infection [7]. This has limited the use of M. balbisiana in conventional breeding. Notably, tolerance to Xcm has also been reported in Musa acuminata subsp. Zebrina belonging to AA genome, suggesting that tolerant traits could be present in existing banana germplasm [8]. Further, the molecular basis of disease resistance in banana progenitor Musa balbisiana against Xcm was investigated [6]. Comparative transcriptome analysis of BXW-resistant genotype Musa balbisiana and BXW-susceptible banana cultivar ‘Pisang Awak’ challenged with Xcm showed differentially expressed genes associated with response to biotic stress, which were mapped to the biotic stress pathways to identify genes associated with defense mechanisms. This study identified several genes involved in the activation of pathogen-associated molecular patterns (PAMP)-triggered basal defense and disease resistance (R) protein-mediated defense in Musa balbisiana as an early response to Xcm infection. These Musa defense genes can be overexpressed in the BXW-susceptible cultivars using biotechnological tools such as transgenic or genome editing for develing resistance against Xcm.

One of the approaches to enhancing plant disease resistance is by boosting their immune system [9]. Plants have evolved two main mechanisms for evading pathogens. One involves recognizing potential phytopathogens before they establish and is achieved through pattern recognition receptors (PRRs), which recognize conserved pathogen-associated molecular patterns (PAMPs), resulting in PAMP-triggered immunity (PTI). In addition, plants utilize resistance (R) proteins, that are mainly nucleotide-binding site leucine-rich repeat receptors (NLRs) that sense specific pathogen effectors leading to effector-triggered immunity (ETI) [10]. Resistance through ETI is typically race-specific and limited to plant varieties with a particular R-gene and specific pathogens with corresponding virulence effector. Meanwhile, PAMPs are conserved among a wide range of microbes; thus, plants tend to exhibit broad-spectrum resistance to pathogens. As PAMPs are essential for microbial survival, their evolution is slower than virulence effectors [11]. Therefore, PTI has the potential of conferring durable and broad-spectrum disease resistance compared to ETI.

Several plant PRRs have been identified and characterized. The best studied PRR is FLAGELLIN SENSING 2 (FLS2), a leucine-rich repeat receptor kinase (LRR-RK), which recognizes a N-terminal 22-amino acid motif, flg22, of bacterial flagellin [12]. Another PRR, related to FLS2, that has been extensively studied is the Brassicaceae-specific ELONGATION FACTOR TU RECEPTOR (EFR), which recognizes the N-terminal acetylated motif elf18 of bacterial elongation factor thermal unstable (EF-Tu), thereby activating plant defense response against many bacteria [13]. EF-Tu is the most copious protein in bacteria and plays an indispensable role in protein synthesis by catalyzing the binding of aminoacyl transfer RNA to the ribosome [14].

EFR plays a significant role in plant response to bacterial infection, thus, it has been widely applied to engineer crops against diverse bacterial diseases. Heterologous expression of Arabidopsis thaliana EFR (AtEFR) in Nicotiana benthamiana and Solanum lycopersicum (tomato) conferred responsiveness to elf18 peptide from diverse bacterial genera, including Agrobacterium, Xanthomonas, Pseudomonas, and Ralstonia. Furthermore, the N. benthamiana and tomato transgenic events exhibited enhanced resistance to different genera of bacterial pathogens [15]. So far, transgenic expression of AtEFR has effectively enhanced the resistance of major crops against various bacterial pathogens, including wheat (Triticum aestivum) against Pseudomonas syringae pv. oryzae [16], rice (Oryza sativa) against Xanthomonas oryzae pv. oryzae [17], potato (S. tuberosum) against Ralstonia solanacearum [18], apple (Malus malus) against Erwinia amylovora [19], and sweet orange (Citrus sinensis) against Xanthomonas citri and Xylella fastidiosa [20].

Previously, the transgenic banana expressing sweet pepper hypersensitive response-assisting protein (Hrap) or plant ferredoxin-like protein (Pflp) genes were developed and tested [21, 22]. These transgenic bananas showed enhanced resistance to BXW through successive crop cycles and agronomic performance comparable to non-transgenic bananas under field trials in Uganda [23]. Transgenic bananas with resistance against BXW were also developed by transforming embryogenic cell suspensions of banana cultivar ‘Sukali Ndiizi’ with Xa21 gene [24]. The Xa21 transgenic banana events exhibited enhanced resistance against BXW under greenhouse conditions. Transgenic banana expressing rice NH1 gene also showed enhanced resistance against BXW disease [25]. The bacterial pathogen can evolve resistance mechanisms to overcome the defense conferred by most single genes or single mode of action. To avoid or minimize the chances of breaking down of disease resistance, there is a need to stack several transgenes with different mode of actions in the banana event for enhanced and durable resistance to BXW disease.

In this study, transgenic banana cultivar dwarf Cavendish (Musa spp., AAA genomic group) constitutively expressing AtEFR under the control of the constitutive CaMV35S promoter were developed and evaluated against Xcm under controlled greenhouse conditions. The transgenic banana events showed enhanced resistance to BXW disease, as exhibited by significantly reduced wilting incidences and a lower bacterial population compared to the non-transgenic control plants. Assessment of defense-related gene expression and oxidative burst assay further revealed that the transgenic events gained responsiveness to elf18, indicating that AtEFR activity is retained after its transfer and integration into the banana genome.

Materials and methods

Plant material

Embryogenic cell suspensions (ECS) of banana cultivar dwarf Cavendish were used for transformation. The ECS were initiated from meristematic shoot tissues using the protocol described by Tripathi et al. [26] and maintained at 28±2°C on a rotary shaker at 95 rpm in the dark.

Generation of transgenic plants

The plasmid construct pBIN19g-35S::AtEFR [15], harboring ELONGATION FACTOR TU RECEPTOR gene from Arabidopsis thaliana (AtEFR) and neomycin phosphotransferase II (nptII) gene for kanamycin selection was transformed into Agrobacterium tumefaciens strain EHA105 by electroporation. The plasmid construct was validated through restriction enzyme digestion and PCR analysis using AtEFR-specific primers before using it for transformation. Banana ECSs were transformed as per the method described previously [26]. Agrobacterium infected ECSs were regenerated on a selective medium supplemented with 100 mg/l kanamycin following the protocol described by Tripathi et al. [26]. All regenerated putative transgenic events were maintained and multiplied on proliferation medium at 28±2°C for a 16-/ 8-h light/dark photoperiod under fluorescent tube lights. The putative transgenic events were characterized for the presence of the transgene. The transgenic shoots were transferred to the rooting medium. The well-rooted events were transferred to soil in the greenhouse for disease evaluation.

Molecular analysis of transgenic events

Polymerase chain reaction analysis

Genomic DNA was extracted from the putatively transformed events using a cetyltrimethylammonium bromide (CTAB) method [27]. PCR was performed in a 25-μL reaction volume containing 2.5 μL 10X PCR buffer, 0.3 μL dNTPs, 1μL of 10 μM reverse and forward AtEFR primers, 2 μL genomic DNA (100ng/μL), 0.2 μL Taq DNA polymerase (Qiagen, Germany), and 18 μL nuclease-free water. Thermocycler conditions were as follows: initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 45 s, then final extension at 72°C for 7 min. Genomic DNA from non-transgenic control plant and pBIN19g-35S::AtEFR plasmid were used as negative and positive controls, respectively. The primers [forward 5’CGGGAATCTTGTAAGCCTGC 3’and reverse 5’GCACCCTTCCCTCAAACTTG 3’] amplifying 635 base pairs (bp) region within the AtEFR gene were used for PCR analysis. The amplified products were run on a 1% agarose gel (Duchefa, Netherlands) stained with GelRed® (Biotium, San Francisco, USA) and visualized under ultraviolet light.

Southern blot analysis

Southern blot analysis was performed as per the method described by Tripathi et al. [23]. Briefly, 10 μg of genomic DNA from each sample was restricted with BamH1 for 12 h. The DNA samples, including plasmid pBIN19g-35S::AtEFR and genomic DNA sample from a control non-transgenic plant, were run for a 0.8% agarose gel at 50 V. The gel stained with GelRed® was viewed under ultraviolet light to confirm the digestion. The restricted DNA was denatured, then blotted onto a positively charged membrane (Roche Diagnostics, West Sussex, UK) and fixed using ultraviolet cross-linking. The blots were then hybridized with a digoxigenin (DIG) PCR-labeled 635-bp AtEFR-specific probe. Hybridization and probe detection was performed using a DIG Luminescent Detection Kit for Nucleic Acids (Roche Diagnostics, UK) as per the manufacturer’s protocol.

Plant growth analysis

Eight PCR positive transgenic events and control plants were randomly selected for the plant growth analysis. Three replicates of well-rooted plants for each event were transferred to soil in small plastic cups and acclimatized for 30 days in a humidity chamber, then transferred to bigger pots and grown in the greenhouse for 90 days at 25–30°C. The growth parameter data, including plant height, pseudostem girth, number of functional leaves, and length and width of the middle leaf, were recorded from 90-day-old plants. The total leaf area was calculated using the formula below [28].

Total leaf area = 0.8 ⊆ L⊆ W ⊆N

In which, L = Length of the middle leaf, W = width of the middle leaf, and N = total number of leaves in the plant.

Greenhouse evaluation of transgenic events for resistance to BXW disease

Three replicates of each transgenic event and non-transgenic control were evaluated for resistance against Xcm under greenhouse conditions. A total of 31 transgenic events were used for the disease assay. The transgenic events and non-transgenic control plants were arranged in a completely randomized design. The culture of Xcm (Ugandan isolate, sublineage 2) that met the four Koch postulates were cultured in YPGA medium (0.5% yeast extract, 0.5% peptone, 1% glucose, and 0.8% micro agar) for 48 h at 28°C. A single colony was aseptically isolated and further cultured for 48 h in 50 mL of YPG medium at 28°C in an incubator shaker (200 rpm). Subsequently, the liquid culture was centrifuged at 4000 rpm for 15 min and the pellet resuspended in sterile distilled water. The suspension concentration was adjusted to OD_600nm of 1 using sterile distilled water. The second open functional leaf of 90-day-old potted plant was inoculated with 100 μL of the bacterial suspension using an insulin syringe. The plants were maintained in the greenhouse under observation, and symptoms were recorded as they occurred for 60 days post-inoculation (dpi). The data collected included number of days for appearance of the first symptom, number of days for complete wilting, disease severity, and the number of leaves showing symptoms at 60 dpi. The data was used to calculate percent resistance compared to control non-transgenic plants using the formula below [27]:

Resistance (%) = (Reduction in wilting of transgenic event/number of leaves wilted in the control plant) ⊆100

In which, reduction in wilting was the total number of leaves minus the number of leaves wilted.

Disease severity was rated on a scale of 0–5 (0- no signs of the disease, 1- a single leaf showing symptom, 2-two to three leaves with symptoms, 3- four to five leaves with symptoms, 4- all the leaves have symptoms but plant not dead, 5- complete death).

Plants were categorized as resistant if they did not show any symptom, partially resistant if the symptoms did not spread to all the leaves, and susceptible if the symptoms spread to all the leaves, causing complete wilting or death of the plant.

In planta bacterial population analysis

For the bacterial population study, two transgenic events (T5 and T7) that exhibited enhanced resistance against Xcm under greenhouse conditions, along with control non-transgenic plants, were used for this experiment. Three replicates of 90-day-old potted plants were inoculated with Xcm culture as described previously [21]. Leaf-mid rib sections (1 cm) of the inoculated leaves were collected at 0, 3, 6, 9, 12, and 15 pdi. The samples were ground in 15-mL falcon tubes after adding 2 mL of YPG medium and incubated in an incubator shaker (200 rpm) for 1 h at 28°C. Five serial dilutions of the sample suspensions were spread on YPGA medium supplemented with 50 mg/L cephalexin to select for Xcm and cultured at 28°C for 48 h. Samples from each line were cultured in triplicate for every time point. The bacterial population was determined by counting colonies for each dilution and described using growth curve analysis.

Transgene expression analysis

To determine the relative gene expression of various transgenic events compared to control non-transgenic plant, total RNA was extracted from the leaves of two-week-old shoots using RNeasy plant mini kit (Qiagen, Germany) according to the manufacturer’s instructions. The RNA quality and concentration were determined using NanoDrop 2000 (Thermo Fisher Scientific). And 1 μg of the total RNA was reverse transcribed into cDNA using Luna script RT Supermix (New England Biolabs) as per the manufacturer’s protocol. The cDNA templates were then used for PCR amplification of the AtEFR gene transcript. The PCR was performed in a 25-μL reaction volume containing 2.5 μL10X PCR buffer, 0.3 μL dNTPs, 1μL of 10 μM reverse and forward AtEFR primers (S1 Table), 2 μL cDNA, 0.2 μL Taq DNA polymerase, and 18 μL nuclease-free water under the following conditions: initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 1 min, then final extension at 72°C for 7 min. Musa 25s ribosomal transcript was used as an internal control to check the quality of the cDNA. qRT-PCR was performed using Luna® Universal qPCR Master Mix (New England Biolabs) on a Quanta Studio Real-Time PCR System (Applied Biosystems, Foster City, CA) under the following conditions: initial denaturation at 95°C for 5 min followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min. The reaction mixture was in a 20 μl reaction volume consisting of 10 μl Luna® Universal qPCR Master Mix, 0.2 μl forward and reverse primers (S1 Table), 5 μl cDNA, and 4.6 μl nuclease-free water. Each sample consisted of three biological replicates. Musa 25s ribosomal transcript served as an internal control for the normalization of gene expression. The relative levels of the AtEFR gene were analysed using Livak & Schmittgen method [29].

Expression analysis of defense-related genes

The leaves of two-week-old shoots were infiltrated with 250 nM elf18 peptide solution for 60, 120, and 180 min. Total RNA was extracted and qRT-PCR was performed as described in the above section to check the relative expression of defense-related genes (MaWRKY-22 like, MaPR1-like, MaPR2-like, MaPR3-like, MaPR4-like, and MaPR5-like) in the transgenic events compared to control non-transgenic events. qRT-PCR was performed with initial denaturation at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min. Each sample consisted of three biological replicates. Musa 25s ribosomal transcript was used as an internal control for the normalization of gene expression. The primers used are presented in S1 Table.

ROS production assay

Hydrogen peroxide production in the transgenic events after elf18 infiltration was determined through histochemical staining assay using DAB (3,3’-diaminobenzidine) solution [30]. Briefly, freshly opened leaves of 14-day-old in vitro plantlets were infiltrated with 100 μL of 250 nM elf18 peptide dissolved in sterile distilled water. The leaves were left to incubate for 2 h, after which they were harvested and submerged in DAB solution in 15-mL falcon tubes wrapped with aluminum foil. The samples were incubated in DAB solution for 5 h on a shaker (70 rpm) at room temperature. Following incubation, DAB solution was removed, and samples were bleached with a solution (ethanol: acetic acid: glycerol = 3:1:1) for 15 min in the water bath at 95°C to remove chlorophyll. The bleaching solution was refreshed thrice, and the samples were further incubated for 30 min at room temperature. The samples were then removed from the bleaching solution, dried on paper towels, and photographed using SMZ1500 stereomicroscope (Carlsbad, CA, USA) attached with high zoom Nikon camera. The photomicrographs were analyzed using image J software (National Institutes of Health, USA) to compare the browning intensities.

Statistical analysis

Data analysis was performed using Minitab Statistical Software, version 17 (Pennsylvania, USA). Differences in disease resistance and plant growth characteristics between various transgenic events and non-transgenic control plants were analyzed using one-way analysis of variance (ANOVA) and means separated by Fisher’s HSD test. Statistical significance was determined at p≤0.05.

Results

Generation of transgenic events

Embryogenic cell suspensions (ECSs) of banana cultivar dwarf Cavendish were co-cultivated with Agrobacterium tumefaciens strain EHA105 harboring the binary vector pBIN19g:35S::AtEFR [15] for three days. Agrobacterium-infected ECSs turned from cream to brown color during co-cultivation. Browning intensified when the cells were transferred to embryo development medium (EDM) supplemented with 100 mg/L kanamycin for selecting transformed embryogenic cells. After about 30 days of culture on the same medium, white embryos began to appear on the surface of the dark heap of cells (Fig 1A). The white embryos increased in number and size when the cells were transferred to fresh EDM. After 14 days of culture on selective embryo maturation medium (EMM), a few embryos germinated into plantlets, but most continued to expand on the same medium without developing any organized structures (Fig 1B). Most embryos germinated into complete plantlets on a selective embryo germination medium (EGM) after 20–30 days of culture (Fig 1C). After germination, the shoots elongated when transferred to proliferation medium (PM) supplemented with 100 mg/L kanamycin (Fig 1D). In total, 32 putative transgenic events were regenerated from three separate experiments.

Fig 1 — (A) Embryogenic cells in selective embryo development medium (EDM), (B) Embryos maturing and germinating on selective embryo maturation medium (EMM), (C) Germination of embryos in selective embryo germination medium (EGM), (D) Complete plantlets on selective proliferation medium (PM).

Molecular characterization of transgenic events

The regenerated putative transgenic events were validated for the presence and integration of the transgene by PCR and Southern blot analysis, respectively. The PCR analysis using AtEFR-specific primers revealed an amplicon of the expected size (635 bp) (Fig 2A), confirming the presence of the AtEFR gene in the transgenic events. No amplification was observed in control non-transgenic plants. Further, 14 PCR-positive events were assessed using Southern blot analysis to confirm transgene integration and copy number. Southern hybridization of BamH1-digested genomic DNA using an AtEFR-specific probe confirmed the integration of the transgene in the plant genome with different hybridization profiles, indicating random insertion of the transgene in the genome of the tested events. The copy number of the transgene incorporated in the different events ranged from at least one to multiple (Fig 2B). No transgene integration was detected in the non-transgenic control plants.

Fig 2 — A) Polymerase chain reaction assay to confirm the presence of *AtEFR* gene, B) Southern blot analysis to confirm the integration of *AtEFR* gene. M; molecular marker, C; Control, P; plasmid.

Plant growth analysis

To assess growth parameters of the generated transgenic events, plant height, pseudostem girth, total leaf area and number of functional leaves were evaluated in eight randomly selected transgenic events and non-transgenic control plants. All plants showed normal growth with no morphological abnormalities. No significant differences (p<0.05) in plant height, pseudostem girth, and total leaf area were observed between the transgenic events and the non-transgenic control plants (Fig 3A–3D), indicating that overexpression of the AtEFR gene in transgenic banana did not alter plant growth.

Fig 3 — (A) Plant height, B) Pseudostem girth, (C) Number of functional leaves, (D) Total leaf area. Data are presented as means ± standard deviation. Bars with different letters are significantly different at p<0.05 according to Fisher’s HSD test (n = 3).

Evaluation of transgenic banana events for resistance to banana Xanthomonas wilt

Thirty-one transgenic events were evaluated through a greenhouse bioassay for disease resistance compared to non-transgenic control plants. Significant differences were observed among the transgenic and non-transgenic control events regarding the number of days to the appearance of the first symptom and the number of days to complete wilting of plants. BXW disease symptoms, such as necrosis and wilting of leaves, appeared in non-transgenic control plants at 16 dpi, whereas transgene-positive plants showed symptoms at only 18 to 42 dpi (Table 1). None of the transgene-positive plants showed complete resistance to BXW disease. Even though several transgene-positive plants showed disease symptoms, disease progression was significantly slower than in control plants. Complete wilting was observed in control plants after an average of 22 dpi, compared to transgene-positive plants, which started to collapse 25 dpi, with the majority dying 30 dpi. Out of the 31 events evaluated, 18 events were found to exhibit partial resistance (50–75%) compared to control non-transgenic plants (Table 1, Fig 4A & 4B).

Table 1. Greenhouse evaluation of transgenic events of banana cultivar ‘dwarf Cavendish’ expressing AtEFR gene for resistance against Xanthomonas campestris pv. musacearum.

Line number	Mean number of days for appearance of first symptoms	Mean number of days for complete wilting	Percent resistance	Disease rating
T1	22.5±7.8^bc	NCW	75.4±5.4^bc	PR
T2	27.0±2.83^b	NCW	66.7±9.5^b	PR
T3	29.5±0.7^b	42.5±6.4^a	33.3±10.5^a	S
T4	36.0±2.83^a	NCW	66.7±10.5^b	PR
T5	20.5±2.12^bc	NCW	75.0±6.9^bc	PR
T6	42.5±2.12^a	NCW	58.3±7.8^ab	PR
T7	20±1.5^bc	NCW	66.7±9.5^b	PR
T8	18±2.1^c	NCW	50 ±10.5^ab	PR
T9	21.0±2.83^bc	33.5±2.12^ab	33.3±10.5^a	S
T10	22.0±0.7^bc	NCW	71.4±9.0^bc	PR
T11	27.0±0.0^b	NCW	66.7±10.5^b	PR
T12	28.5±14.8^b	31.0±2.6^abc	38.1±9.5^a	S
T13	18.3±1.5^c	26.3±2.1^bc	0^a	S
T14	21.0±2.8^bc	NCW	66.7±10.5^b	PR
T15	24.0±1.4^bc	38.0±2.6^ab	47.6±9.9^ab	S
T16	21.5±2.1^bc	29.0±2.8^bc	33.3±10.5^a	S
T17	20±3.1^bc	NCW	50±9.9^ab	PR
T18	21.0±2.8^bc	NCW	66.7±10.5^b	PR
T19	22.0±2.1^bc	NCW	66.7±10.5^b	PR
T20	20.5±3.5^bc	33.0±2.8^ab	33.3±9.5^a	S
T21	28.5±10.^6b	43.0±14.1^a	33.3±9.9^a	S
T22	19.0±0.0^bc	25.0±2.8b^c	33.3±7.5^a	S
T23	29.0±9.9^b	NCW	66.7±9.5^b	PR
T24	24.0±4.2^bc	NCW	66.7±6.5^b	PR
T25	23.0±0.0^bc	34±2.6^ab	41.7±9.0^ab	S
T26	28.3±2.1^b	NCW	66.7±10.5^b	PR
T27	25.5±3.1^b	NCW	66.7±10.5^b	PR
T28	21.0±1.8^bc	NCW	66.7±10.5^b	PR
T29	25.5±2.8^b	35±2.0^ab	33.3±9.5^a	S
T30	27.0±0.0^b	32±2.8^ab	33.3±9.5^a	S
T31	22.5±0.7^bc	NCW	66.7±10.5^b	PR
Control	16.3±1.2^c	22.0±2.0^c	0^a	S

Open in a new tab

Means followed by the same superscript letter in the same column are not significantly different according to Fisher HSD test at p<0.05

Data are presented as means±standard diviation (SD). NS; no symptoms

NCW; no complete wilting

S; suseptible

PR; partial resistance.

Fig 4 — (A) Transgenic banana event T7 showing partial resistance to BXW disease, (B) Non-transgenic control plants showing complete wilting due to BXW disease. Photographs were taken at 60 days post inoculations (dpi).

Testing transgenic banana events for oxidative burst

To assess whether the transgenic events exhibited enhanced production of reactive oxygen species upon pathogen infection, the leaves of transgenic event T5 and non-transgenic control were infiltrated with either sterile water or 250 nM elf18 for 2 hpi, followed by diaminobenzidine (DAB) staining to detect the accumulation of hydrogen peroxide. Positive-transgenic plants infiltrated with elf18 exhibited more intense browning than the mock-treated control and transgenic plants (Fig 5A & 5B) suggesting that the expression of AtEFR confers elf18 perception and subsequent activation of early signaling immune outputs in the transgenic plants.

Fig 5 — A) Photomicrographs showing the difference in browning intensity between the leaves of transgenic events compared to non-transgenic control plants, (B) Graphical representation of browning intensity of non-transgenic control and transgenic leaves after elf18 infiltration followed by DAB staining. Error bars represent the standard error of the mean of three independent biological replicates.

Relative expression of AtEFR gene among transgenic events

The relative expression of the AtEFR transgene was assessed through reverse-transcriptase (RT) quantitative PCR (RT-qPCR) assays in seven transgenic events compared to non-transgenic control plants. The seven transgenic events were selected based on their level of disease resistance in the glasshouse, ranging from 33% resistance in T3 event to 75% resistance in T1 and T5 event (Table 1). Variations in transcript levels were observed between the various transgenic events tested. For example, T5 event showed the highest level of AtEFR gene expression, whereas the lowest gene expression was observed in T3 event (Fig 6A–6C). No EFR expression was detected in non-transgenic control plants.

Fig 6 — (A) Reverse-transcriptase (RT)-PCR products corresponding to 100 bp *AtEFR* gene fragment, (B) RT-PCR products corresponding to *Musa 25s* gene (internal control), (C) Transcription level of *AtEFR* in the transgenic bananas as determined using qRT-PCR. Data shown are fold induction relative to the non-transgenic control and were normalized against the internal control gene *Musa 25s*. Data presented are mean± standard deviation (SD) of three replicate experiments. Bars with different letters are significantly different at p<0.05 according to *Fisher’s* HSD test. M; 100-base pair marker; T; Transgenic event expressing *AtEFR*, C; non-transgenic control.

Relative expression of defense-related genes in transgenic banana events

The transgenic T5 event with 75% resistance was infiltrated with 250 nM elf18, and the relative expression of six selected defense marker genes (MaWRKY-22 like, MaPR1-like, MaPR2-like, MaPR3-like, MaPR4-like, and MaPR5-like) was evaluated at 1, 2, and 3 h time points, relative to the water-treated replicates. Among the tested defense-related genes, MaWRKY-22-like, MaPR1-like and MaPR3-like were significantly upregulated in AtEFR transgene-positive plants relative to non-transgenic control plants. MaWRKY-22-like was highly expressed mainly at 1h post-infiltration (hpi), after which its expression reduced significantly. At 3 hpi, its expression was not substantially different from that of the non-transgenic control. Similarly, MaPR3-like was upregulated at all the time points, but significantly at 1 hpi. Meanwhile, the expression of MaPR1-like and MaPR2-like was significantly higher at 3 hpi. Notably, no significant increase in the expression of MaPR4-like and MaPR5-like was observed at all time points, compared with the non-transgenic control (Fig 7A–7C).

Fig 7 — Expression profile of defense-related genes induced at (A) 1 h post inoculation (hpi), (B) 2 hpi, and (C) 3 hpi following infiltration with 250 nM elf18 peptide in transgenic line T5 and non-transgenic control as revealed by qRT-PCR. Results are presented as fold induction relative to water treatment and normalized to internal control *Musa 25s* gene. Data presented are mean values ± standard deviation (SD) from three replicate experiments. Bars with different letters are significantly different at p<0.05 according to *Fisher’s* HSD test.

Bacterial population analysis of transgenic banana events

In planta bacterial population analysis was performed with two transgene-positive plants (T5 and T7) and non-transgenic control plants to determine differences in the Xcm growth rate post inoculation. Samples were collected from each plant at specific time points following inoculation with Xcm and cultured on a YPGA medium to examine the bacterial population. No significant difference in bacterial titers were observed between the control and transgenic plants up to 3 dpi (Fig 8A). However, a reduction in bacterial titers was observed in transgene-positive plants compared to non-transgenic control at 6, 9, 12, and 15 dpi (Fig 8A). Also, significant differences in the bacterial population were observed between the two transgenic events assayed. Transgenic event T7 exhibited a significantly lower level of bacterial population compared to event T5 at 15 dpi (Fig 8B).

Fig 8 — (A) Bacterial population analysis at 0 to 15 dpi with *Xcm*, (B) Bacterial population at 15 dpi. Data are presented as means ± standard deviations. Bars with different letters are significantly different at p<0.05 according to *Fisher’s* HSD test (n = 3).

Discussion

BXW disease continues to be the primary threat to banana production in the Great Lakes region of East Africa since its first report in Ethiopia. Considering that most bananas grown in these regions are mainly for subsistence, the impact can be severe. Developing banana varieties with disease resistance through conventional breeding is possible; however, the process has many limitations [31]. For example, most breeding programs use fertile diploids to hybridize triploid varieties or tetraploid intermediates. However, given that most cultivated varieties are triploids with low female and male fertility levels, it is not viable to repeatedly backcross the primary hybrid to the original variety. As such, the introgression of new traits into elite varieties is not practical. Also, being a clonally propagated crop, there are limited desirable traits in banana gene pool. In this case, there are no fertile diploids with resistance to BXW, except Musa balbisiana, which is not preferred due to its association with banana streak virus susceptibility [5].

The exploitation of natural plant defenses for crop improvement through genetic engineering is increasingly becoming an attractive option for improving clonally propagated crops like banana. Transferring PRRs across plant species that would not naturally interbreed is relatively a recent crop improvement approach for developing disease resistance [32]. Herein, the EFR gene from A. thaliana (AtEFR) was overexpressed in the susceptible banana cultivar ‘dwarf Cavendish,’ and the transgenic events were evaluated for their response against Xcm in greenhouse conditions. These assays revealed that transgenic bananas expressing AtEFR exhibited enhanced resistance against Xcm compared to non-transgenic controls.

Heterologous expression of some defense-related genes has been sometimes associated with constitutive expression of defense-related genes, which can have adverse effects on plant growth and development, and usually manifest as shoot and root growth inhibition, necrosis, or both [33, 34]. Such effects directly translate to yield losses. In this study, transgenic bananas expressing AtEFR were phenotypically similar to non-transgenic control plants, indicating no limitation to their normal growth characteristics. This further implies that constitutive expression of AtEFR in banana is not likely to affect yield, which is consistent with results previously reported in tomato [15, 35], rice [17, 36], potato [18], Medicago [37], apple [19] and sweet orange [20].

Pattern recognition receptors, such as EFR, confer basal resistance against adapted and non-adapted pathogens, and thus contribute to both basal and non-host disease resistances. The resistance usually is quantitative, but in some instances, it can lead to qualitative or complete resistance [38]. In this study, all the transgenic events showed quantitative resistance manifested by delay in symptom appearance and disease progression, as well as lower disease severity compared with the wildtype controls.

Substantial evidence shows that PRRs confer more broad-spectrum resistance to pathogens compared to R-genes, mainly because they recognize PAMPs, which are often conserved across a wide range of genera and play essential roles in the survival of the pathogens. PRRs are therefore also predicted to confer more durable resistance [32, 39]. However, in rare cases, variations in PAMP genes have been observed in adapted plant pathogens or commensals to evade recognition [40–42]. Also, some pathogens produce effectors that can suppress PTI in some plants [40, 43], but this has not been very effective as some level of PTI is usually retained, as exemplified by enhanced susceptibility to virulent pathogens in mutants of PRRs [44, 45].

EFR sense bacterial EF-Tu through recognition of the N-acetylated elf18 motif, thereby activating PTI [13]. In this study, transgenic bananas expressing AtEFR gained responsiveness to elf18 as exhibited by ROS accumulation and upregulation of defense marker genes following elf18 peptide infiltration. These findings indicate that AtEFR activity was retained after its transfer to banana and that necessary downstream signaling components are conserved between Arabidopsis and the monocotyledonous plant banana. Accordingly, we observed a significant reduction in the bacterial population at various time points following Xcm inoculation compared to control plants, indicating that the activation of early immune outputs (e.g. ROS, defense gene expression) mediated by the recognition of Xcm EF-Tu by EFR leads to enhanced resistance to this otherwise adapted pathogen.

Induction of pathogenesis-related (PR) genes is associated with systemic acquired resistance (SAR), a form of plant defense mechanism that begins from a localized region of a plant and spreads throughout the entire plant [46]. Induction of PR gene following elf18 treatment has been reported in transgenic rice expressing AtEFR [36]. However, it is not clear whether the upregulation of PR genes observed in this study is a secondary response to constitutive expression of AtEFR in banana. Therefore, further studies should be conducted to verify these findings.

In conclusion, this study indicates that AtEFR retains its activity in banana when ectopically expressed and confers resistance to Xcm. This further confirms that immune signaling networks downstream of PRRs are conserved across various plant families and thus interfamily transfer of PRRs can be used to engineer disease resistance. Given that the resistance observed herein was however quantitative, future studies on banana improvement against bacterial diseases should focus on combining AtEFR with other defense genes like Pflp and Hrap, which could lead to stronger and more durable resistance. The transgenic banana expressing AtEFR gene should be further tested under fields conditions for several generations to confirm the durable resistance.

Supporting information

S1 Table. List of primers used for qRT-PCR.

(DOCX)

Click here for additional data file.^{(14.4KB, docx)}

S1 Raw images

(PDF)

Click here for additional data file.^{(245.6KB, pdf)}

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This study was supported by the 2 Blades Foundation, the Gatsby Charitable Foundation, and the United States Agency for International Development (USAID). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Voora V, Larrea C, Bermudez S. Global Market Report: Bananas.:12. [Google Scholar]
2.Ainembabazi JH, Tripathi L, Rusike J, Abdoulaye T, Manyong V. Ex-Ante Economic Impact Assessment of Genetically Modified Banana Resistant to Xanthomonas Wilt in the Great Lakes Region of Africa. PloS One. 2015;10(9):e0138998. doi: 10.1371/journal.pone.0138998 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Tripathi L, Mwangi M, Abele S, Aritua V, Tushemereirwe WK, Bandyopadhyay R. Xanthomonas Wilt: A Threat to Banana Production in East and Central Africa. Plant Dis. 2009. Apr 6;93(5):440–51. doi: 10.1094/PDIS-93-5-0440 [DOI] [PubMed] [Google Scholar]
4.Kikulwe EM, Kyanjo JL, Kato E, Ssali RT, Erima R, Mpiira S, et al. Management of Banana Xanthomonas Wilt: Evidence from Impact of Adoption of Cultural Control Practices in Uganda. Sustainability. 2019. Jan;11(9):2610. [Google Scholar]
5.Dale J, Paul JY, Dugdale B, Harding R. Modifying Bananas: From Transgenics to Organics? Sustainability. 2017. Mar;9(3):333. [Google Scholar]
6.Tripathi L, Tripathi JN, Shah T, Muiruri KS, Katari M. Molecular Basis of Disease Resistance in Banana Progenitor Musa balbisiana against Xanthomonas campestris pv. musacearum. Sci Rep. 2019. May 7;9(1):7007. doi: 10.1038/s41598-019-43421-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Iskra-Caruana M line Duroy PO, Chabannes M, Muller E. The common evolutionary history of badnaviruses and banana. Infect Genet Evol. 2014. Jan 1;21:83–9. doi: 10.1016/j.meegid.2013.10.013 [DOI] [PubMed] [Google Scholar]
8.Nakato GV, Christelová P, Were E, Nyine M, Coutinho TA, Doležel J, et al. Sources of resistance in Musa to Xanthomonas campestris pv. musacearum, the causal agent of banana xanthomonas wilt. Plant Pathol. 2019;68(1):49–59. [Google Scholar]
9.Nicaise V. Boosting innate immunity to sustainably control diseases in crops. Curr Opin Virol. 2017. Oct 1;26:112–9. doi: 10.1016/j.coviro.2017.07.030 [DOI] [PubMed] [Google Scholar]
10.Ngou BPM, Ding P, Jones JDG. Thirty years of resistance: Zig-zag through the plant immune system. Plant Cell. 2022. Apr 26;34(5):1447–78. doi: 10.1093/plcell/koac041 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Zipfel C. Plant pattern-recognition receptors. Trends Immunol. 2014. Jul;35(7):345–51. doi: 10.1016/j.it.2014.05.004 [DOI] [PubMed] [Google Scholar]
12.Gómez-Gómez L, Boller T. FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol Cell. 2000. Jun;5(6):1003–11. doi: 10.1016/s1097-2765(00)80265-8 [DOI] [PubMed] [Google Scholar]
13.Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones JDG, Boller T, et al. Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell. 2006. May 19;125(4):749–60. doi: 10.1016/j.cell.2006.03.037 [DOI] [PubMed] [Google Scholar]
14.Sprinzl M. Elongation factor Tu: a regulatory GTPase with an integrated effector. Trends Biochem Sci. 1994. Jun 1;19(6):245–50. doi: 10.1016/0968-0004(94)90149-x [DOI] [PubMed] [Google Scholar]
15.Lacombe S, Rougon-Cardoso A, Sherwood E, Peeters N, Dahlbeck D, van Esse HP, et al. Interfamily transfer of a plant pattern-recognition receptor confers broad-spectrum bacterial resistance. Nat Biotechnol. 2010. Apr;28(4):365–9. doi: 10.1038/nbt.1613 [DOI] [PubMed] [Google Scholar]
16.Schoonbeek H jan Wang HH, Stefanato FL, Craze M, Bowden S, Wallington E, et al. Arabidopsis EF-Tu receptor enhances bacterial disease resistance in transgenic wheat. New Phytol. 2015;206(2):606–13. doi: 10.1111/nph.13356 [DOI] [PubMed] [Google Scholar]
17.Lu F, Wang H, Wang S, Jiang W, Shan C, Li B, et al. Enhancement of innate immune system in monocot rice by transferring the dicotyledonous elongation factor Tu receptor EFR. J Integr Plant Biol. 2015. Jul;57(7):641–52. doi: 10.1111/jipb.12306 [DOI] [PubMed] [Google Scholar]
18.Boschi F, Schvartzman C, Murchio S, Ferreira V, Siri MI, Galván GA, et al. Enhanced Bacterial Wilt Resistance in Potato Through Expression of Arabidopsis EFR and Introgression of Quantitative Resistance from Solanum commersonii. Front Plant Sci [Internet]. 2017. [cited 2023 Jun 9];8. Available from: https://www.frontiersin.org/articles/10.3389/fpls.2017.01642 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Piazza S, Campa M, Pompili V, Costa LD, Salvagnin U, Nekrasov V, et al. The Arabidopsis pattern recognition receptor EFR enhances fire blight resistance in apple. bioRxiv. 2021. Jan 22;2021.January.22.427734. doi: 10.1038/s41438-021-00639-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Mitre LK, Teixeira-Silva NS, Rybak K, Magalhães DM, Souza-Neto RR de, Robatzek S, et al. The Arabidopsis immune receptor EFR increases resistance to the bacterial pathogens Xanthomonas and Xylella in transgenic sweet orange. bioRxiv. 2021. Jan 22;2021.January.22.427732. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Tripathi L, Mwaka H, Tripathi JN, Tushemereirwe WK. Expression of sweet pepper Hrap gene in banana enhances resistance to Xanthomonas campestris pv. musacearum. Mol Plant Pathol. 2010. Nov;11(6):721–31. doi: 10.1111/j.1364-3703.2010.00639.x [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Namukwaya B, Tripathi L, Tripathi JN, Arinaitwe G, Mukasa SB, Tushemereirwe WK. Transgenic banana expressing Pflp gene confers enhanced resistance to Xanthomonas wilt disease. Transgenic Res. 2012. Aug;21(4):855–65. doi: 10.1007/s11248-011-9574-y [DOI] [PubMed] [Google Scholar]
23.Tripathi L, Tripathi JN, Kiggundu A, Kori S, Shotkoski F, Tushemereirwe WK. Field trial of Xanthomonas wilt disease-resistant bananas in East Africa. Nature Biotechnology 2014; 32:868–870. doi: 10.1038/nbt.3007 [DOI] [PubMed] [Google Scholar]
24.Tripathi JN, Lorenzen J, Bahar O, Ronald P, Tripathi L. Transgenic expression of the rice Xa21 pattern-recognition receptor in banana (Musa sp.) confers resistance to Xanthomonas campestris pv. musacearum. Plant Biotechnol J. 2014. Aug;12(6):663–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Tripathi JN. Genetic Engineering of Banana Using Nonexpressor of Pathogenesis Related Gene for Resistance to Xanthomonas Wilt and Fusarium Wilt Diseases [Internet] [Thesis]. Kenyatta University; 2018. [cited 2023 Jul 17]. Available from: https://ir-library.ku.ac.ke/handle/123456789/19013 [Google Scholar]
26.Tripathi JN, Oduor RO, Tripathi L. A High-Throughput Regeneration and Transformation Platform for Production of Genetically Modified Banana. Front Plant Sci. 2015;6:1025. doi: 10.3389/fpls.2015.01025 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Stewart VIA LE. A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications. Rapid CTAB DNA Isol Tech Useful RAPD Fingerprinting PCR Appl. 1993;14(5):748–51. [PubMed] [Google Scholar]
28.Kumar N, Krishnamoorthy V., Nalina L., Soorianathasundharam K. A new factor for estimating total leaf area in banana [Internet]. 2002. [cited 2020 Dec 17]. Available from: https://www.musalit.org/seeMore.php?id=14204 [Google Scholar]
29.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2- ΔΔCT method. methods. 2001;25(4):402–8. [DOI] [PubMed] [Google Scholar]
30.Daudi A, O’Brien JA. Detection of Hydrogen Peroxide by DAB Staining in Arabidopsis Leaves. Bio-Protoc [Internet]. 2012. [cited 2020 Dec 19];2(18). Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4932902/ [PMC free article] [PubMed] [Google Scholar]
31.Batte M, Swennen R, Uwimana B, Akech V, Brown A, Tumuhimbise R, et al. Crossbreeding East African Highland Bananas: Lessons Learnt Relevant to the Botany of the Crop After 21 Years of Genetic Enhancement. Front Plant Sci [Internet]. 2019. [cited 2020 Dec 22];10. Available from: https://www.frontiersin.org/articles/10.3389/fpls.2019.00081/full [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Boutrot F, Zipfel C. Function, Discovery, and Exploitation of Plant Pattern Recognition Receptors for Broad-Spectrum Disease Resistance. Annu Rev Phytopathol. 2017. Aug 4;55:257–86. doi: 10.1146/annurev-phyto-080614-120106 [DOI] [PubMed] [Google Scholar]
33.Gurr SJ, Rushton PJ. Engineering plants with increased disease resistance: what are we going to express? Trends Biotechnol. 2005. Jun;23(6):275–82. doi: 10.1016/j.tibtech.2005.04.007 [DOI] [PubMed] [Google Scholar]
34.Hammond-Kosack KE, Parker JE. Deciphering plant-pathogen communication: fresh perspectives for molecular resistance breeding. Curr Opin Biotechnol. 2003. Apr;14(2):177–93. doi: 10.1016/s0958-1669(03)00035-1 [DOI] [PubMed] [Google Scholar]
35.Kunwar S, Iriarte F, Fan Q, Evaristo da Silva E, Ritchie L, Nguyen NS, et al. Transgenic Expression of EFR and Bs2 Genes for Field Management of Bacterial Wilt and Bacterial Spot of Tomato. Phytopathology®. 2018. Jun 20;108(12):1402–11. doi: 10.1094/PHYTO-12-17-0424-R [DOI] [PubMed] [Google Scholar]
36.Schwessinger B, Bahar O, Thomas N, Holton N, Nekrasov V, Ruan D, et al. Transgenic Expression of the Dicotyledonous Pattern Recognition Receptor EFR in Rice Leads to Ligand-Dependent Activation of Defense Responses. PLOS Pathog. 2015. Mar 30;11(3):e1004809. doi: 10.1371/journal.ppat.1004809 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Pfeilmeier S, George J, Morel A, Roy S, Smoker M, Stransfeld L, et al. Expression of the Arabidopsis thaliana immune receptor EFR in Medicago truncatula reduces infection by a root pathogenic bacterium, but not nitrogen-fixing rhizobial symbiosis. Plant Biotechnol J. 2019. Mar;17(3):569–79. doi: 10.1111/pbi.12999 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Ranf S. Pattern Recognition Receptors—Versatile Genetic Tools for Engineering Broad-Spectrum Disease Resistance in Crops. Agronomy. 2018. Aug;8(8):134. [Google Scholar]
39.van Esse HP, Reuber TL, van der Does D. Genetic modification to improve disease resistance in crops. New Phytol. 2020;225(1):70–86. doi: 10.1111/nph.15967 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Buscaill P, van der Hoorn RAL. Defeated by the nines: nine extracellular strategies to avoid microbe-associated molecular patterns recognition in plants. Plant Cell. 2021. Jul 1;33(7):2116–30. doi: 10.1093/plcell/koab109 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Colaianni NR, Parys K, Lee HS, Conway JM, Kim NH, Edelbacher N, et al. A complex immune response to flagellin epitope variation in commensal communities. Cell Host Microbe. 2021. Apr 14;29(4):635–649.e9. doi: 10.1016/j.chom.2021.02.006 [DOI] [PubMed] [Google Scholar]
42.Parys K, Colaianni NR, Lee HS, Hohmann U, Edelbacher N, Trgovcevic A, et al. Signatures of antagonistic pleiotropy in a bacterial flagellin epitope. Cell Host Microbe. 2021. Apr 14;29(4):620–634.e9. doi: 10.1016/j.chom.2021.02.008 [DOI] [PubMed] [Google Scholar]
43.Cui H, Xiang T, Zhou JM. Plant immunity: a lesson from pathogenic bacterial effector proteins. Cell Microbiol. 2009. Oct;11(10):1453–61. doi: 10.1111/j.1462-5822.2009.01359.x [DOI] [PubMed] [Google Scholar]
44.Nguyen QM, Iswanto ABB, Son GH, Kim SH. Recent Advances in Effector-Triggered Immunity in Plants: New Pieces in the Puzzle Create a Different Paradigm. Int J Mol Sci. 2021. Jan;22(9):4709. doi: 10.3390/ijms22094709 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Thordal-Christensen H. A holistic view on plant effector-triggered immunity presented as an iceberg model. Cell Mol Life Sci. 2020;77(20):3963–76. doi: 10.1007/s00018-020-03515-w [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Durrant WE, Dong X. Systemic acquired resistance. Annu Rev Phytopathol. 2004;42:185–209. doi: 10.1146/annurev.phyto.42.040803.140421 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0290884.r001

Decision Letter 0

Eugenio Llorens

10 Jul 2023

PONE-D-23-18202Transgenic expression of Arabidopsis ELONGATION FACTOR-TU RECEPTOR (AtEFR) gene in banana enhances resistance against Xanthomonas campestris pv. musacearumPLOS ONE

Dear Dr. Tripathi,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Aug 24 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Eugenio Llorens

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the field site access and, if no permits were required, a brief statement explaining why.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

"This study was supported by the 2 Blades Foundation, the Gatsby Charitable Foundation, and the United States Agency for International Development (USAID)."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"This study was supported by the 2 Blades Foundation, the Gatsby Charitable Foundation, and the United States Agency for International Development (USAID). "

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. Please include a copy of Table 2 which you refer to in your text on page 24.

6. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Line 43: It is suggested to expand on how the disease is spread in the field and to briefly outline the current forms of control.

Line 44: the background of conventional breeding and sources of resistance seems underdeveloped. It is suggested to review the article by Nakato et al. (2019) 'Sources of resistance in Musa to Xanthomonas campestris pv. musacearum, the causal agent of banana Xanthomonas wilt'. Plant Pathology, 68, 49-59. Doi: 10.1111/ppa.12945. These authors report the evaluation of 72 banana accessions representative of Musa diversity for response to BXW by artificial inoculation.

Some of the accessions reported in Nakato et al. (2019) e.g., M. acuminata subsp. zebrina could even be a good reference to contrast the effect of the atEFR gene with existing banana germplasm reported to be resistant/tolerant to BXW.

Line 159: It is suggested to indicate the sublineage of the Xcm colony used in the assay.

Line 179: Please check the expression. In planta bacterial population analysis?

Line 276: The southern indicates the number of insertions in the genome, and although it is correct that it could indicate the number of copies in the genome, it is very risky in the case of a single copy. It would be more correct to say that the number of copies of the transgene incorporated in the different events ranged from at least one to multiple (Fig. 1F). This is simply an observation and is at the discretion of the authors.

Line 337: Please specify the time (days) where complete wilting was observed in all accessions or instead substantiate why a longer time scale was not used for this species which is perennial.

Line 360: Improve the expression of the abscissa legend in Figure 4 C.

Line 390: Please, check the expression. In planta bacterial population analysis was performed...

Line 427: The EFR gene of A. thaliana (AtEFR) was previously overexpressed in several annual and some perennial species. From the point of view of gene efficacy, the assay shown in Table 1 seems more suitable for annual species, not so much in perennials. A more prolonged evaluation in time would seem more appropriate to know the effect of the AtEFR gene in banana cultivation. Moreover, the authors' opinion about their expectations of the durability of resistance in banana cultivation would be desirable.

Line 435: Boschi et al. (2017) is quoted in two different ways: 17 and 36, please leave one alone. Check other quotes, e,g, 19 and 38.

Reviewer #2: Banana Xanthomonas wilt (BXW) is a big threat to banana industry in East and Central Africa. This paper described a reserch on generating transgenic banana plants expressing the AtEFR gene. The authors also evaluated their resistance against XCW under greenhouse conditions. Although the function of EFR gene has been investigated, the application in banana is not carried out yet. Therefore, this research is still meaningful and significant to the banana community. After reviewing, I suggest this paper can be accepted for publication in PLOS ONE. There are some suggestions or comments as below:

1. The scientific name of banana cultivar dwarf Cavendish is needed to be added, Musa spp. Cavendish group AAA.

2. For experimental design, how many plantets per replicate?

3. In Fig 3, the The quality of the figures is not so good for publication. Please try to improve them.

Reviewer #3: The manuscript reports the generation of transgenic lines of banana expressing the EFR receptor from Arabidopsis thaliana and evaluates their resistance against the bacterial pathogen Xanthomonas campestris pv. musacearum (Xcm). The research problem is relevant since banana bacterial wilt caused by Xcm is considered the most devastating disease of banana in East and Central Africa. Conventional breeding for resistance in this crop is hampered by the lack of resistance sources, highlighting the potential of transgenic approaches. The interfamily transfer of the EF-Tu receptor (EFR) from Arabidopsis thaliana has shown to confer PAMP perception and to increase pathogens resistance in several crops in previous studies. The work performed involved the generation and molecular verification of the transgenic lines, the resistance evaluation under greenhouse conditions and indirect verification of the activity of the At EFR receptor through expression analysis of defense-related genes and ROS production after pathogen infection.

Overall, the work is acceptable for publication but structuring of the manuscript should be improved to enhance understanding of the strategy and scope of the activities carried out.

- Include background information on the use of other transgenic approaches in banana for the control of Xcm.

- Why Figure legends are widespread along the manuscript and not necessarily in accordance with the text? Is really confused to follow the reading in this way.

- The term “overexpressing AtEFR” is not correct and is repeated several times in the manuscript. This term is used to refer to gene expression in quantitative and relative terms from one condition to another. In this case the AtEFR gene is not overexpressed in the transgenic lines compared to the control plants (in fact in wt plants the AtEFR gene is not present and therefore not expressed).

- The number and identity of transgenic lines used in the different activities performed varied without any justification or clarification of the selection criteria. Some activities were carried out with all the lines obtained and others with different subsets of selected lines that do not coincide with each other.

- Additional information should be included in resistance assays descriptions: controls used (non-transgenic plants, non-inoculated plants), experimental design (randomized complete design, block design, etc).

- Why AtEFR expression was assessed through both RT-PCR and RT-qPCR?

- Additional information for RT-qPCR analysis is required (primers, cycling conditions, etc).

- Results of the southern blot assay are confused and not clearly presented. It is striking that only one line showed a single copy of the transgene (T5). The other lines showed multiple copies which is not a desirable trait. This fact should be made explicit in the text. Further characterization of these lines is also not justified. A more suitable way for copy number determination should be performed to confirm these results.

- The relative expression of AtEFR gene among transgenic events is part of their molecular verification but is presented separately after the resistance and the ROS assay.

- Figures must be organized logically and referenced in an orderly fashion in the text. Some figures cover more than one essay and are referred to in different sections of the manuscript, which makes it difficult to follow.

- In the case of Figure 1, I suggest separating the E/F panels referring to molecular verification of the lines.

- Figure 3 should also be split in two. One part of the figure refers to the results of the resistance assays, showing the symptoms observed for one of the transgenic lines categorized as PR (T7) compared to the control. The other part of the figure shows the results of the ROS assay performed for the transgenic line T5. It is not understandable why both are shown in the same figure when they refer to different assays and transgenic lines.

- Plant growth was analyzed for different transgenic lines but not for T5, the only one that carries the AtEFR gene in a single copy. This should be performed to complete the characterization of this line.

- Several references are repeated (Lu et al., Lacombe et al., Boschi et al., Piazza et al, Mitre et al., etc). Revise all.

Other minor corrections:

Lane 48: “BB genome”, “B genome”, explain or modify.

Lane 163: “bacterial culture”. You mean “bacterial inoculum” or “bacterial suspension”?

Lanes 163-164: remove “After inoculation” (is repeated at the end of the sentence)

Lane 183: Specify if the leaf-mid rib sections (1 cm) included the inoculation point or not.

Lane 213: “section 4.6”??

Lanes 238-239: “between various transgenic events”…and control non-transgenic plants?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Ou Sheng

Reviewer #3: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2023 Sep 1;18(9):e0290884. doi: 10.1371/journal.pone.0290884.r002

Author response to Decision Letter 0

5 Aug 2023

Dear Editor and Reviewers,

Thank you very much for considering our manuscript entitled ‘Transgenic expression of Arabidopsis ELONGATION FACTOR-TU RECEPTOR (AtEFR) gene in banana enhances resistance to Xanthomonas campestris’ for publication in your journal. We are also grateful for your constructive feedback on the manuscript. We have adopted your suggestions and corrected the manuscript with track changes. We now hope that the manuscript meets your expectation.

Our point-to-point response to the reviewer's comments is as follows:

Reviewer #1

1. It is suggested to expand on how the disease is spread in the field and to briefly outline the current forms of control.

Response: The information has been added in the introduction section.

2. The background of conventional breeding and sources of resistance seems underdeveloped. It is suggested to review the article by Nakato et al. (2019) 'Sources of resistance in Musa to Xanthomonas campestris pv. musacearum, the causal agent of banana Xanthomonas wilt'. Plant Pathology, 68, 49-59. Doi: 10.1111/ppa.12945. These authors report the evaluation of 72 banana accessions representative of Musa diversity for response to BXW by artificial inoculation. Some of the accessions reported in Nakato et al. (2019) e.g., M. acuminata subsp. zebrina could even be a good reference to contrast the effect of the atEFR gene with existing banana germplasm reported to be resistant/tolerant to BXW.

Response: This information is added to the introduction section. We have also explained how the knowledge from BXW-resistant Musa balbisiana can be transferred to BXW-susceptible banana cultivars.

3. Line 159: It is suggested to indicate the sublineage of the Xcm colony used in the assay.

Response: Xcm isolates from Uganda (sublineage 2) was used in this study. It has been added in the revised manuscript.

4. Line 179: Please check the expression. In planta bacterial population analysis?

Response: It has been revised.

5. Line 276: The southern indicates the number of insertions in the genome, and although it is correct that it could indicate the number of copies in the genome, it is very risky in the case of a single copy. It would be more correct to say that the number of copies of the transgene incorporated in the different events ranged from at least one to multiple (Fig. 1F). This is simply an observation and is at the discretion of the authors

Response: The sentence has been revised accordingly.

6. Line 360: Improve the expression of the abscissa legend in Figure 4 C.

Response: We have revised the figure legends (Figure 4C is now 6C).

7. Line 390: Please, check the expression. In planta, bacterial population analysis was performed.

Response: It has been revised.

8. Line 427: The EFR gene of A. thaliana (AtEFR) was previously overexpressed in several annual and some perennial species. From the point of view of gene efficacy, the assay shown in Table 1 seems more suitable for annual species, not so much in perennials. A more prolonged evaluation in time would seem more appropriate to know the effect of the AtEFR gene in banana cultivation. Moreover, the author’s opinion about their expectations of the durability of resistance in banana cultivation would be desirable.

Response: We have added a sentence in the discussion section to state that these transgenic banana will be further evaluated under field conditions for several generations to check the durability of disease resistance.

9. Line 435: Boschi et al. (2017) is quoted in two different ways: 17 and 36, please leave one alone. Check other quotes, e,g, 19 and 38.

Response: It has been corrected.

Reviewer #2

1. The scientific name of banana cultivar dwarf Cavendish is needed to be added, Musa spp. Cavendish group AAA.

Response: It has been added.

2. For experimental design, how many plantets per replicate?

Response: Three replicates were used for each transgenic line, this information has been included in the text.

3. In Fig 3, the The quality of the figures is not so good for publication. Please try to improve them.

Response: The figures have been revised (Fig 3 in now fig 4)

Reviwer #3

1. Include background information on the use of other transgenic approaches in banana for the control of Xcm.

Response: It has been added.

2. Why Figure legends are widespread along the manuscript and not necessarily in accordance with the text? Is really confused to follow the reading in this way.

Response: We have rearranged the figure legends to follow a logical sequence. Please note that the journal requires that we cite the figure legend immediately after its first mention.

3. The term “overexpressing AtEFR” is not correct and is repeated several times in the manuscript. This term is used to refer to gene expression in quantitative and relative terms from one condition to another. In this case the AtEFR gene is not overexpressed in the transgenic lines compared to the control plants (in fact in wt plants the AtEFR gene is not present and therefore not expressed).

Response: It has been revised.

4. The number and identity of transgenic lines used in the different activities performed varied without any justification or clarification of the selection criteria. Some activities were carried out with all the lines obtained and others with different subsets of selected lines that do not coincide with each other.

Response: The lines generated were subjected to PCR and southern blot analyses. The lines which were PCR positive were acclimatized and evaluated in the greenhouse. Lines for RT-PCR were selected based on their level of BXW resistance in the greenhouse. We selected lines that showed the highest BXW resistance and those that showed the least resistance for qRT-PCR analysis. For bacterial population assay, we selected the line which responded best in the bioassay (T5), the one which showed moderate response (T7), and the non-transgenic control. For the ROS assay and analysis of defense-related genes, we selected the line that had a single gene copy, showed the best response in the glasshouse and qRT-PCR (T5).

5. Additional information should be included in resistance assays descriptions: controls used (non-transgenic plants, non-inoculated plants), experimental design (randomized complete design, block design, etc).

Response: We have added the details.

6. Why AtEFR expression was assessed through both RT-PCR and RT-qPCR?

Response: RT-PCR was performed to check expression, but further quantitative expression was assessed through qRT-PCR.

7. Additional information for RT-qPCR analysis is required (primers, cycling conditions, etc).

Response: We have added the additional information. Primer details can be found in Table S1, which have been cited in the relevant sections.

8. Results of the southern blot assay are confused and not clearly presented. It is striking that only one line showed a single copy of the transgene (T5). The other lines showed multiple copies which is not a desirable trait. This fact should be made explicit in the text. Further characterization of these lines is also not justified. A more suitable way for copy number determination should be performed to confirm these results.

Response: It is indeed true that multiple copy is not a desirable trait. Also, Southern blot is not the most accurate approach for determining copy number. However, it is noteworthy that this is a proof of concept study mainly to determine if AtEFR can function in banana and if it can enhance resistance to EFR. The Southern blot was performed purposely to confirm gene integration and provide some rough information on the copy number. We will further evaluate these lines under field conditions and, if the resistance is sustained, conduct new transformation experiments using prefered banana cultivar in East Africa for product development. At this stage, we will conduct a more elaborate copy number analysis, incorporating other methods, especially because regulators do not prefer lines with multiple copy numbers.

9. The relative expression of AtEFR gene among transgenic events is part of their molecular verification but is presented separately after the resistance and the ROS assay.

Response: The verification of transgenic events was performed using PCR and Southern and then evaluated for disease resistance. We further checked gene expression in the selective transgenic events with varied resistance levels to check the correlation between expression and disease resistance. Variations in transcript levels were observed between the various transgenic events tested. For example, T5 event showed the highest level of AtEFR gene expression, whereas the lowest gene expression was observed in T3 event.

10. Figures must be organized logically and referenced in an orderly fashion in the text. Some figures cover more than one essay and are referred to in different sections of the manuscript, which makes it difficult to follow. - In the case of Figure 1, I suggest separating the E/F panels referring to molecular verification of the lines. Figure 3 should also be split in two. One part of the figure refers to the results of the resistance assays, showing the symptoms observed for one of the transgenic lines categorized as PR (T7) compared to the control. The other part of the figure shows the results of the ROS assay performed for the transgenic line T5. It is not understandable why both are shown in the same figure when they refer to different assays and transgenic lines.

Response: The figures have been re-arranged to ensure a logical flow.

11. Plant growth was analyzed for different transgenic lines but not for T5, the only one that carries the AtEFR gene in a single copy. This should be performed to complete the characterization of this line.

Response: Plant growth data was taken of eight randomly selected events prior to disease assay to check if expression of AtEFR has any negative impact on plant morphology. We did not observe any significant difference in the growth parameters of the transgenic events tested compared to the control non-transgenic plants. We felt that the eight events aree enough sample size to conclude that expression of AtEFR has no effect on plant growth. Therefore, we did not evaluated additional events for plant growth analysis. Anyways data will be collected for growth and agronomic parameters during confined field trials of the promising events.

12. Several references are repeated (Lu et al., Lacombe et al., Boschi et al., Piazza et al, Mitre et al., etc). Revise all.

Response: It has been corrected.

13. Lane 48: “BB genome”, “B genome”, explain or modify.

Response: BB is genomic group and B is the agenome.

14. Lane 163: “bacterial culture”. You mean “bacterial inoculum” or “bacterial suspension”?

Response: We meant bacterial suspension. This has been revised.

15. Lanes 163-164: remove “After inoculation” (is repeated at the end of the sentence)

Response: Done

16. Lane 183: Specify if the leaf-mid rib sections (1 cm) included the inoculation point or not.

Response: Yes, the mid-rib sections of the leaves were inoculated with the bacterial suspension.

17. Lane 213: “section 4.6”??

Response: It has been corrected.

18. Lanes 238-239: “between various transgenic events”…and control non-transgenic plants?

Response: It has been c

Attachment

Submitted filename: Response to reviewers.docx

Click here for additional data file.^{(24.2KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0290884.r003

Decision Letter 1

Eugenio Llorens

18 Aug 2023

Transgenic expression of Arabidopsis ELONGATION FACTOR-TU RECEPTOR (AtEFR) gene in banana enhances resistance against Xanthomonas campestris pv. musacearum

PONE-D-23-18202R1

Dear Dr. Tripathi,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Eugenio Llorens

Academic Editor

PLOS ONE

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Reviewer #1: Each of the comments have been answered satisfactorily and I believe that they have been interpreted correctly.

They have also responded correctly to the comments of other reviewers. This manuscript is considered suitable for publication in the journal.

Reviewer #2: The authors revised according to my previous suggestions. I suggest this paper can be accepted for publication.

Reviewer #3: Authors have adequately addressed the main comments raised in my previous review.

On my point of view the manuscript is now acceptable for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Ou Sheng

Reviewer #3: No

**********

PLoS One. doi: 10.1371/journal.pone.0290884.r004

Acceptance letter

Eugenio Llorens

25 Aug 2023

PONE-D-23-18202R1

Transgenic expression of Arabidopsis ELONGATION FACTOR-TU RECEPTOR (AtEFR) gene in banana enhances resistance against Xanthomonas campestris pv. musacearum

Dear Dr. Tripathi:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Eugenio Llorens

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. List of primers used for qRT-PCR.

(DOCX)

Click here for additional data file.^{(14.4KB, docx)}

S1 Raw images

(PDF)

Click here for additional data file.^{(245.6KB, pdf)}

Attachment

Submitted filename: Response to reviewers.docx

Click here for additional data file.^{(24.2KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0290884.ref001] 1.Voora V, Larrea C, Bermudez S. Global Market Report: Bananas.:12. [Google Scholar]

[pone.0290884.ref002] 2.Ainembabazi JH, Tripathi L, Rusike J, Abdoulaye T, Manyong V. Ex-Ante Economic Impact Assessment of Genetically Modified Banana Resistant to Xanthomonas Wilt in the Great Lakes Region of Africa. PloS One. 2015;10(9):e0138998. doi: 10.1371/journal.pone.0138998 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref003] 3.Tripathi L, Mwangi M, Abele S, Aritua V, Tushemereirwe WK, Bandyopadhyay R. Xanthomonas Wilt: A Threat to Banana Production in East and Central Africa. Plant Dis. 2009. Apr 6;93(5):440–51. doi: 10.1094/PDIS-93-5-0440 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref004] 4.Kikulwe EM, Kyanjo JL, Kato E, Ssali RT, Erima R, Mpiira S, et al. Management of Banana Xanthomonas Wilt: Evidence from Impact of Adoption of Cultural Control Practices in Uganda. Sustainability. 2019. Jan;11(9):2610. [Google Scholar]

[pone.0290884.ref005] 5.Dale J, Paul JY, Dugdale B, Harding R. Modifying Bananas: From Transgenics to Organics? Sustainability. 2017. Mar;9(3):333. [Google Scholar]

[pone.0290884.ref006] 6.Tripathi L, Tripathi JN, Shah T, Muiruri KS, Katari M. Molecular Basis of Disease Resistance in Banana Progenitor Musa balbisiana against Xanthomonas campestris pv. musacearum. Sci Rep. 2019. May 7;9(1):7007. doi: 10.1038/s41598-019-43421-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref007] 7.Iskra-Caruana M line Duroy PO, Chabannes M, Muller E. The common evolutionary history of badnaviruses and banana. Infect Genet Evol. 2014. Jan 1;21:83–9. doi: 10.1016/j.meegid.2013.10.013 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref008] 8.Nakato GV, Christelová P, Were E, Nyine M, Coutinho TA, Doležel J, et al. Sources of resistance in Musa to Xanthomonas campestris pv. musacearum, the causal agent of banana xanthomonas wilt. Plant Pathol. 2019;68(1):49–59. [Google Scholar]

[pone.0290884.ref009] 9.Nicaise V. Boosting innate immunity to sustainably control diseases in crops. Curr Opin Virol. 2017. Oct 1;26:112–9. doi: 10.1016/j.coviro.2017.07.030 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref010] 10.Ngou BPM, Ding P, Jones JDG. Thirty years of resistance: Zig-zag through the plant immune system. Plant Cell. 2022. Apr 26;34(5):1447–78. doi: 10.1093/plcell/koac041 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref011] 11.Zipfel C. Plant pattern-recognition receptors. Trends Immunol. 2014. Jul;35(7):345–51. doi: 10.1016/j.it.2014.05.004 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref012] 12.Gómez-Gómez L, Boller T. FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis. Mol Cell. 2000. Jun;5(6):1003–11. doi: 10.1016/s1097-2765(00)80265-8 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref013] 13.Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones JDG, Boller T, et al. Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell. 2006. May 19;125(4):749–60. doi: 10.1016/j.cell.2006.03.037 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref014] 14.Sprinzl M. Elongation factor Tu: a regulatory GTPase with an integrated effector. Trends Biochem Sci. 1994. Jun 1;19(6):245–50. doi: 10.1016/0968-0004(94)90149-x [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref015] 15.Lacombe S, Rougon-Cardoso A, Sherwood E, Peeters N, Dahlbeck D, van Esse HP, et al. Interfamily transfer of a plant pattern-recognition receptor confers broad-spectrum bacterial resistance. Nat Biotechnol. 2010. Apr;28(4):365–9. doi: 10.1038/nbt.1613 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref016] 16.Schoonbeek H jan Wang HH, Stefanato FL, Craze M, Bowden S, Wallington E, et al. Arabidopsis EF-Tu receptor enhances bacterial disease resistance in transgenic wheat. New Phytol. 2015;206(2):606–13. doi: 10.1111/nph.13356 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref017] 17.Lu F, Wang H, Wang S, Jiang W, Shan C, Li B, et al. Enhancement of innate immune system in monocot rice by transferring the dicotyledonous elongation factor Tu receptor EFR. J Integr Plant Biol. 2015. Jul;57(7):641–52. doi: 10.1111/jipb.12306 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref018] 18.Boschi F, Schvartzman C, Murchio S, Ferreira V, Siri MI, Galván GA, et al. Enhanced Bacterial Wilt Resistance in Potato Through Expression of Arabidopsis EFR and Introgression of Quantitative Resistance from Solanum commersonii. Front Plant Sci [Internet]. 2017. [cited 2023 Jun 9];8. Available from: https://www.frontiersin.org/articles/10.3389/fpls.2017.01642 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref019] 19.Piazza S, Campa M, Pompili V, Costa LD, Salvagnin U, Nekrasov V, et al. The Arabidopsis pattern recognition receptor EFR enhances fire blight resistance in apple. bioRxiv. 2021. Jan 22;2021.January.22.427734. doi: 10.1038/s41438-021-00639-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref020] 20.Mitre LK, Teixeira-Silva NS, Rybak K, Magalhães DM, Souza-Neto RR de, Robatzek S, et al. The Arabidopsis immune receptor EFR increases resistance to the bacterial pathogens Xanthomonas and Xylella in transgenic sweet orange. bioRxiv. 2021. Jan 22;2021.January.22.427732. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref021] 21.Tripathi L, Mwaka H, Tripathi JN, Tushemereirwe WK. Expression of sweet pepper Hrap gene in banana enhances resistance to Xanthomonas campestris pv. musacearum. Mol Plant Pathol. 2010. Nov;11(6):721–31. doi: 10.1111/j.1364-3703.2010.00639.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref022] 22.Namukwaya B, Tripathi L, Tripathi JN, Arinaitwe G, Mukasa SB, Tushemereirwe WK. Transgenic banana expressing Pflp gene confers enhanced resistance to Xanthomonas wilt disease. Transgenic Res. 2012. Aug;21(4):855–65. doi: 10.1007/s11248-011-9574-y [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref023] 23.Tripathi L, Tripathi JN, Kiggundu A, Kori S, Shotkoski F, Tushemereirwe WK. Field trial of Xanthomonas wilt disease-resistant bananas in East Africa. Nature Biotechnology 2014; 32:868–870. doi: 10.1038/nbt.3007 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref024] 24.Tripathi JN, Lorenzen J, Bahar O, Ronald P, Tripathi L. Transgenic expression of the rice Xa21 pattern-recognition receptor in banana (Musa sp.) confers resistance to Xanthomonas campestris pv. musacearum. Plant Biotechnol J. 2014. Aug;12(6):663–73. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref025] 25.Tripathi JN. Genetic Engineering of Banana Using Nonexpressor of Pathogenesis Related Gene for Resistance to Xanthomonas Wilt and Fusarium Wilt Diseases [Internet] [Thesis]. Kenyatta University; 2018. [cited 2023 Jul 17]. Available from: https://ir-library.ku.ac.ke/handle/123456789/19013 [Google Scholar]

[pone.0290884.ref026] 26.Tripathi JN, Oduor RO, Tripathi L. A High-Throughput Regeneration and Transformation Platform for Production of Genetically Modified Banana. Front Plant Sci. 2015;6:1025. doi: 10.3389/fpls.2015.01025 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref027] 27.Stewart VIA LE. A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications. Rapid CTAB DNA Isol Tech Useful RAPD Fingerprinting PCR Appl. 1993;14(5):748–51. [PubMed] [Google Scholar]

[pone.0290884.ref028] 28.Kumar N, Krishnamoorthy V., Nalina L., Soorianathasundharam K. A new factor for estimating total leaf area in banana [Internet]. 2002. [cited 2020 Dec 17]. Available from: https://www.musalit.org/seeMore.php?id=14204 [Google Scholar]

[pone.0290884.ref029] 29.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2- ΔΔCT method. methods. 2001;25(4):402–8. [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref030] 30.Daudi A, O’Brien JA. Detection of Hydrogen Peroxide by DAB Staining in Arabidopsis Leaves. Bio-Protoc [Internet]. 2012. [cited 2020 Dec 19];2(18). Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4932902/ [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref031] 31.Batte M, Swennen R, Uwimana B, Akech V, Brown A, Tumuhimbise R, et al. Crossbreeding East African Highland Bananas: Lessons Learnt Relevant to the Botany of the Crop After 21 Years of Genetic Enhancement. Front Plant Sci [Internet]. 2019. [cited 2020 Dec 22];10. Available from: https://www.frontiersin.org/articles/10.3389/fpls.2019.00081/full [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref032] 32.Boutrot F, Zipfel C. Function, Discovery, and Exploitation of Plant Pattern Recognition Receptors for Broad-Spectrum Disease Resistance. Annu Rev Phytopathol. 2017. Aug 4;55:257–86. doi: 10.1146/annurev-phyto-080614-120106 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref033] 33.Gurr SJ, Rushton PJ. Engineering plants with increased disease resistance: what are we going to express? Trends Biotechnol. 2005. Jun;23(6):275–82. doi: 10.1016/j.tibtech.2005.04.007 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref034] 34.Hammond-Kosack KE, Parker JE. Deciphering plant-pathogen communication: fresh perspectives for molecular resistance breeding. Curr Opin Biotechnol. 2003. Apr;14(2):177–93. doi: 10.1016/s0958-1669(03)00035-1 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref035] 35.Kunwar S, Iriarte F, Fan Q, Evaristo da Silva E, Ritchie L, Nguyen NS, et al. Transgenic Expression of EFR and Bs2 Genes for Field Management of Bacterial Wilt and Bacterial Spot of Tomato. Phytopathology®. 2018. Jun 20;108(12):1402–11. doi: 10.1094/PHYTO-12-17-0424-R [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref036] 36.Schwessinger B, Bahar O, Thomas N, Holton N, Nekrasov V, Ruan D, et al. Transgenic Expression of the Dicotyledonous Pattern Recognition Receptor EFR in Rice Leads to Ligand-Dependent Activation of Defense Responses. PLOS Pathog. 2015. Mar 30;11(3):e1004809. doi: 10.1371/journal.ppat.1004809 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref037] 37.Pfeilmeier S, George J, Morel A, Roy S, Smoker M, Stransfeld L, et al. Expression of the Arabidopsis thaliana immune receptor EFR in Medicago truncatula reduces infection by a root pathogenic bacterium, but not nitrogen-fixing rhizobial symbiosis. Plant Biotechnol J. 2019. Mar;17(3):569–79. doi: 10.1111/pbi.12999 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref038] 38.Ranf S. Pattern Recognition Receptors—Versatile Genetic Tools for Engineering Broad-Spectrum Disease Resistance in Crops. Agronomy. 2018. Aug;8(8):134. [Google Scholar]

[pone.0290884.ref039] 39.van Esse HP, Reuber TL, van der Does D. Genetic modification to improve disease resistance in crops. New Phytol. 2020;225(1):70–86. doi: 10.1111/nph.15967 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref040] 40.Buscaill P, van der Hoorn RAL. Defeated by the nines: nine extracellular strategies to avoid microbe-associated molecular patterns recognition in plants. Plant Cell. 2021. Jul 1;33(7):2116–30. doi: 10.1093/plcell/koab109 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref041] 41.Colaianni NR, Parys K, Lee HS, Conway JM, Kim NH, Edelbacher N, et al. A complex immune response to flagellin epitope variation in commensal communities. Cell Host Microbe. 2021. Apr 14;29(4):635–649.e9. doi: 10.1016/j.chom.2021.02.006 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref042] 42.Parys K, Colaianni NR, Lee HS, Hohmann U, Edelbacher N, Trgovcevic A, et al. Signatures of antagonistic pleiotropy in a bacterial flagellin epitope. Cell Host Microbe. 2021. Apr 14;29(4):620–634.e9. doi: 10.1016/j.chom.2021.02.008 [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref043] 43.Cui H, Xiang T, Zhou JM. Plant immunity: a lesson from pathogenic bacterial effector proteins. Cell Microbiol. 2009. Oct;11(10):1453–61. doi: 10.1111/j.1462-5822.2009.01359.x [DOI] [PubMed] [Google Scholar]

[pone.0290884.ref044] 44.Nguyen QM, Iswanto ABB, Son GH, Kim SH. Recent Advances in Effector-Triggered Immunity in Plants: New Pieces in the Puzzle Create a Different Paradigm. Int J Mol Sci. 2021. Jan;22(9):4709. doi: 10.3390/ijms22094709 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref045] 45.Thordal-Christensen H. A holistic view on plant effector-triggered immunity presented as an iceberg model. Cell Mol Life Sci. 2020;77(20):3963–76. doi: 10.1007/s00018-020-03515-w [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0290884.ref046] 46.Durrant WE, Dong X. Systemic acquired resistance. Annu Rev Phytopathol. 2004;42:185–209. doi: 10.1146/annurev.phyto.42.040803.140421 [DOI] [PubMed] [Google Scholar]

PERMALINK

Transgenic expression of Arabidopsis ELONGATION FACTOR-TU RECEPTOR (AtEFR) gene in banana enhances resistance against Xanthomonas campestris pv. musacearum

Mark Adero

Jaindra Nath Tripathi

Richard Oduor

Cyril Zipfel

Leena Tripathi

Roles

Abstract

Introduction

Materials and methods

Plant material

Generation of transgenic plants

Molecular analysis of transgenic events

Polymerase chain reaction analysis

Southern blot analysis

Plant growth analysis

Greenhouse evaluation of transgenic events for resistance to BXW disease

In planta bacterial population analysis

Transgene expression analysis

Expression analysis of defense-related genes

ROS production assay

Statistical analysis

Results

Generation of transgenic events

Fig 1. Generation of transgenic banana events expressing AtEFR gene.

Molecular characterization of transgenic events

Fig 2. Molecular analysis of putatively transgenic banana events expressing AtEFR gene.

Plant growth analysis

Fig 3. Growth analysis of transgenic banana events expressing AtEFR gene compared to non-transgenic control plants.

Evaluation of transgenic banana events for resistance to banana Xanthomonas wilt

Table 1. Greenhouse evaluation of transgenic events of banana cultivar ‘dwarf Cavendish’ expressing AtEFR gene for resistance against Xanthomonas campestris pv. musacearum.

Fig 4. Evaluation of transgenic banana events expressing AtEFR gene and non-transgenic control for resistance to BXW disease.

Testing transgenic banana events for oxidative burst

Fig 5. ROS production assay in transgenic event T5 and non-transgenic control (NC) after elf18 infiltration followed by diaminobenzidine (DAB) staining.

Relative expression of AtEFR gene among transgenic events

Fig 6. Relative expression of AtEFR gene in transgenic banana events.

Relative expression of defense-related genes in transgenic banana events

Fig 7. Relative expression of defense related genes in transgenic bananas expressing AtEFR upon activation with elf18 peptide.

Bacterial population analysis of transgenic banana events

Fig 8. Bacterial population analysis in two transgenic events (T5 and T7) and non-transgenic control plants post inoculation with Xanthomonas campestris pv. musacearum (Xcm).

Discussion

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Eugenio Llorens

Roles

Author response to Decision Letter 0

Decision Letter 1

Eugenio Llorens

Roles

Acceptance letter

Eugenio Llorens

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases