Skip to main content
NCBI home page
Lippincott Open Access logoLink to Lippincott Open Access
. 2023 Jun 23;60(2):306–314. doi: 10.1097/SHK.0000000000002168

A NETWORK PHARMACOLOGY-BASED TREATMENT ANALYSIS OF LUTEOLIN FOR REGULATING PYROPTOSIS IN ACUTE LUNG INJURY

Danying Zhang ∗, Yifan Li ∗, Weiwei Jiang ∗, Wenfang Li ∗, Xiaowei Yuan †, Zhaofen Lin ∗
PMCID: PMC10476600  PMID: 37379125

ABSTRACT

Background: Acute lung injury (ALI) and its severe manifestation, acute respiratory distress syndrome, are complicated pulmonary inflammatory conditions for which standard therapeutics are still not well established. Although increasing research has indicated the anti-inflammatory, anticancer, and antioxidant effects of luteolin, especially in lung diseases, the molecular mechanisms underlying luteolin treatment remain largely unclear. Methods: The potential targets of luteolin in ALI were explored using a network pharmacology-based strategy and further validated in a clinical database. The relevant targets of luteolin and ALI were first obtained, and the key target genes were analyzed using a protein-protein interaction network, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses. The targets of luteolin and ALI were then combined to ascertain the relevant pyroptosis targets, followed by Gene Ontology analysis of core genes and molecular docking of key active compounds to the antipyroptosis targets of luteolin in resolving ALI. The expression of the obtained genes was verified using the Gene Expression Omnibus database. In vivo and in vitro experiments were performed to explore the potential therapeutic effects and mechanisms of action of luteolin against ALI. Results: Fifty key genes and 109 luteolin pathways for ALI treatment were identified through network pharmacology. Key target genes of luteolin for treating ALI via pyroptosis were identified. The most significant target genes of luteolin in ALI resolution included AKT1, NOS2, and CTSG. Compared with controls, patients with ALI had lower AKT1 expression and higher CTSG expression. Luteolin simply reduced systemic inflammation and lung tissue damage in septic mice. Furthermore, we blocked AKT1 expression and found luteolin reduced the degree of lung injury and affected NOS2 levels. Conclusions: As demonstrated by a network pharmacology approach, luteolin may exert an antipyroptosis effect on ALI via AKT1, NOS2, and CTSG.

KEYWORDS: Acute lung injury, acute respiratory distress syndrome, luteolin, network pharmacology, pyroptosis, treatment

INTRODUCTION

Acute respiratory distress syndrome (ARDS) is an acute, inflammatory, life-threatening form of lung injury, with more than 200,000 new cases annually, and a mortality rate of up to 40% (1). Acute lung injury (ALI) is an early and continuous pathophysiological process in ARDS. In ARDS patients, the increased permeability of the pulmonary microvasculature elevates the susceptibility of endothelial and alveolar epithelial cells to injury, leading to progressive respiratory distress and even respiratory failure. To date, pharmacotherapy for ARDS has mainly focused on morphological changes. Mounting clinical pharmacological trials have indicated a failure in reducing ARDS mortality among current drugs, including β2-adrenergic agents, ketoconazole, lisofylline, vitamins C and D, omega fatty acids, and statins (2). However, currently, there are no specific therapeutic approaches for ARDS. However, a variety of natural products such as flavonoids, alkaloids, and terpenoids have been found to exert positive effects on ARDS (3). In traditional Chinese medicine, its bioactive components or derivatives affect multiple potential targets rather than one; focusing on a single pathway or target genes may result in worse outcomes (4,5). It is difficult to screen and interpret all the possible interactions between proteins and compounds experimentally. Therefore, effective prevention of the occurrence of ARDS in the early stages and further development of ARDS has become important issues to be solved urgently.

Luteolin (3′, 4′, 5, 7-tetrahydroxyflavone) (Fig. 1A), a well-known flavonoid, is found in many medicinal herbs and is one of the most abundant secondary metabolites in plants (6). The chemical structure of luteolin does not allow its pharmacological function to be exerted in a single way. Luteolin plays an inhibitory role in inflammation regulation mainly by impacting inflammatory mediators and factors, as well as some inflammatory pathways (7). Accumulating evidence has shown that luteolin can alleviate the severity of ALI in various ways and, consequently, can be considered a potential drug for ALI treatment (8,9). Luteolin is reported to relieve pulmonary edema in ARDS (10), exert its anti-inflammatory role, restrain the development of ARDS (10), affect intrapulmonary oxidative stress, and increase the activity of several antioxidants in ARDS (11,12). There is no doubt that luteolin has a therapeutic effect on lung injury, and the underlying mechanisms are less explored. Therefore, it is tempting to expand research on the therapeutic mechanisms of luteolin in lung injury.

Fig. 1.

Fig. 1

Open in a new tab

The molecular structure of luteolin (A) and the detailed flowchart of the present study (B).

Pyroptosis is an inflammatory form of programmed cell death activated by pattern recognition receptors that identify conserved microbial products or endogenous dangers. It is characterized by early destruction of plasma membrane stability and subsequent extracellular overflow of intracellular content (13). Several studies have found that nonclassical pyroptosis plays a role in ALI (14,15), such as the promotion of HMGB1 secretion during ALI (16). The exploration of ARDS treatment targets revolving around pyroptosis may be of great significance.

In this study, we used network pharmacology and bioinformatics methods to investigate and identify all potential targets of luteolin in resolving ALI and attempted to explore how luteolin alleviates ALI through cell pyroptosis. In addition, we confirmed the potential pharmacological effects of luteolin in vivo and in vitro. A flowchart of the study is shown in Figure 1B.

METHODS

Prediction of pharmacological targets of luteolin

The structures of luteolin obtained from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/) were used to predict the pharmacological targets of luteolin in the pharmMapper database (http://www.lilab-ecust.cn/pharmmapper/). The species was set to “Homo sapiens” and irregular, nonhuman, and repetitive targets were excluded.

Collection of ALI/pyroptosis-associated genes

The relevant targets of ALI were searched in the GeneCards database (https://www.genecards.org/) using the keyword “ALI,” followed by the deletion of repetitive target genes, to establish an ALI target database. In addition, a database of pyroptosis-related target genes was constructed in the same way.

Protein-protein interaction and analysis

The common genes between ALI and luteolin were imported into the STRING platform (https://string-db.org/), with the species set to “Homo sapiens” and the minimum interaction threshold set to 0.4, to obtain concise protein-protein interaction (PPI) information, with which the PPI network was constructed and visualized using Cytoscape software (version 3.8.2).

Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses

R software (version 4.1.2) and RStudio were used to analyze the target genes by which luteolin acts on ALI. Several packages including clusterProfiler, org.Hs.eg.db, enrichplot, and ggplot2 were used to perform Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses. These three genes were imported into the Metascape database (http://metascape.org/) to identify the main pathways. The “min overlap = 2,” “min enrichment = 1.5,” and “P value cutoff <0.01” were set as significant thresholds.

Pyroptosis-associated genes in ALI

VENNY 2.1.0 software (https://bioinfogp.cnb.csic.es/tools/venny/) was used to obtain the overlapped targets between the predicted pyroptosis target genes and potential luteolin/ALI targets. Cytoscape (version 3.7.1) software was used to visually display the compound-pyroptosis–related gene-disease network.

Molecular docking

Using the UniProt database (https://www.uniprot.org/), the SDF file of the crystal structures of the receptor proteins was obtained and converted to mol2 format using PyMOL software. Subsequently, the three-dimensional crystal structures of luteolin and the proteins were optimized by removing the water molecules and adding hydrogen before docking. AutoDock Vina software was used to define the locations of the active pockets and perform molecular docking. The docking results were optimized using PyMOL software and showed the action sites of the amino acids, hydrogen bonds, and their distances.

Acquisition of data on gene expression

The Human Platelet Antigen (HPA) database (http://www.proteinatlas.org/) was used to verify the expression of the three genes (AKT1, NOS2, and CTSG) at the protein level. Meanwhile, the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/) was applied to search the potential data sets related to ALI with the key word set to “ARDS,” and the data set GSE76293 was obtained. Twelve patients with ARDS and 12 healthy controls were included in this analysis.

Animal experimental validation

Animals and grouping

Eight-week-old male C57BL/6 mice were purchased from the Shanghai Experimental Animal Center (Shanghai, China) and were housed in standard vivarium cages at ambient temperature with ad libitum access to food and water for 1 week for adaptation to the new environment.

The mice were divided into three groups (n = 4 per group): CLP, CLP/luteolin, and sham. The experiment was performed in triplicate. Luteolin was purchased from MedChemExpress (Princeton; cat# HY-N0162). Luteolin (20 mg/kg) was intraperitoneally injected 1 h before CLP. Mice in the sham group were intraperitoneally injected with the same dose of phosphate-buffered saline solution 1 h before sham CLP modeling. The study protocol was approved by the Committee on the Ethics of Animal Experiments of Shanghai Changzheng Hospital.

Cecal ligation and puncture model

An ALI mouse model was established using the classic cecal ligation and puncture procedure (17). Untreated mice were anesthetized by an intraperitoneal injection of 1% phenobarbital (40 mg/mL). A 1-cm longitudinal incision was made in the midline of the abdomen, and 50% of the cecum was exposed and ligated to the right side of the abdomen. The cecum was punctured with a 22-gauge needle between the ligation site and the end of the cecum, and a small amount of cecal content was pressed out through the punctures. The cecum was returned to its anatomical position and the abdominal cavity was closed. The mice in the sham group were treated with the same surgical procedures but without ligation and puncture.

Cell culture and treatment

RAW264.7 murine macrophage cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). RAW264.7 cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin (Gibco). All cells were cultured in a wet incubator at 37°C and 5% CO2. Luteolin was dissolved in DMSO, and the final concentration of DMSO was lower than 0.1%. Then, the murine RAW264.7 macrophages (seeded at 3 × 105 cells/mL) were treated as follows. The cells incubated with a culture medium containing 0.1% DMSO were designated as the control group. The cells stimulated with LPS (1 ug/mL) for 6 h were designated as the LPS group. The cells incubated with LPS (1 ug/mL) and luteolin (80 μM) for 6 h were designated as the LPS/luteolin group. The cells incubated with LPS (1 ug/mL), luteolin (80 μM), and AKT1 inhibitor (MCE, cat#HY-146459) for 6 h were designated as the LPS/luteolin/AKT1 inhibitor group. After 24 h, the cells were collected and analyzed as described hereinafter.

Histological analysis

Lung samples were separated and fixed in 4% paraformaldehyde fixation solution for 24 h, embedded in paraffin, and sliced (4–5 μm in thickness). Lung sections were stained with hematoxylin and eosin and images of the stained sections were captured using a LEICA CTR 5500 microscope, optical microscope (Germany). Collect 200× and 400× images, randomly select three fields of view from each slice, and use MIKAWA scoring method (18): (1) alveolar congestion, (2) hemorrhage, (3) neutrophils infiltration, and (4) thickening of alveolar septa or formation of transparent membranes. According to the severity of the lesion, it is divided into 0–4 points (0 points for no or extremely minor injury: 1 point for mild injury, 2 points for moderate injury, 3 points for severe injury, 4 points for extremely severe injury), and the total score was regarded as the pathological score.

Immunohistochemistry

Lung sections were fixed in 4% buffered formalin at 4°C for 24 h and embedded in paraffin using a routine method. The lung paraffined sections were dewaxed with xylenes, dehydrated with gradient ethanol, and washed with phosphate-buffered saline (PBS, 3 times, 3 min each time). The sections were activated with 3% endogenous peroxidase for 10 min, followed by cell membrane blocking with 0.3% Triton X-100 (50 μL) for 15 min. After that, the sections were blocked with skim milk powder and cultured with the primary anti–MPO antibodies (1/1000, Abcam, cat. #ab208670) at 4°C overnight. The sections were dehydrated and sealed. Images were acquired using LEICA CTR 5500 microscope and analyzed by Image Pro Plus 6.0 software.

Cell viability

Cell viability was assessed by cell counting kit 8 assay. RAW264.7 cells were plated in 96-well plates at a density of 2000 cells per well. The cells were treated with different concentrations of luteolin (5, 10, 20, 40, 60, 80, 100, 120, and 140 μM). After 24 h, 10 μL of cell counting kit 8 reagent was added to each well, and the cells were incubated at 37°C for 2 h. When the medium’s color turned orange, the culture was terminated, and a microplate reader was used to measure the absorbance at 490 nm.

Cell wound healing assay

RAW264.7 cells were seeded in a six-well plate and incubated until the cells coated the bottom surface of the plate. Then, a sterile pipette tip was used to make an “I-shaped” scratch of the cells coated on the bottom surface, followed by washing with PBS three times to remove cell fragments and floating cells and the subsequent addition of a serum-free culture medium. The cell healing was observed and the images were taken after 0 and 24 h under a microscope to determine the cell migration ability.

Western blot assay

Lung tissues and cells were washed with ice-cold PBS and lysed with RIPA lysis buffer (Beyotime, cat. #0013B). After centrifugation at 12,000 rpm at 4°C for 10 min, cells or tissues were collected and subjected to protein concentration detection using a bicinchoninic acid assay. Equal amounts of protein were subjected to SDS-PAGE (12.5% gels) and transferred onto PVDF membranes by electroblotting. The membranes were blocked with Tris-buffered saline with Tween 20 buffer containing 3% bovine serum albumin and then incubated with primary antibodies against AKT1 (1:1000, Affinity, cat. #AF0836), NOS2 (1:1000, Abcam, cat. #ab178945), gasdermin D (1:1000, ABclonal, cat. #A22523), caspase-11 (1:1000, Zenbio, cat. #R23724), GAPDH (1:5000, Zenbio, cat. #200306-7E4), and β-actin (1:1000, MDL, cat. #MD6553) at 4°C overnight. The membranes were probed with a peroxidase-conjugated secondary antibody (1:8000, Proteintech, cat. #SA00001-1). The antigen-antibody complexes were detected using an electrochemiluminescence reagent, and the gray values of the blot bands were calculated using ImageJ software.

Enzyme linked immunosorbent assay

Mouse orbital blood was obtained and placed in a 1.5-mL EP tube, followed by centrifugation at 3,000 g for 15 min to obtain the supernatant. The culture medium of each group was subjected to centrifugation at 1,200 rpm for 10 min to obtain the supernatant. Then, ELISA kits were used to detect the expression of IL-1β, IL-6, and TNF-α.

Quantitative real time polymerase chain reaction

The total RNA of cells was extracted by TRIzol (Invitrogen), homogenized for 1 min, and placed at 37°C for 10 min. The RNA was reverse-transcribed into complementary DNA using a reverse transcription kit (Takara Bio, Inc, Japan). Quantitative real time polymerase chain reaction was performed with an SYBR Green PCR reagent kit (Roche, Germany) on an ABI QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA). The primers were provided by Shanghai You Doctor Biotechnology Co, Ltd, and listed as follows. β-actin: sense: 5′- CATTGCTGACAGGATGCAGAAGG′, antisense: 5′- TGCTGGAAGGTGGACAGTGAGG′; AKT1: sense: 5′- GGACTACTTGCACTCCGAGAAG-3′, antisense: 5′-CATAGTGGCACCGTCCTTGATC-3′; iNOS: sense: 5′- ATGACTCCCAGCACAAAGGG-3′, antisense: 5′- CTCTCTTGCGGACCATCTCC-3′.

Statistical analysis

Data are expressed as mean ± SD. Using GraphPad PRISM 9.0.0 statistical software (San Diego, CA), the Mann-Whitney test was used, and multiple comparisons were performed to analyze the protein expression among the groups. Statistical significance was set at P < 0.05.

RESULTS

Compound-target network and therapeutic target of ALI

We searched the Human Gene Database (http://www.genecards.org/) for genes associated with the term “ALI.” A total of 520 therapeutic targets were screened from GeneCards, including AKT1, TNF, VEGFA, and IL-6 (Fig. 2A). A total of 299 genes were identified as candidate luteolin targets and were imported into the UniProt database for gene annotation and deletion of duplicates, leaving 290 targeted genes. Subsequently, a compound-target network comprising 291 nodes and 290 edges was constructed using Cytoscape (Fig. 2B). To identify the common targets between luteolin and ALI, 290 targets of luteolin were mapped to 520 disease therapeutic targets using VENNY (Fig. 2C). Fifty genes, on which luteolin exerted its influence, were identified as therapeutic targets for ALI. Finally, the STRING 11.0 database was used to find the interaction relationship of 50 target genes, followed by beautification and analysis using Cytoscape. Collectively, these results indicated that luteolin might exert its therapeutic effect through these 50 genes. The top 10 highest-scored genes, including ALB, AKT1, MAPK1, MMP9, IGF1, SRC, MAPK14, MMP2, KDR, and RHOA, were selected as hub genes (Fig. 3A).

Fig. 2.

Fig. 2

Open in a new tab

Screening of inflammatory targets for ALI. A, A total of 520 therapeutic targets from GeneCards for ALI. B, A luteolin target network comprising 291 nodes and 290 edges. C, Venn diagram of luteolin targets and ALI therapeutic targets. There were 50 overlapping targets between luteolin targets and ALI therapeutic targets. ALI, acute lung injury.

Fig. 3.

Fig. 3

Open in a new tab

Functional enrichment and protein network of inflammatory genes in lung injury. A, GO analysis with the interaction network among 50 target genes. Round orange nodes stand for the 10 hub genes. B, KEGG pathways of target genes. C, The bar plot for functionally enriched BPs, MFs, and CCs (top six for each aspect) with corresponding adjusted P values analyzed by clusterProfiler. The color scales represent the different thresholds of adjusted P values, and the lengths of the bars represent the gene count of each term. D, The circle graph for BPs of target genes. The color scales represent different thresholds of fold change, and the sizes of the dots represent the gene count of an enrichment. BP, biological process; CC, cell component; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; MF, molecular function.

Kyoto Encyclopedia of Genes and Genomes pathway enrichment and GO analyses

We performed KEGG pathway enrichment and GO analyses to identify the mechanisms between the target genes and ALI. Fifteen significant KEGG pathways were identified, including the following five categories: metabolism, environmental information processing, cellular processes, organismal systems, and human diseases. Gene Ontology analysis included the following three aspects: biological processes (BPs), molecular functions, and cell composition. There were 1,052 BPs, 39 cell compositions, and 65 molecular functions under the condition of adjusted P value less than 0.05 and q value less than 0.2. After screening the signaling pathways involved with the 50 target genes, 135 pathways were identified, and the top six pathways were visualized (Fig. 3C). We identified several inflammation-related pathways in BP. This indicates that the 50 target genes might play a crucial anti-inflammatory role in ALI through these processes. The relationship between the five BPs and the enriched genes is shown in Figure 3D.

Overlapping network of the antipyroptosis effect of luteolin on ALI

Database mining indicated mild pyroptosis in luteolin-treated ALI. According to our previous research, luteolin has an antipyroptotic effect in resolving ALI. With screened 161 genes related to pyroptosis from GeneCards (Fig. 4A), VENNY was used to obtain the intersected genes among pyroptosis, luteolin targets, and ALI treatment targets, which are presented in the intersected region in Figure 4B. This indicates that luteolin might exert an antipyroptotic effect by regulating AKT1, NOS2, and CTSG. Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis showed that these three genes were mainly enriched in cellular responses to small cell lung cancer, amoebiasis, and neutrophil extracellular trap formation (Fig. 4C).

Fig. 4.

Fig. 4

Open in a new tab

Key inflammation-related genes and molecular docking of luteolin in the treatment of pyroptosis phenotype. A, The 161 genes related to pyroptosis from GeneCards. B, Venn diagram of target genes and pyroptosis target genes. Three targets (AKT1, NOS2, and CTSG) were common between key genes and pyroptosis genes. C, KEGG pathway enrichment analysis of the three genes. D, Molecular models of luteolin binding to the three predicted targets. KEGG, Kyoto Encyclopedia of Genes and Genomes.

Predicted binding of luteolin to target proteins in ALI

Molecular docking was performed to identify the binding regions of luteolin to AKT1, NOS2, and CTSG. PyMOL was first applied to define the location of active pockets: the center of AKT1: x = 13.677, y = −4.132, z = 0.089; the center of CTSG: x = 12.256, y = 41.42, z = 2.705; and the center of NOS2: x = 12.233, y = 56.951, z = 21.71. Binding sites were obtained by docking using AutoDock Vina (Fig. 4D). The binding sites of luteolin on AKT1 were ARG-25, ARG-23, TGR-21, ILE-19, and ASN-53. The binding sites of luteolin on CTSG were LYS-217, GLY-193, ARG-41, and ALA-190. The binding sites of luteolin for NOS2 were TYR-489 and GLU-377. The binding free energies of AKT1, CTSG, and NOS2 were −7.1, −7.8, and −9.4 kcal/mol, respectively.

Database and experimental verification of the therapeutic effects of luteolin

We mined immunohistochemical sections of AKT1, iNOS, and CTSG in healthy humans from the HPA database (Fig. 5A). We observed high AKT1 expression, low iNOS expression, and no CTSG expression in normal human lung tissues (Fig. 5C). Differential gene expression between healthy controls and patients with ALI was analyzed using the GEO database. Compared with the controls, AKT1 expression in ALI patients was significantly lower (Fig. 5B); conversely, CTSG expression in ALI patients was slightly higher. Hematoxylin and eosin staining revealed histopathological changes in the lung tissues of the mice (Fig. 5C). After cecal ligation and puncture procedures, the alveolar septum was significantly thickened, the interstitial capillaries were significantly dilated and congested, and a small number of red blood cells exuded from the alveolar cavity, accompanied by a large number of inflammatory cell infiltrates in the CLP group. These injuries were alleviated upon luteolin injection. In addition, we found that upon treatment with luteolin, the levels of MPO and serum IL-1β and TNF-α decreased in mice, suggesting that luteolin could reduce the degree of inflammation in ALI mice (Fig. 5, D and E).

Fig. 5.

Fig. 5

Open in a new tab

Validation of the expression of AKT1, NOS2, and CTSG. A, Immunohistochemistry of AKT1, NOS2, and CTSG in normal lung tissue and (B) volcano plot of differential gene expression. C, Representative images of lung sections stained with hematoxylin-eosin. D, MPO activity was detected to determine pulmonary inflammation in terms of neutrophil influx. E, Expression of inflammation factors IL-1β and TNF-α. F, The protein expression of NOS2, AKT1, and GSDMD in the mouse lungs was detected by western blot assays and analyzed with ImageJ software. Data are expressed as mean ± SD (n = 4 for each group) and analyzed with the Mann-Whitney test. Compared with the control, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0:0001.

To verify whether luteolin could target AKT1 and iNOS, we detected the protein expression of NOS2 and AKT1 in ALI mice using western blot assays. We also detected the pyroptosis marker GSDMD in lung tissue. The results showed that compared with the CLP group, the expression of NOS2 and GSDMD was significantly increased, and the expression of AKT1 was significantly decreased after luteolin treatment (P < 0.05) (Fig. 5F).

AKT1 and iNOS participate in the antipyroptosis effect of luteolin

CCK-8 assay was exploited to evaluate the effects of luteolin on the viability of RAW264.7 macrophages when RAW264.7 cells were cultured with luteolin in various concentrations (0, 5, 10, 20, 40, 60, 80, 100, 120, 140 μM) for 24 h. As shown in Figure 6A, there was no significant difference in cell viability between the cells treated with 80, 100, 120, and 140 μM of luteolin. The luteolin concentration of 80 μM has been selected as the experimental dosage for subsequent experiments. In the cell migration experiment, we found that the optimal concentration of luteolin could strongly promote the migration of RAW264.7 cells (Fig. 6B). Compared with the LPS group, the expression of pyroptosis-related proteins decreased after the use of luteolin; this was reversed after AKT1 was inhibited (Fig. 6, C and D). In addition, we found that luteolin could reduce the expression of IL-1β, IL-6, and TNF-α, and this anti-inflammatory effect could be blocked by AKT1 inhibitors; thus, we believe that luteolin can play an anti-inflammatory role through AKT1 (Fig. 6E). We used the STRING database to find the relationship between AKT1 and iNOS and found that PPI enrichment P value was 0.173 (Fig. 6F). We also detected the protein expression of iNOS after inhibiting AKT1 and found that its expression was increased. Therefore, we hold the view that luteolin may regulate iNOS expression by affecting AKT1 expression (Fig. 6G).

Fig. 6.

Fig. 6

Open in a new tab

Inhibition of AKT1 could reverse the therapeutic effect of luteolin. A, Cell viability was measured by CCK-8 assays. B, Cell migration was detected by cell wound healing assays. C, The expression of AKT1 mRNA in the RAW264.7 macrophages was measured by qRT-PCR. D, AKT1 is involved in the antipyroptosis treatment of luteolin. E, Expression of inflammation factors IL-1β, IL-6, and TNF-α in RAW264.7 macrophages. F, The interaction between AKT1 and NOS2 in the STRING database. G, AKT1 has an influence on NOS2 expression. Data are expressed as mean ± SD (n = 3 for each group) and analyzed with the Mann-Whitney test. Compared with the control, *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

DISCUSSION

Acute respiratory distress syndrome is characterized by noncardiac pulmonary edema and acute progressive hypoxemia caused by a variety of intrapulmonary and extrapulmonary pathogenic factors. Acute respiratory distress syndrome is not a disease, but rather a collection of several disorders that cause acute parenchymal lung failure or a sequela to diverse conditions. Sepsis, trauma, and ischemia-reperfusion injury are major clinical disorders that contribute to the development of ARDS during hospitalization (19,20). The progressive accumulation of protein-rich fluid within the interstitium and alveolus, uncontrolled inflammation, and lung endothelial and epithelial barrier dysfunction are involved in the pathogenesis of ALI (20). Lung injury is an inflammatory condition. Recently, plant extracts for ARDS treatment have been divided into flavonoids, terpenoids, alkaloids, and polyphenols (21–23), all of which play an anti-inflammatory role in the treatment. Flavonoids extracted from traditional Chinese herbs have long been studied for their anti-inflammatory activity. A network pharmacology-based analysis of Scutellaria baicalensis treatment of ARDS showed that wogonin, a plant flavonoid compound extracted from Scutellaria baicalensis, not only improved cell activity but also reduced the degree of lung inflammation by targeting PI3K/AKT signaling pathway-associated molecules such as BAD and Bcl-2 (24). Recent research has indicated that curcumin regulates the expression of SIRT1 and suppresses the activation of NLRP3, thus alleviating pulmonary inflammation (25).

Luteolin, a natural flavonoid, has a strong anti-inflammatory effect, as demonstrated in mounting trials. Luteolin is adaptable to various types of cells and exerts biological activity at micromolar concentrations (7). Luteolin reduces the production of inflammatory factors by regulating the immune microenvironment. Thus, luteolin can regulate the inflammatory response in ARDS. The effects of luteolin on ARDS may be divided into the following categories: luteolin mitigated pulmonary edema in a sepsis model, and notably, such mitigation in ARDS is achieved by increasing the activity of cGMP/PI3K-dependent epithelial sodium channels (10). In addition, luteolin exerts its anti-inflammatory role by improving the expression of HO-1 in macrophages to inhibit the extracellular HMGB1 level to control the development of ARDS (26). In addition, luteolin influences intrapulmonary oxidative stress and increases the activities of malondialdehyde, catalase, glutathione peroxidase, superoxide dismutase, and other antioxidants (11,12). In this study, we identified the following top 10 hub genes: ALB, AKT1, MAPK1, MMP9, IGF1, SRC, MAPK14, MMP2, KDR, and RHOA (Fig. 3A). AKT1, MAPK1, IGF1, SRC, MAPK14, KDR, and RHOA are reported to be involved in the RAP1 signaling pathway. Studies have shown that RAP1 signal-associated molecules participate in integrin activation, which is involved in T-cell migration to sites of inflammation (27). KDR, SRC, MAPK1, MAPK14, and AKT1, which are linked to the VEGF signaling pathway, participate in cell migration and permeability. Matrix metalloproteinase 2 (MMP2) and MMP9 lyse the extracellular matrix, and both are elevated with the disease severity in inflammatory disorders (28) such as Alzheimer disease (29) and colon cancer (30). Matrix metalloproteinases can also aggravate ALI by upregulating the RHOA/ROCK signaling pathway (31). Unlike other hub genes, ALB or albumin is a natural delivery vehicle that accumulates at inflamed sites in the human body. Many drugs are delivered to inflamed sites after binding to albumin. In lipopolysaccharide- and pam3CSK-treated macrophages, luteolin inhibited SRC phosphorylation. The sites of this phosphorylation were not in the SH2 and SH3 regions but in the ATP-binding pockets (32). Among the enriched pathways linked to luteolin (Fig. 3B), inflammation, microvascular endothelial cell integrity, and T-cell activation play leading roles in lung injury. Another study found that T-cell receptor activation was involved in luteolin treatment of lung injury, which suppressed the expression of IL-17A and induced Treg differentiation (33).

Patients with ARDS have diverse phenotypes, and appropriate phenotype-specific therapies would benefit the precise treatment of ARDS (34). Pyroptosis, an inflammatory form of programmed cell damage, can help identify the molecular targets of disease treatment. Pyroptosis depends on the activation of caspase-1/11, which mature cytokines and lead to necrotic cell death, respectively (35). The activation of inflammatory cysteine in inflammatory corpuscles can drive the pro-pyroptosis factor GSDMD to break down and produce N-terminal fragments, which oligomerize in the host cell membrane to form pores, eventually leading to pyroptosis (36). This induces inflammatory cell swelling and cracking, thereby releasing intracellular proinflammatory substances and subsequently producing a strong inflammatory response (37). Luteolin significantly reduced cell viability and the expression of HMGB1, which could elicit pyroptosis (38). Luteolin can attenuate caspase-11–dependent lung pyroptosis by activating Tregs (39). Natural compounds from traditional medicinal herbs can bind to multiple targets. Therefore, the mechanism underlying the therapeutic effect of luteolin in ARDS should be multidimensional. Network pharmacology strategies can systematically screen biotargets, links between proteins, and BPs at the molecular level in ALI. In our network pharmacology study, we aimed to identify the genes associated with luteolin, pyroptosis, and ALI using GO and KEGG enrichment analyses and the Metascape database, and eventually identify the key target genes among luteolin targets, disease (lung injury) targets, and pyroptosis phenotype targets.

Our study showed that AKT1, NOS2, and CTSG are genes of pyroptosis that luteolin might target in ALI therapy with high probability. Generally, the binding of compounds to proteins is stable when the binding free energy of molecular docking is less than −6 kcal/mol. In our work, the binding free energies of AKT1, CTSG, and NOS2 were −7.1, −7.8, and −9.4 kcal/mol, respectively (Fig. 4D). This indicated stable binding of AKT1, CTSG, and NOS2 with luteolin. In the KEGG analysis, we found that the three genes were mainly enriched in cellular responses to small-cell lung cancer, amoebiasis, and neutrophil extracellular trap formation (Fig. 4C). In addition, we mined the immunohistochemical information for these three proteins in normal human lung tissue from the HPA database (Fig. 5A). Notably, in normal lung tissues, AKT1 expression increased, iNOS expression was very low, and no CTSG expression was observed. Therefore, because of the small change and low expression of CTSG in sepsis patients, we speculated that CTSG may play a small role in luteolin reducing the pyroptosis of lung injury, and the changes in AKT1 and iNOS expression in ALI would be more meaningful. In addition, we analyzed the differential expression of AKT1, CTSG, and iNOS in sepsis patients using the GEO database (Fig. 5B). According to our data mining results, AKT1 expression in sepsis patients decreased; in contrast, CTSG expression increased. According to previous studies, AKT1 is a serine/threonine protein of the AKT family and can prevent infections and autoimmunity (40). AKT1 can negatively regulate neutrophil recruitment and function depending on STAT3 signaling in lung tissue during ALI (41). Thus, AKT1 may be a protective factor against ALI. CTSG (Cathepsin G) elevates neutrophils and promotes their recruitment in ALI (42). CTSG directly participates in the activation of caspase-4 through bacterial ligands, thereby causing cell pyroptosis (43). Evidence suggests that its activation reduces the survival of lung epithelial cells and disrupts homeostasis maintained by tight junctions (44). Through our network pharmacology analysis, we considered that AKT1, NOS2, and CTSG may preliminarily be the target genes of luteolin in the treatment of ALI during pyroptosis.

In animal experiments, we determined that luteolin had a therapeutic effect in sepsis mice (Fig. 5, C and D). Meanwhile, we detected the levels of inflammatory markers in mice and found their levels decreased, which indicated that luteolin had a certain anti-inflammatory effect in septic mice (Fig. 5E). In addition, compared with the CLP/sepsis group without luteolin treatment, AKT1 protein levels were significantly increased and iNOS protein levels were significantly decreased in the CLP/luteolin group (Fig. 5F). This suggests that AKT1 and iNOS may be the molecular targets of luteolin. Next, we examined the overall pyroptosis levels in the mouse lungs. We found that the protein expression of the pyroptosis marker GSDMD in the mouse lungs decreased after luteolin treatment (Fig. 5F). Therefore, luteolin may affect pyroptosis in vivo by targeting AKT1 and iNOS, thereby treating sepsis-induced lung injury.

To further elucidate the effect of luteolin on pyroptosis, we used RAW264.7 cells for in vitro experiments and treated them with different concentrations of luteolin after 6-h LPS stimulation (Fig. 6A). Besides, luteolin can promote cell migration of RAW264.7 (Fig. 6B). The expression of GSDMD and caspase-11 was significantly decreased at the most suitable concentration of luteolin (Fig. 6D). Both classical and nonclassical pathways for pyroptosis use GSDMD as a downstream effector (45). Caspase-11 is activated by LPS stimulation and activated caspase-11 cleaves GSDMD, and cleaved GSDMD forms transmembrane pores to enable the release of cytokines such as IL-1β (46). To clarify the role of AKT1 and iNOS in the treatment of lung injury by luteolin, we inhibited the expression of AKT1 with its inhibitors (Fig. 6, C–E) and found pyroptosis-related proteins increased rapidly, accompanied by a dramatic increase in cytokines. This indicated that luteolin can target the regulation of AKT1 levels and thereby improve pyroptosis. The latest study found that AKT1 was involved in pyroptosis in severe pancreatitis through AKT1/NF-κB pathway (47). Interestingly, we found a correlation between AKT1 and iNOS in the STRING database. The expression of iNOS showed an upward trend upon inhibition of AKT1. It has been reported that AKT1−/− macrophages can promote their polarization into M1 macrophages, and LPS-stimulated AKT1−/− macrophages also express high levels of iNOS (48). These findings indicate that luteolin can target the regulation of AKT1/iNOS levels to affect pyroptosis in sepsis-induced lung injury. Unfortunately, we did not weigh each molecule when the pathway(s) were enriched in KEGG analysis. Some genes have little expression but probably have a great influence on the pathway(s). In addition, although our studies have shown that luteolin has a potential therapeutic effect on ALI, its clinical application still has a long way to go. In terms of the clinical transformation of such a natural molecule, we need to overcome many problems, such as toxicity detection and half-life detection.

In conclusion, we identified the potential targets and pathways of luteolin in the treatment of lung injury using network pharmacology analysis. Besides, we validated the therapeutic effects and mechanism of luteolin in vivo and in vitro. Our finding suggested that luteolin could target AKT1 and iNOS expression, thus affecting the pyroptosis of sepsis-induced lung injury.

Footnotes

The authors report no conflicts of interest.

Contributor Information

Danying Zhang, Email: 19941102875@163.com.

Yifan Li, Email: ivannmu@163.com.

Weiwei Jiang, Email: jiangweiwei0521@163.com.

Wenfang Li, Email: chzhedlwf@163.com.

Xiaowei Yuan, Email: 15821699471@163.com.

REFERENCES

  • 1.Morales-Ortíz J Deal V Reyes F, et al. Platelet-derived TLT-1 is a prognostic indicator in ALI/ARDS and prevents tissue damage in the lungs in a mouse model. Blood. 2018;132(23):2495–2505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Williams GW Berg NK Reskallah A, et al. Acute respiratory distress syndrome. Anesthesiology. 2021;134(2):270–282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.He YQ Zhou CC Yu LY, et al. Natural product derived phytochemicals in managing acute lung injury by multiple mechanisms. Pharmacol Res. 2021;163:105224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Lavecchia A, Cerchia C. In silico methods to address polypharmacology: current status, applications and future perspectives. Drug Discov Today. 2016;21(2):288–298. [DOI] [PubMed] [Google Scholar]
  • 5.Boezio B Audouze K Ducrot P, et al. Network-based approaches in pharmacology. Mol Inform. 2017;36(10). [DOI] [PubMed] [Google Scholar]
  • 6.Gendrisch F Esser PR Schempp CM, et al. Luteolin as a modulator of skin aging and inflammation. Biofactors. 2021;47(2):170–180. [DOI] [PubMed] [Google Scholar]
  • 7.Aziz N, Kim MY, Cho JY. Anti-inflammatory effects of luteolin: a review of in vitro, in vivo, and in silico studies. J Ethnopharmacol. 2018;225:342–358. [DOI] [PubMed] [Google Scholar]
  • 8.Liu X, Meng J. Luteolin alleviates LPS-induced bronchopneumonia injury in vitro and in vivo by down-regulating microRNA-132 expression. Biomed Pharmacother. 2018;106:1641–1649. [DOI] [PubMed] [Google Scholar]
  • 9.Lin Y Shi R Wang X, et al. Luteolin, a flavonoid with potential for cancer prevention and therapy. Curr Cancer Drug Targets. 2008;8(7):634–646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hou Y Li J Ding Y, et al. Luteolin attenuates lipopolysaccharide-induced acute lung injury/acute respiratory distress syndrome by activating alveolar epithelial sodium channels via cGMP/PI3K pathway. J Ethnopharmacol. 2022;282:114654. [DOI] [PubMed] [Google Scholar]
  • 11.Rungsung S Singh TU Rabha DJ, et al. Luteolin attenuates acute lung injury in experimental mouse model of sepsis. Cytokine. 2018;110:333–343. [DOI] [PubMed] [Google Scholar]
  • 12.Celebi D Aydin P Cinar I, et al. Protective effect of luteolin on acute lung injury in a rat model of sepsis. Biotech Histochem. 2021;96(8):579–585. [DOI] [PubMed] [Google Scholar]
  • 13.Vande Walle L, Lamkanfi M. Pyroptosis. Curr Biol. 2016;26(13):R568–R572. [DOI] [PubMed] [Google Scholar]
  • 14.Cheng KT Xiong S Ye Z, et al. Caspase-11-mediated endothelial pyroptosis underlies endotoxemia-induced lung injury. J Clin Invest. 2017;127(11):4124–4135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Xie K Chen YQ Chai YS, et al. HMGB1 suppress the expression of IL-35 by regulating naive CD4+ T cell differentiation and aggravating caspase-11–dependent pyroptosis in acute lung injury. Int Immunopharmacol. 2021;91:107295. [DOI] [PubMed] [Google Scholar]
  • 16.Hou L Yang Z Wang Z, et al. NLRP3/ASC-mediated alveolar macrophage pyroptosis enhances HMGB1 secretion in acute lung injury induced by cardiopulmonary bypass. Lab Invest. 2018;98(8):1052–1064. [DOI] [PubMed] [Google Scholar]
  • 17.Benjamim CF Lundy SK Lukacs NW, et al. Reversal of long-term sepsis-induced immunosuppression by dendritic cells. Blood. 2005;105(9):3588–3595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Mikawa K Nishina K Takao Y, et al. ONO-1714, a nitric oxide synthase inhibitor, attenuates endotoxin-induced acute lung injury in rabbits. Anesth Analg. 2003;97(6):1751–1755. [DOI] [PubMed] [Google Scholar]
  • 19.Matthay MA, Zemans RL. The acute respiratory distress syndrome: pathogenesis and treatment. Annu Rev Pathol. 2011;6:147–163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Thompson BT, Chambers RC, Liu KD. Acute respiratory distress syndrome. N Engl J Med. 2017;377(6):562–572. [DOI] [PubMed] [Google Scholar]
  • 21.Wu YH Wu YR Li B, et al. Cryptotanshinone: a review of its pharmacology activities and molecular mechanisms. Fitoterapia. 2020;145:104633. [DOI] [PubMed] [Google Scholar]
  • 22.Salminen A Lehtonen M Suuronen T, et al. Terpenoids: natural inhibitors of NF-kappaB signaling with anti-inflammatory and anticancer potential. Cell Mol Life Sci. 2008;65(19):2979–2999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zhou HX Li RF Wang YF, et al. Total alkaloids from Alstonia scholaris inhibit influenza a virus replication and lung immunopathology by regulating the innate immune response. Phytomedicine. 2020;77:153272. [DOI] [PubMed] [Google Scholar]
  • 24.Zhu G Zhang J Yang Y, et al. The key target and molecular mechanism of the volatile component of Scutellaria baicalensis Georgi in acute lung injury based on network pharmacology. Front Pharmacol. 2021;12:650780. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Wang Y Wang Y Cai N, et al. Anti-inflammatory effects of curcumin in acute lung injury: in vivo and in vitro experimental model studies. Int Immunopharmacol. 2021;96:107600. [DOI] [PubMed] [Google Scholar]
  • 26.Park EJ Kim YM Kim HJ, et al. Luteolin activates ERK1/2- and Ca2+-dependent HO-1 induction that reduces LPS-induced HMGB1, iNOS/NO, and COX-2 expression in RAW264.7 cells and mitigates acute lung injury of endotoxin mice. Inflamm Res. 2018;67(5):445–453. [DOI] [PubMed] [Google Scholar]
  • 27.Menasche G Kliche S Bezman N, et al. Regulation of T-cell antigen receptor-mediated inside-out signaling by cytosolic adapter proteins and Rap1 effector molecules. Immunol Rev. 2007;218:82–91. [DOI] [PubMed] [Google Scholar]
  • 28.Cabral-Pacheco GA Garza-Veloz I Castruita-De la Rosa C, et al. The roles of matrix metalloproteinases and their inhibitors in human diseases. Int J Mol Sci. 2020;21(24). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ali F, Siddique YH. Bioavailability and pharmaco-therapeutic potential of luteolin in overcoming Alzheimer's disease. CNS Neurol Disord Drug Targets. 2019;18(5):352–365. [DOI] [PubMed] [Google Scholar]
  • 30.Pandurangan AK Dharmalingam P Sadagopan SK, et al. Luteolin inhibits matrix metalloproteinase 9 and 2 in azoxymethane-induced colon carcinogenesis. Hum Exp Toxicol. 2014;33(11):1176–1185. [DOI] [PubMed] [Google Scholar]
  • 31.Abedi F Hayes AW Reiter R, et al. Acute lung injury: the therapeutic role of rho kinase inhibitors. Pharmacol Res. 2020;155:104736. [DOI] [PubMed] [Google Scholar]
  • 32.Lee J-O Jeong D Kim M-Y, et al. ATP-binding pocket-targeted suppression of Src and Syk by luteolin contributes to its anti-inflammatory action. Mediators Inflamm. 2015;2015:967053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Xie K Chai Y-S Lin S-H, et al. Luteolin regulates the differentiation of regulatory T cells and activates IL-10–dependent macrophage polarization against acute lung injury. J Immunol Res. 2021;2021:8883962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Silva PL, Pelosi P, Rocco PRM. Personalized pharmacological therapy for ARDS: a light at the end of the tunnel. Expert Opin Investig Drugs. 2020;29(1):49–61. [DOI] [PubMed] [Google Scholar]
  • 35.Linkermann A Stockwell BR Krautwald S, et al. Regulated cell death and inflammation: an auto-amplification loop causes organ failure. Nat Rev Immunol. 2014;14(11):759–767. [DOI] [PubMed] [Google Scholar]
  • 36.Sun C-Y Xu L-Q Zhang Z-B, et al. Protective effects of pogostone against LPS-induced acute lung injury in mice via regulation of Keap1-Nrf2/NF- κB signaling pathways. Int Immunopharmacol. 2016;32:55–61. [DOI] [PubMed] [Google Scholar]
  • 37.Man SM, Karki R, Kanneganti TD. Molecular mechanisms and functions of pyroptosis, inflammatory caspases and inflammasomes in infectious diseases. Immunol Rev. 2017;277(1):61–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wang Y Zhang H Chen Q, et al. TNF-α/HMGB1 inflammation signalling pathway regulates pyroptosis during liver failure and acute kidney injury. Cell Prolif. 2020;53(6):e12829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zhang ZT Zhang DY Xie K, et al. Luteolin activates Tregs to promote IL-10 expression and alleviating caspase-11–dependent pyroptosis in sepsis-induced lung injury. Int Immunopharmacol. 2021;99:107914. [DOI] [PubMed] [Google Scholar]
  • 40.Weichhart T, Saemann MD. The PI3K/Akt/mTOR pathway in innate immune cells: emerging therapeutic applications. Ann Rheum Dis. 2008;67(suppl 3):iii70–iii74. [DOI] [PubMed] [Google Scholar]
  • 41.Liu G Bi Y Wang R, et al. Kinase AKT1 negatively controls neutrophil recruitment and function in mice. J Immunol. 2013;191(5):2680–2690. [DOI] [PubMed] [Google Scholar]
  • 42.Gao F Liu X Shen Z, et al. Andrographolide sulfonate attenuates acute lung injury by reducing expression of myeloperoxidase and neutrophil-derived proteases in mice. Front Physiol. 2018;9:939. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Jun HK Jung YJ Ji S, et al. Caspase-4 activation by a bacterial surface protein is mediated by cathepsin G in human gingival fibroblasts. Cell Death Differ. 2018;25(2):380–391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Filipczak PT Senft AP Seagrave J, et al. NOS-2 inhibition in phosgene-induced acute lung injury. Toxicol Sci. 2015;146(1):89–100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kayagaki N Stowe IB Lee BL, et al. Caspase-11 cleaves gasdermin D for non-canonical inflammasome signalling. Nature. 2015;526(7575):666–671. [DOI] [PubMed] [Google Scholar]
  • 46.Wang K Sun Q Zhong X, et al. Structural mechanism for GSDMD targeting by autoprocessed caspases in pyroptosis. Cell. 2020;180(5):941–955.e20. [DOI] [PubMed] [Google Scholar]
  • 47.Wang X Qian J Meng Y, et al. Salidroside ameliorates severe acute pancreatitis-induced cell injury and pyroptosis by inactivating Akt/NF-κB and caspase-3/GSDME pathways. Heliyon. 2023;9(2):e13225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Arranz A Doxaki C Vergadi E, et al. Akt1 and Akt2 protein kinases differentially contribute to macrophage polarization. Proc Natl Acad Sci U S A. 2012;109(24):9517–9522. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Shock (Augusta, Ga.) are provided here courtesy of Wolters Kluwer Health

RESOURCES