Skip to main content
NCBI home page
Biochemistry and Biophysics Reports logoLink to Biochemistry and Biophysics Reports
. 2023 Aug 25;35:101534. doi: 10.1016/j.bbrep.2023.101534

The effect of edible bird's nests on the expression of MHC-II and costimulatory molecules of C57BL/6 mouse splenocytes

Theerawat Dobutr a,b,c, Nisachon Jangpromma b,d, Rina Patramanon b,d, Jureerut Daduang c, Sompong Klaynongsruang b,d, Saowanee Poopornchai e, Tomio Yabe f, Sakda Daduang b,g,∗
PMCID: PMC10475475  PMID: 37671389

Abstract

The glutinous nest that builds by the saliva secretion of swiftlet is recognizable as an edible bird's nest (EBN). It enriched a medicinal value and was regarded as supplementary food that exerts various beneficial health effects, especially immune boosters. This study's objective was to determine the impact of EBN on the expression of MHC-II and costimulatory molecules (CD86 and CD80) related to the initiation of T-cell activation. Both rEBN and pEBN samples were prepared with simulated gastrointestinal digestion for enhancing the bioaccessibility of bioactive compounds. Our result showed that digested EBN samples slightly influence the upregulation of MHC-II, CD86, and CD80 in gene expression of LPS-stimulated Raw 264.7 cells. The concern of endotoxin contamination in EBN samples, which may cause a false-positive result, was measured by quantitative PCR. We found that the inflammatory genes (IL-1β and TNF-α) were not induced by EBN treatments. Moreover, cell surface protein expression in splenocytes treated with EBN was assessed using flow cytometric analysis. Digested EBN samples demonstrated their capacity to promote the elevation of MHC-II, CD86, and CD80 cell surface protein expression. Finally, the digested-EBN-treated splenocytes only exhibited a specific response in the T-cells population. Thus, EBN is a source of the bioactive compound that has been proposed to exert a role in the stimulation of both MHC-II and costimulatory molecules for TCR/pMHC-II interaction leading to T-cell activation.

Keywords: Edible bird's nest, MHC-II, Costimulatory molecules, Splenocytes

Graphical abstract

Image 1

Open in a new tab

Highlights

  • •

    EBN demonstrates their potential to enhance the upregulation of cell surface-protein expression of MHC-II, CD86, and CD80.

  • •

    The expression of MHC-II and costimulatory molecules by EBN is not associated with an inflammatory response.

  • •

    The upregulation of MHC-II and costimulatory molecules are related to the increase in T-cell proliferation.

1. Introduction

The edible bird's nest (EBN) has been utilized by the ancient Chinese for several decades. Most believed that the consumption of EBN can improve health and strengthen the immune system [1,2]. Asia countries are the main customer that widely used EBN as alternative medical foods and some European countries [3]. In other words, the immune booster effect is still the dominant expectation of medical benefits of EBNs from the customer.

The highest biological composition that can be found in EBN is approximately 50% of protein, followed by carbohydrates (25.62–27.76%), lipids (0.14–1.28%), and minerals [4,5]. Glycoproteins in EBN content are the major protein that plays an important role as bioactive compounds [5,6]. It also enriches both essential amino acids (EAA) and non-essential amino acids (NEAA) [7]. Sialic acids are the main bioactive compounds of carbohydrates of EBN, N-glycolylneuraminic acid (Neu5Gc) and N-acetylneuraminic acid (Neu5Ac), which facilitate cognitive functions andbrain function systems [6,8,9].

Nowadays, researchers attempt to find out a high-efficiency approach for enhancing the release of bioactive compounds of EBN. Many approaches are used for EBN extraction such as stewing, heating, sonication, and enzymatic hydrolysis [6]. In addition, artificial gastrointestinal systems, a simulation of physiological procedures in the gastrointestinal region, are often used to explore the functional properties of foods [10]. The enzymatic hydrolyzed EBN was reported that it has an inhibitory effect on influenza infection via hemagglutination activity [11]. Furthermore, Wong et al. (2018) reported that EBN hydrolysates are more effective in promoting bone cell differentiation than EBN without enzymatic hydrolysis. However, the protein component, small peptides, is not only influenced by the simulated gastric fluid but also impacts the release of carbohydrate components, especially N-acetylglucosamine [12]. Thus, hydrolyzed EBN may contain more free bioactive components than unhydrolyzed EBN [13]. That it's essential for the absorption and action of potential bioactive substances of EBN on the health benefits.

The biological activities of EBN were reported by many researchers such as epidermal growth factor-like activity [14], antiviral effects against influenza virus (neuraminidase inhibitory properties) [15], and cell proliferation [16,17]. It also is suggested as an essential energy source for facilitating cell function and enhancing the immune system [5]. In previous reports, there are many studies that revealed the immunological activity of EBN, particularly as a mediator in immune enhancement. Zhang, Wang, & Wang [18] reported that the EBN extract facilitates the T-lymphocytes transformation and immunoglobulin M (IgM) production. In addition, Zhao et al. [7] evaluated the EBN activity on lymphocyte proliferation against the immunosuppressive drug. They found that B-cell activation responded to EBN treatment and increase the level of antibody production. Moreover, EBN can improve the morphology of secondary lymphoid organs (spleen and thymus index) and enhance the immune cells in both specific and non-specific immune functions [19]. However, the beneficial effects of EBN are influent by several factors, such as nest-building season, habitat conditions, harvesting period, food source, and species origin of swiftlets. The producing origin and geographical origin have not affected the distinction of the protein component of EBN [20,21]. On the other hand, the carbohydrate, lipid, and ash contents in EBNs are significantly different between species origin, production origin, and geographical origin [22]. Hence, the surrounding environmental conditions have influenced the composition and biochemical activities of EBN.

In the previous report, we reported that EBN promotes T-cell proliferation and interleukin-2 production. These results convinced us to disclose more detail about the T-cell activation by EBN. Generally, T-cells are typically activated via the major histocompatibility complex (MHC) - T cell receptor (TCR) interaction to activate the downstream signaling pathways [23]. Antigen-presenting cells (APCs) are crucial cell mediator that triggers the activating of T-cells via their MHC class II molecule [24]. T-cells required 2 signals for the initial activation and expansion phase. Firstly, TCR-pMHC interactions are provided by the binding between the antigenic peptide complexed-MHC (pMHC) and TCR. Secondary, costimulatory molecules (CD80/CD86) on DCs engage with CD28 on T-cells [25]. MHC-II is a crucial molecule associated with peptides derived from exogenous antigens and recognized by CD4+ T-cells. Exogenous antigens can be uptake by APCs via phagocytosis, micropinocytosis, andreceptor-mediated endocytosis [26]. In immature APCs, MHC-II dimers are synthesized in the endoplasmic reticulum and assembled with an invariant chain (li). Then, cathepsins will cleave the invariant chain (li) for transferring the MHC-II into the cell surface. However, the binding of class II invariant chain-associated peptide (CLIP)/MHC-II remains and is exchanged for an antigenic peptide in the endosome. The length of peptides binding to MHC-II molecules is not constrained and it was estimated around 13–17 amino acids in length [27]. Peptide-binding MHC (pMHC) class II deposits on the plasma membrane and presents the immunogenic peptides to αβ TCR-bearing CD4+ T-cells. The TCR-pMHC interactions initiate the primary immune response and subsequence costimulatory signals mediated by CD80 (B7-1) and CD86 (B7-2). Finally, the proliferation of naive T-cells is induced, and it is also different into distinct classes of effectors, Th1, Th2, Treg, and Th17 [28].

However, there are many studies that report the immune cell response to EBN, but the mechanism of EBN on immunomodulatory activity is limited. We have assumed that EBN could induce T-cell proliferation via TCR-pMHC interactions. Therefore, this study aims to investigate EBN activity on the cell-surface protein of MHC-II and costimulatory molecule expressions associated with T-cell activation.

2. Materials and methods

2.1. Chemicals and reagents

A raw EBN sample (rEBN) was purchased from Surat-Thani, Thailand. Aiko Edible Bird Nest Pattani Part., Ltd. (Thailand) provided the processed EBN powder (pEBN). Thermo Fisher Scientific K.K. (Japan) supplied the RPMI 1640 medium and Dulbecco's Modified Eagle Medium (DMEM). FITC anti-mouse MHC-II, FITC anti-mouse CD80, and FITC anti-mouse CD86 were purchased from eBioscience, Inc. (USA). FITC anti-mouse CD3ε antibody, PE anti-mouse CD19 antibody, anti-mouse CD16/32 antibody, and recombinant mouse IL-2 were purchased from BioLegend, Inc. (U.S.A.). Falcon® 70 μm Cell Strainer was purchased from Corning, Inc. (USA). Fetal bovine serum (FBS), l-Glutamine, Penicillin-Streptomycin, and β-mercaptoethanol were purchased from Nacalai Tesque, Inc. (Japan). The filter paper was purchased from ADVANTEC Co., Ltd., Japan). THUNDERBIRD™ - Probe and SYBR® were purchased from Toyobo Co., Ltd., JAPAN.

2.2. EBN preparation and enzymatic digestion

Firstly, the fresh rEBN was saturated for an hour in distilled water until its content was utterly loose. The impurities were manually removed from EBN content and dried for 12 h at 60 °C. The dried EBN was finely powdered and stored at 25 °C. Secondly, gastrointestinal digestion was used for digesting the EBN samples. Simulated gastric fluid (10 mL with Pepsin, 35 mM NaCl and 0.7% HCl, pH 1.2) was added to incubate 100 mg of EBN samples at 37 °C and agitation of 60 rpm. After 2 h of incubation, it was adjusted to pH 6.8 with 2.5 M NaOH for neutralizing the enzyme activity. Then, 10 mL of simulated intestinal fluid (5 mM NaH2PO4) containing pancreatin was added, followed by adjusting pH to 7.4 before incubating at 37 °C and agitation of 60 rpm for 2 h. The enzyme's activity was terminated by incubating at 80 °C for 10 min. The supernatant was collected by centrifuging for 10 min at 4000×g and filtered with filter paper No. 5C (ADVANTEC). Finally, it was subjected to the freeze-dryer (EYELA FDU-1200) and stored at −25 °C.

2.3. Gene expression

2.3.1. Cell culture

In a 6-well plate with DEME media (containing 10% FBS, 200 mM l-glutamine, 1% Penicillin-Streptomycin, 0.8% of NaHCO3, with or without 10 ng/mL of LPS), Raw 264.7 cells were seeded at a concentration of 0.1 × 106 cells with rEBN or pEBN at different doses. It was subsequently left to incubate for 24 h at 37 °C containing 5% CO2.

2.3.2. Quantitative PCR (qPCR)

After being properly rinsed in PBS, Raw 264.7 cells were resuspended in 1 mL of RNA IsoPlus™. The RNA extraction was implemented following the manufacturer's instructions. To assess the quality and amount of RNA, 260 nm and 280 nm absorbance measurements were performed on RNA samples. ReverTra Ace™ (TOYOBO Biotech) was used for synthesizing the complementary DNA from the total RNA (100 μg) as per the manufacturer's instructions. The primer pairs and reaction conditions for analyzed genes were designed for MHC-II and costimulatory molecules and inflammatory cytokines, as shown in Table 1. The qPCR mixture contained cDNA (1 μL), forward and reverse primers (0.45 μL), DEPC-treated water (5.6 μL), and Thunderbird (TOYOBO, Japan) master mix (7.5 μL). The qPCR assays were performed on the TAKARA Thermal cycler (Japan). The analysis was done using the 2−ΔΔCt method for calculating the relative quantification of gene expression (GAPDH was used as an internal reference).

Table 1.

List of primer sequences and temperature conditions used for qPCR analysis.

Gene Primer sequence 3 PCR steps
Denaturinga Annealingb Extensionc
GAPDH F: AACCTGCCAAGTATGATGA
R: GGAGTTGCTGTTGAAGTC		 95 °C 56.7 °C 72 °C
IL-1β F: GCAACTGTTCCTGAACTCAACT 95 °C 63.30 °C 72 °C
R: ATCTTTTGGGGTCCGTCAACT
IL-6 F: CCACGGCCTTCCCTAC 95 °C 60.50 °C 72 °C
R: AGTGCATCATCGTTGTTC
TNF-α F: AAAATTCGAGTGACAAGCCTGTAG 95 °C 63.30 °C 72 °C
R: CCCTTGAAGAGAACCTGGGAGTAG
MHC-II F: CCCTTCTTATGTTCCCTGAT 95 °C 63.35 °C 72 °C
R: CCTCCTTCTGTTCTGACTT
CD86 F: GATGTGTTCGTGTTGCTAT 95 °C 63.35 °C 72 °C
R: TGTTGCTGTCACCTGTAT
CD80 F: GTCGTCATCGTTGTCATC 95 °C 63.35 °C 72 °C
R: TTCTCTGCTTGCCTCATT
Open in a new tab
a

Denaturing step for 15 s.

b

Annealing step for 30 s.

c

Extension step for 1 min.

2.4. Lymphocyte proliferation and cell surface protein expression

2.4.1. Animals

C57BL/6 mice (Male, bodyweight 20–25 g, 7 weeks old) were purchased from Japan SLC Co., Ltd. All mice were housed at Life Sciences Research Center (Division of genomic research, Gifu University, JAPAN). It was fed ad libitum and maintained in the controlled environment at a room temperature of 23 ± 2 °C, and humidity level of 30%–60% (with a light/dark cycle of 12:12 h).

2.4.2. Splenocyte isolation

The spleen was collected from a C57BL/6 mouse and mashed through the 70 μm cell strainer in a culture dish containing 10 mL of serum-free RPMI 1640 medium. The supernatant was discarded by centrifuging for 10 min at 4000 rpm. Then, red blood cell lysis buffer (5 mL) was added for removing the red blood cells at 37 °C for 8 min. RPMI 1640 complete medium (5 mL) was added to neutralize the lysis reaction and centrifuged for discarding the supernatant. The isolated splenocytes were twice washed in PBS before being placed in RPMI 1640 complete medium for storage.

2.4.3. Cell viability assay and flow cytometric analysis

The splenocytes at a density of 1 × 106 cells/well were seeded in 96 well-plate containing RPMI 1640 complete medium (supplemented with 50 mM of β-mercaptoethanol, and 200 μL/mL of recombinant interleukin-2) and 0.1 or 1 mg/mL of EBN samples. After 72 h, the mixture was incubated at 37 °C and 5% CO2 for an hour after the cell counting kit-8 (10 μL) was added. Finally, the microplate reader (Infinite® M200, TECAN) took an absorbance reading at 450 nm.

For flow cytometric analysis, the EBN-treated splenocytes were harvested by centrifuging at 2000 rpm for 8 min, followed by washing and resuspending in 100 μL of PBS. To prevent non-specific Fc-mediated interactions, anti-mouse CD16/32 was used for blocking the Fc receptors (FcRs). The unbound antibodies were removed (centrifuged at 2000 rpm for 8 min), followed by labeling with anti-mouse CD3ε-FITC antibody and anti-mouse CD19-PE antibody in the total dark (30 min) for determining lymphocyte proliferation. The cell surface protein expressions were performed by staining the EBN-treated splenocytes with anti-mouse MHC–II–FITC, anti-mouse CD80-FITC, and anti-mouse CD86-FITC as per manufacturer's instructions for 30 min in the dark. After washing to remove any unbound antibodies 2 times, it was resuspended with PBS (500 μL). Finally, the labeled splenocytes underwent flow cytometric analysis to determine the frequency of the target cell. The data was interpreted and visualized using FlowJo software (Version 10.8).

2.5. Statistical analysis

The experiment's data, which were conducted in triplicate, were presented as mean ± standard deviation. Dunnett's multiple comparison tests were employed to establish the statistical significance when the p-value was less than 0.05, after the one-way ANOVA test. The statistical tests were performed using Graph Pad Prism software (version 9.3.1).

3. Results

3.1. The effect of EBNs on inflammatory gene expression

To investigate the endotoxin contamination in EBN samples, the EBN-treated Raw 264.7 cells were employed for the inflammatory gene expression assessment by qPCR. Lipopolysaccharide (LPS) was represented as a positive control to show how IL-1β, IL-6, and TNF-α were upregulated. Our study demonstrated that both rEBN and pEBN have no effect on the expression of IL-1β and TNF-α (Fig. 1A and B). Moreover, EBN samples showed a tendency to decrease the expression of IL-1β and TNF-α (p > 0.05), especially at 1 mg/mL of both EBN samples. Interestingly, the pEBN-treated Raw 264.7 group showed an increase in a dose-dependent manner of IL-6 expression (p < 0.05) (Fig. 1C).

Fig. 1.

Fig. 1

Open in a new tab

The effect of edible bird's nest on the gene expression of (A) IL-1β, (B) TNF-α, (C) IL-6, (D) MHC-II, (E) CD86, and (F) CD80 in EBN-treated Raw 264.7 cells. The gene expression was displayed as a relative gene expression value after normalized with the expression of the GAPDH gene. When the p-value was less than 0.01; ** or 0.001; ***, it was suggested that there was a statistically significant difference comparing the control group (LPS) and EBN treatment group. (G) The heat map showed the summary of the gene expression of proinflammatory cytokines (IL-1β, IL-6, and TNF-α), MHC-II, and costimulatory molecules (CD80 and CD86).

3.2. The impact of EBNs on MHC-Il and costimulatory molecule expression

After the investigation of inflammatory gene expression was done, the result of EBN on the expression of MHC-II and co-stimulatory molecules was established to observe the potential of EBN in promoting T-cell activation. The result revealed that the expression of MHC-II, CD86, and CD80 has upregulated in EBN-treated Raw 264.7 cells in both rEBN and pEBN groups, specifically at a concentration of 1 mg/mL (p > 0.05). However, these upregulation levels weren't revealed to be upregulated in a dose-dependent manner. The MHC-II, CD86, and CD80 expressions were unaffected by EBN samples at 0.1 mg/mL (Fig. 1D, E, and 1F). Additionally, pEBN (1 mg/mL) and rEBN (1 mg/mL) slightly increased the expression of CD86 and CD80, respectively.

3.3. The effect of EBN samples on splenocyte proliferation

The splenocyte proliferation was determined from the EBN-treated splenocytes by a WST-8-based lymphocyte proliferation assay. The yellow color of WST-8 will be turned to an orange color (WST-8 Formazan) by the metabolic activity of living cells. The result showed that rEBN and pEBN didn't reduce the cell viability of splenocytes compared with a control group (or without ConA; -ConA). Conversely, EBN treatment groups at a concentration of 1 mg/mL have the potential to stimulate the proliferation of mouse splenocytes (p < 0.05) (Fig. 2B). The pEBN treatment also has higher activity on spherocyte proliferation than rEBN treatment. However, a concentration of 0.1 mg/mL of all treatments has no effect on splenocyte proliferation compared with a control group (-ConA).

Fig. 2.

Fig. 2

Open in a new tab

(A) The morphology of EBN-treated splenocytes showed cell clumping after stimulation with different concentrations of EBN sample (Scale bar: 200 μm). (B) Measurement of splenocyte proliferation using Cell counting Kit-8 after incubation with rEBN and pEBN for 72 h. When the p-value was less than 0.01; ** or 0.0001; ****, it was suggested that there was a statistically significant difference comparing the control group (-ConA) and the EBN treatment group.

3.4. The proliferation of lymphocyte subpopulations (CD3+ T-cells and CD19+ B-cells)

Splenocytes were cultured with EBNs in varying concentrations for 72 h. Lymphocyte subpopulations were labeled with antibodies and measured the cell frequency by a flow cytometer. We found that both rEBN and pEBN treatments stimulated a significantly increased in the CD3+ T-cells population (p < 0.05) (Fig. 3B). Notably, rEBN treatment at a high concentration (1 mg/mL) showed a high influence to trigger the proliferation of T-cells than the lower concentration. In contrast, pEBN at a concentration of 0.1 mg/mL has the highest potential to induce T-cell proliferation. However, EBN treatments also significantly affect the reduction in the number of CD19+ B-cells (p < 0.05) (Fig. 3C).

Fig. 3.

Fig. 3

Open in a new tab

(A) The contour plot shows the percentage of CD3+ T-cells (Quartile 1; Q1) and CD19+ B-cells (Quartile 3; Q3) after the EBN-treated splenocytes were determined with flow cytometry. The comparison of the percentage of lymphocyte subpopulations, CD3+ T-cells (B), and CD19+ B-cells (C). When the p-value was less than 0.05; *, 0.001; ***, and 0.0001; ****, it was suggested that there was a statistically significant difference comparing the control group and the EBN treatment group.

3.5. The impact of EBNs on cell surface proteins expression (MHC-II and costimulatory molecules)

The expression of cell surface proteins was determined from EBN-treated splenocytes by flow cytometric analysis. The result was expressed as mean fluorescence intensity (MFI) that is in direct proportion to the level of expression of the target protein. Our study found that EBN-treated splenocytes at different concentrations had significantly increased the cell surface protein expression of MHC-II (Fig. 4D). At high concentration (1 mg/mL) of both rEBN and pEBN also revealed the high activity in promoting the expression of MHC-II. In addition, the expression of CD80 was substantially increased by EBN treatments, especially rEBN treatment (1 mg/mL) (Fig. 4F). However, we found that EBNs have a low potential to increase CD86 protein expression (Fig. 4E).

Fig. 4.

Fig. 4

Open in a new tab

The effect of edible bird's nest on the cell surface protein expression of (A) MHC-II, (B) CD86, and (C) CD80. The splenocytes were incubated with EBN samples at varying concentrations for 72 h and stained with monoclonal antibodies before measuring the expression by flow cytometer. The cell surface protein expression of EBN-treated splenocytes was expressed as mean fluorescence intensity (MFI). When the p-value was less than 0.01; **, 0.001; *** or 0.0001; ****, it was suggested that there was a statistically significant difference comparing the control group and the EBN treatment group.

4. Discussion

In the previous study (Data not shown), both in vivo and in vitro studies (Sprague Dawley Rat) exhibited that EBN has the ability to promote the expansion of T-cells and enhanced interleukin-2 production. In addition, EBN was reported regarding the immunomodulating activity that it can promote the proliferation of B-cells [7]. It's possible that the different geographical origins affect the biochemical composition and immunological properties of EBN [5]. However, T-cells and B-cells are entirely different in their activation mechanism. The response of B-cells can stimulate by lipopolysaccharide (LPS) that may be contaminated in EBN samples. The concern of endotoxin contamination in EBN is a problem for elucidating the immunomodulatory activity clearly because it may cause a false-positive result in the determination of immune response. Endotoxin, also known as LPS, is the outer membrane part of positive-gram bacteria that can stimulate inflammation in several immune cells. The activation occurs through the troll-like receptor (TRL) and activates the transcription factors to produce the pro-inflammatory cytokines [29]. Moreover, endotoxin also influents the maturation of DCs and the upregulation of MHC-II and costimulatory molecules. Our study demonstrated that EBNs-treated Raw 264.7 cells don't induce the expression of inflammatory genes markers. On the other hand, the high concentration of EBNs also can potentially reduce the expression of IL-1β and TNF-α. The effect of EBN on anti-inflammatory properties was reported that it can recover the symptoms of colitis (the inflammation of the lining of the colon) in animal models by reducing pro-inflammatory cytokines [30]. Notably, our study found that IL-6 gene expression was highly increased by the pEBN treatment. IL-6 plays a broad range of immune responses and has a pleiotropic effect [31]. Additionally, it is essential for CD4 T-cell development into T helper 17 cells [32]. This phenomenon is difficult to explain clearly because only a pEBN treatment can induce the IL-6 expression, but the rEBN sample showed didn't induce any inflammatory genes. We have assumed that some bioactive components in EBN extract may act as a stimulator that explicitly induces the expression of IL-6. This finding may be continually studied to elucidate this doubt in the future. Therefore, this data is evidence supporting our results that EBN has no contamination with endotoxin. It's not influential to cause false positive results on the determination of cell surface protein expression involved in T-cell activation.

According to the previous mention, our hypotheses have highlighted EBN's capacity to promote T-cell proliferation. The main composition of EBN is the protein (glycoprotein) that may act as an exogenous protein. It could be engulfed and processed into small fragment peptides by APCs before presenting pMHC-II to TCR. Thus, EBN-derived peptides may be the main bioactive compound of EBN that act as the T-cell mitogen. The studying of the bioavailability and bioaccessibility of EBN is important for enhancing the release of potential bioactive from the EBN matrix in the digestive system [10]. The gastrointestinal digestion, based on the human digestion process, was applied to prepare EBN samples. This process could facilitate the release of peptides and influence the bioavailability of EBN. Thus, the digested EBN may have activities higher than EBN without any digestive process [13].

To illustrate T-cell activation, a flow cytometric analysis was carried out to quantify the expression level of the molecules MHC-II, CD80, and CD86. Indeed, these molecules have upregulated after being treated with EBN samples. Although MHC-II molecules have greatly increased, costimulatory molecules have not been statistically significant. Once peptide-MHC-II complexes (pMHC-II) are formed, they will engage with TCR on the naive T-cells to trigger the TCR-dependent intracellular signaling pathways [33]. This is the first signal that is important for antigen-specific adaptive response [34]. Nevertheless, efficient activation of naïve T-cells is required for signals from TCR/MHC-II and CD80/CD86-CD28 interactions. According to our results, the low expression of costimulatory (CD80/CD86) is difficult to address because it can distinctly regulate T cells in response to a stimulator [35]. After T-cells are activated, expression of the CD28 molecule is no longer expressed on the cell surface. The activated T-cells will upregulate the cytotoxic T lymphocyte antigen 4 (CTLA-4 or CD152), which is important in negative immune regulation. CTLA-4 is more likely to bind with CD80/CD86 than the CD28 molecule [36]. The CTLA-4-CD80/CD86 interaction can annul the activated T-cells by reducing cell cycle progression and level of IL-2 production [37]. Therefore, upon exposure to EBN treatment for a while, this activity may result in a reduction in the expression of CD80/CD86. Besides, EBNs didn't only impact to promote the T-cell population, they may also suppress B-cell proliferation. The decrease in the number of B-cells during T-cell activation may be probably caused by CD4 T cell-derived IFN-γ. Th1 cells are known for producing IFN-γ that which has various effects on the immune response, one of which is to inhibit B-cell activation and antibody production either before maturation or after activation [38,39]. However, this phenomenon may be investigated for more understanding in future studies.

In summary, one possible explanation for the immunomodulating activity of EBN is the biological activity of glycoprotein. Some EBN-derived peptides might exert as a mitogen that can induce T-cell proliferation. Our prediction was supported by the upregulation of MHC-II and costimulatory molecules. Therefore, EBNs are regarded as biologically active substances that positively affect the immune response.

5. Conclusions

EBN is a natural substance that may function as a mitogen to promote the proliferation of T cells. Our study showed how effective EBN is at promoting MHC-II and costimulatory molecule expression, both of which are essential for full T-cell activation. EBN can therefore be used as a food supplement to strengthen the immune system.

Ethics statement

The Animal Research Committee of the Gifu University (Gifu, Japan) assessed and approved the procedure for using animals in this research.

Funding

This research was funded by Research and Researchers for Industries (RRI) for Ph.D. degree students, The Thailand Research Fund (TRF) (grant no. PHD61I0024). This study was partially supported by The National Research Council of Thailand (NRCT) (grant no.3/2564 (KKU-NRCT)), the Centre for Research and Development of Medical Diagnostic Laboratories (CMDL), Faculty of Associated Medical Sciences, Khon Kaen University (KKU), and The Fundamental Fund of KKU received funding support from the National Science, Research and Innovation Fund (NSRF), Thailand.

Declaration of competing interest

The authors declare that there is no conflict.

Acknowledgments

We would like to thank Asst. Prof. Kohji Kitaguchi and the Department of Applied Life Science, Gifu University for guidance on flow cytometric analysis, equipment, and material supports.

References

  • 1.Hobbs J.J. Problems in the harvest of edible birds' nests in Sarawak and Sabah, Malaysian Borneo. Biodivers. Conserv. 2004;13:2209–2226. doi: 10.1023/B:BIOC.0000047905.79709.7f. [DOI] [Google Scholar]
  • 2.Babji A.S., Etty Syarmila I.K., NurAliah D., Nurul Nadia M., Hadi Akbar D., Norrakiah A.S., Ghassem M., Najafian L., Salma M.Y. Assessment on bioactive components of hydrolysed edible bird nest. Int. Food Res. J. 2008;25(5):1936–1941. [Google Scholar]
  • 3.Lee T.H., Wani W.A., Shin Y., Kavita S., Ti E., Tan T. Recent advances in the identification and authentication methods of edible bird's nest. Food Res. Int. 2017;100:14–27. doi: 10.1016/j.foodres.2017.07.036. [DOI] [PubMed] [Google Scholar]
  • 4.Marcone M.F. Characterization of the edible bird's nest the “Caviar of the East”. Food Res. Int. 2005;38(10):1125–1134. doi: 10.1016/j.foodres.2005.02.008. [DOI] [Google Scholar]
  • 5.Chua L.S., Zukefli S.N. A comprehensive review on edible bird nests and swiftlet farming. J. Integr. Med. 2016;14(6):415–428. doi: 10.1016/S2095-4964(16)60282-0. [DOI] [PubMed] [Google Scholar]
  • 6.Daud N.A., Mohamad Yusop S., Babji A.S., Lim S.J., Sarbini S.R., Hui Yan T. Edible bird's nest: physicochemical properties, production, and application of bioactive extracts and glycopeptides. Food Rev. Int. 2021;37(1):177–196. doi: 10.1080/87559129.2019.1696359. [DOI] [Google Scholar]
  • 7.Zhao R., Li G., Kong X.J., Huang X.Y., Li W., Zeng Y.Y., Lai X.P. The improvement effects of edible bird's nest on proliferation and activation of B lymphocyte and its antagonistic effects on immuno-suppression induced by cyclophosphamide. Drug Des. Dev. Ther. 2016;10:371–381. doi: 10.2147/DDDT.S88193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Teh S.S., Ma Z.F. Bioactive components and pharmacological properties of edible bird's nest. IPCBEE. 2018;103:29–34. doi: 10.1002/brb3.1817. [DOI] [Google Scholar]
  • 9.Mahaq O., Rameli M.A.P., Jaoi Edward M., Mohd Hanafi N., Abdul Aziz S., Abu Hassim H., Mohd Noor M.H., Ahmad H. The effects of dietary edible bird nest supplementation on learning and memory functions of multigenerational mice. Brain and Behavior. 2020;10(3) doi: 10.1002/brb3.1817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Santos D.I., Saraiva J.M.A., Vicente A.A., Moldão-Martins M. In: 2-Methods for Determining Bioavailability and Bioaccessibility of Bioactive Compounds and Nutrients. Barba F.J., Saraiva J.M.A., Cravotto G., Lorenzo J.M., editors. Woodhead Publishing, United Kingdoms; 2019. pp. 23–54. [Google Scholar]
  • 11.Guo C.T., Takahashi T., Bukawa W., Takahashi N., Yagi H., Kato K., Hidari K.I., Miyamoto D., Suzuki T., Suzuki Y. Edible bird's nest extract inhibits influenza virus infection. Antivir. Res. 2006;70(3):140–146. doi: 10.1016/j.antiviral.2006.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wong Z.C.-F., Chan G.K.-L., Wu K.-Q., Poon K.K.-M., Chenm Y., Dong T.T.X., Tsim K.W.K. Completed digestion of Edible Bird's Nest releases free N-acetyl-neuraminic acid and small peptide: an efficiency method to improve functional properties. Food Funct. 2018;9(10):5139–5149. doi: 10.1039/c8fo00991k. [DOI] [PubMed] [Google Scholar]
  • 13.Fan Q., Liu X., Wang Y., Xu D., Guo B. Recent advances in edible bird's nests and edible bird's nest hydrolysates. Food Sci. Technol. 2022;42 doi: 10.1590/fst.67422. [DOI] [Google Scholar]
  • 14.Zhang S., Lai X., Liu X., Li Y., Li B., Huang X., Zhang Q., Chen W., Lin L., Yang G. Competitive enzyme- linked immunoassay for sialoglycoprotein of Edible Bird's Nest in food and cosmetics. J. Agric. Food Chem. 2012;60(14):3580–3585. doi: 10.1021/jf300865a. [DOI] [PubMed] [Google Scholar]
  • 15.Haghani A., Mehrbod P., Safi N., Aminuddin N.A., Bahadoran A., Omar A.R., Ideris A. In vitro and in vivo mechanism of immunomodulatory and antiviral activity of Edible Bird's Nest (EBN) against influenza A virus (IAV) infection. J. Ethnopharmacol. 2016;185:327–340. doi: 10.1016/j.jep.2016.03.020. [DOI] [PubMed] [Google Scholar]
  • 16.Aswir A.R., Wan Nazaimoon W.M. Effect of edible bird's nest on cell proliferation and tumor necrosis factor alpha (TNF-α) release in vitro. Int. Food Res. J. 2011;18(3):1123–1127. [Google Scholar]
  • 17.Zainal Abidin F., Hui C.K., Luan N.S., Suhana E., Ramli M., Hun L.T., Ghafar N.A. Effects of edible bird's nest (EBN) on cultured rabbit corneal keratocytes. BMC Compl. Alternative Med. 2011;11(1):94. doi: 10.1186/1472-6882-11-94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhang M., Wang D.S., Wang J. The effect of the ZHENZHU-YANWO extracts on animal function. Pharmaceutial Biotechnology. 1994;1(2):49–51. [Google Scholar]
  • 19.Cao Y., Xu J., Wang J.F., You Y.Y., Xue C.H. Studies on immunomodulation function of Indonesia white edible bird's nest on hypoimmune mice. Acta Nutr. Sin. 2012;34:168–171. [Google Scholar]
  • 20.Nurul Huda M.Z., Zuki A.B.Z., Azhar K., Goh Y.M., Suhaimi H., Awang Hazmi A.J., Zairi M.S. Proximate, elemental and fatty acid analysis of pre-processed edible bird's nest (Aerodramus fuciphagus): a comparison between regions and types of nest. J. Food Technol. 2008;6(1):39–44. [Google Scholar]
  • 21.Seowa E.K., Ibrahimb B., Akmal S., Lam M., Lee L.H., Cheng L.H. Differentiation between house and cave edible bird's nests by chemometric analysis of amino acid composition data. Food Sci. Technol. 2016;65:428–435. 10. 1016/j.lwt.2015.08.047. [Google Scholar]
  • 22.Chua P., Bloodworth B.C., Leong L.P., Li S. Metabolic profiling of edible bird's nest using gaschromatog- raphy/mass spectrometry and liquid chromatography/mass spectrometry. Rapid Commun. Mass Spectrom. 2014;28(12):1387–1400. doi: 10.1002/rcm.6914. [DOI] [PubMed] [Google Scholar]
  • 23.Corse E., Gottschalk R.A., Allison J.P. Strength of TCR-peptide/MHC interactions and in vivo T cell responses. J. Immunol. 2002;186(9):5039–5045. doi: 10.4049/jimmunol.1003650. 10.4049/jimmunol.1003650. [DOI] [PubMed] [Google Scholar]
  • 24.Undale A.H., van den Elsen P.J., Celis E. Antigen-independent acquisition of MHC class II molecules by human T lymphocytes. Int. Immunol. 2004;16(10):1523–1533. doi: 10.1093/intimm/dxh154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Budd R.C., Fortner K.A. In: Kelley's Textbook of Rheumatology. ninth ed. Firestein G.S., Budd R.C., Gabriel SE McInnes I.B., O'Dell J.R., editors. W.B. Saunders; USA: 2013. pp. 15–190. [Google Scholar]
  • 26.Delamarre L., Holcombe H.R., Mellman I. Presentation of exogenous antigens on major histocompatibility complex (MHC) class I and MHC class II molecules is differentially regulated during dendritic cell maturation. JEM. 2013;198(1):111–122. doi: 10.1084/jem.20021542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Murphy K., Weaver C. ninth ed. Garland Science; New York: 2016. Immunobiology; pp. 160–161. [Google Scholar]
  • 28.Meyer zum Bueschenfelde C.O., Unternaehrer J., Mellman I., Bottomly K. Regulated recruitment of MHC class II and costimulatory molecules to lipid rafts in dendritic cells. J. Immunol. 2004;173(10):6119–6124. doi: 10.4049/jimmunol.173.10.6119. [DOI] [PubMed] [Google Scholar]
  • 29.Vijay K. Toll-like receptors in immunity and inflammatory diseases: past, present, and future. Int. Immunopharm. 2018;59:391–412. doi: 10.1016/j.intimp.2018.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Fan Y., Fan Y., Liu K., Lonan P., Liao F., Huo Y., Zhong X., Liang Y., Wang Y., Hou S., Lai X., Li G., Kuang W. Edible bird's nest ameliorates dextran sulfate sodium-induced ulcerative colitis in C57BL/6J mice by restoring the Th17/Treg cell balance. Front. Pharmacol. 2021;12 doi: 10.3389/fphar.2021.632602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rose-John S., Winthrop K., Calabrese L. The role of IL-6 in host defence against infections:immunobiology and clinical implications. Nat. Rev. Rheumatol. 2017;13:399–409. doi: 10.1038/nrrheum.2017.83. [DOI] [PubMed] [Google Scholar]
  • 32.Jones B.E., Maerz M.D., Buckner J.H. IL-6: a cytokine at the crossroads of autoimmunity. Curr. Opin. Immunol. 2018;55:9–14. doi: 10.1016/j.coi.2018.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Samelson L.E. Signal transduction mediated by the T cell antigen receptor: the role of adapter proteins. Annu. Rev. Immunol. 2002;20:371–394. doi: 10.1146/annurev.immunol.20.092601.111357. [DOI] [PubMed] [Google Scholar]
  • 34.Wosen J.E., Mukhopadhyay D., Macaubas C., Mellins E.D. Epithelial MHC class II expression and its role in antigen presentation in the gastrointestinal and respiratory tracts. Front. Immunol. 2018;9:2144. doi: 10.3389/fimmu.2018.02144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Soskic B., Jeffery L.E., Kennedy A., Gardner D.H., Hou T.Z., Halliday N., Williams C., Janman D., Rowshanravan B., Hirschfield G.M., Sansom D.M. CD80 on human T cells is associated with FoxP3 expression and supports Treg homeo-stasis. Front. Immunol. 2021;11 doi: 10.3389/fimmu.2020.577655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Dembic Z. Elsevier Science; 2015. The Cytokines of the Immune System: the Role of Cytokines in Disease Related to Immune Response; pp. 57–98. [Google Scholar]
  • 37.Mukherjee S., Ahmed A., Nandi D. CTLA4-CD80/CD86 interactions on primary mouse CD4+ T cells integrate signal-strength information to modulate activation with Concanavalin A. J. Leukoc. Biol. 2005;78(1):144–157. doi: 10.1189/jlb.1104644. [DOI] [PubMed] [Google Scholar]
  • 38.Alspach E., Lussier D.M., Schreiber R.D. Interferon γ and its important roles in promoting and inhibiting spontaneous and therapeutic cancer immunity. Cold Spring Harbor Perspect. Biol. 2019;11:a028480. doi: 10.1101/cshperspect.a028480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Arens R., Tesselaar K., Baars P.A., van Schijndel G.M., Hendriks J., Pals S.T., Krimpenfort P., Borst J., van Oers M.H., van Lier R.A. Constitutive CD27/CD70 interaction induces expansion of effector-type T cells and results in IFN gamma-mediated B cell depletion. Immunity. 2001;15:801–812. doi: 10.1016/s1074-7613(01)00236-9. [DOI] [PubMed] [Google Scholar]

Articles from Biochemistry and Biophysics Reports are provided here courtesy of Elsevier

RESOURCES