Arc1 : a regulator of triglyceride homeostasis in male Drosophila

Abstract

Achieving metabolic homeostasis is necessary for survival, and many genes are required to control organismal metabolism. A genetic screen in Drosophila larvae identified putative fat storage genes including Arc1 . Arc1 has been shown to act in neurons to regulate larval lipid storage; however, whether Arc1 functions to regulate adult metabolism is unknown. Arc1 ^esm18 males store more fat than controls while both groups eat similar amounts. Arc1 ^esm18 flies express more brummer lipase and less of the glycolytic enzyme triose phosphate isomerase, which may contribute to excess fat observed in these mutants. These results suggest that Arc1 regulates adult Drosophila lipid homeostasis.

Figure 1. Arc1 mutant Drosophila store excess fat .

(A) Triglyceride (TAG), glycogen, and free glucose concentrations were measured in approximately 1-2 week old male w ¹¹¹⁸ and Arc1 ^esm18 Drosophila . Bars indicate average macromolecule concentrations normalized by protein concentrations ± standard error (n=16). (B) 1-2 week old male w ¹¹¹⁸ and Arc1 ^esm18 Drosophila were fed 5% sucrose and the amount eaten after 24 hours was measured. Bars represent the average food consumed after 24 hours ± standard error (n=9-12). (C) qPCR was performed for brummer ( bmm ), fatty acid synthase ( FASN1 ), triose phosphate isomerase ( Tpi ), and withered ( whd ) from cDNA generated from RNA samples isolated from 1-2 week old male w ¹¹¹⁸ and Arc1 ^esm18 flies. Expression was normalized by the expression of rp49. Bars indicate the average normalized mRNA expression of each gene ± standard error (n=6). * p < 0.05, ** p < 0.01 as determined by unpaired, two-tailed t-test.

Description

All multicellular organisms require a well-regulated metabolism to survive. When not regulated appropriately, fat stores can accumulate leading to diseases such as obesity and type II diabetes (Singh et al., 2017) . Many genes are required for this to occur; however, not all of them are known. The fruit fly, Drosophila melanogaster , provides an excellent system to identify and study genes important for lipid and carbohydrate metabolism. Many metabolic genes present within Drosophila are conserved in mammals and Drosophila has an adipose-like organ called the fat body that stores and metabolizes lipids similarly to mammalian adipose tissue (Baker and Thummel, 2007; Musselman & Kühnlein, 2018; Heier et al., 2021). To identify genes important for fat storage, a buoyancy-based screen was performed utilizing Drosophila larvae (Reis et al., 2010) . This screen identified 66 genes that may be involved in the regulation of fat content and one such gene is the activity-regulated cytoskeleton-associated protein 1 ( Arc1 ) (Reis et al., 2010) . Arc1 mutant larvae have increased buoyancy and Arc1 has been shown to act in specific neurons in the larval brain to regulate fat accumulation (Mosher et al., 2015) . Additionally, Drosophila adults with a mutated Arc1 gene are resistant to starvation (Mattaliano et al., 2007) suggesting a metabolic function; however, whether Arc1 functions in adult flies to regulate lipid storage is not yet known.

To explore the metabolic functions of Arc1 in adult flies, triglyceride (TAG), glycogen, and free glucose levels were measured in male control ( w ¹¹¹⁸ ) and Arc1 mutant ( Arc1 ^esm18 ) flies. Arc1 mutant male flies have significantly higher levels of triglycerides than male control flies ( Fig. 1A ), consistent with previous work depleting Arc1 in larvae (Mosher et al., 2015) . It is possible that the increased triglyceride phenotype in Arc1 mutants is due to increased food consumption. To test this hypothesis, we conducted a feeding assay on male w ¹¹¹⁸ and Arc1 ^esm18 flies and found that male Arc1 flies consume the same amount as the controls ( Fig. 1B ). This suggests that the excess fat in Arc1 mutant flies is not due to increasing food consumption.

The triglyceride accumulation seen in male Arc1 mutant flies may arise from increased lipid synthesis, decreased lipid breakdown, or both. To address this question, we measured the expression of several lipid metabolic enzyme genes in cDNA generated from total RNA isolated from control ( w ¹¹¹⁸ ) and mutant Arc1 (Arc1 ^esm18 ) flies using reverse transcription-qPCR analysis ( Fig. 1C ). We measured the expression of the fatty acid synthesis enzyme gene FASN1 , the triglyceride lipase gene bmm , and the Drosophila homolog of the rate limiting reaction in beta oxidation of fatty acids carnitine palmitoyltransferase I (known as whd in flies). While there was no change in FASN1 expression, we observed an increase in bmm levels and a trend for an increase in whd levels ( Fig. 1C ) suggesting that loss of Arc1 may be increasing the expression of these lipid breakdown genes to compensate for the excess TAG accumulation. Additionally, we measured the expression of the triose phosphate isomerase gene Tpi, which encodes an enzyme that interconverts dihydroxyacetone phosphate (DHAP) and glyceraldehyde 3-phosphate (GAP) in glycolysis. We chose to measure Tpi levels because Mosher et al. showed increased levels of glycerol-3-phosphate (G3P) and decreased levels of GAP in Arc1 mutants suggesting a defect in the TPI enzyme. We observed a significant decrease in Tpi expression in Arc1 mutants ( Fig. 1C ), suggesting that DHAP is not entering glycolysis as GAP but rather being converted to G3P (a substrate for triglyceride esterification) and may contribute to the triglyceride accumulation phenotype observed in Arc1 mutants. Together, these results suggest that Arc1 functions to regulate multiple genes encoding important metabolic enzymes to control lipid homeostasis in adult flies.

Based on our data, the Arc1 gene appears to have a regulatory role in the storage of lipids in adult Drosophila . Our results indicate that male Arc1 mutant Drosophila store more fat than male control flies. This data is consistent with previous studies that found that Arc1 mutant larvae are more buoyant and have higher levels of fat compared to controls (Reis et al. 2010 and Mosher et al. 2015) . Interestingly, this increase in fat storage is not due to increased feeding as our data also show that these male Arc1 mutant flies consume the same amount of food as the control flies. Additionally, the increased triglyceride levels shown here is consistent with the starvation resistance phenotype observed previously (Mattaliano et al., 2007) . This previous study noted that Arc1 mutant flies did not show hyperactive behavior when starved, allowing them to live longer during starvation (Mattaliano et al., 2007) . These starvation resistance and lack of hyperactivity phenotypes could also be due to increased fat storage and further experimentation is necessary to address these possibilities. Moreover, while we only tested triglyceride levels in adult male flies in this study, the increased fat phenotype in the Mosher et al. (2015) study was observed in 3rd instar larvae and the starvation resistance phenotype in Mattaliano et al. (2007) was shown in adult female flies, suggesting that Arc1 may regulate lipid storage similarly at different stages of Drosophila development and in both male and female flies; however, additional studies are needed to support this claim.

We also show that the loss of Arc1 decreases the expression of the glycolysis enzyme triose phosphate isomerase (TPI). This change would increase the levels of DHAP because it cannot be converted into GAP during glycolysis. The extra DHAP could be converted into G3P, a substrate for triglyceride synthesis. This hypothesis is consistent with the decreased levels of GAP and increased levels of G3P observed in Arc1 mutant larvae (Mosher et al., 2015) . However, whether these changes in GAP and G3P are observed in adult Arc1 mutants still needs to be shown. In addition, the mechanism of how Arc1 regulates the expression of genes encoding metabolic enzymes like bmm and Tpi is not known. Moreover, whether the expression of additional genes encoding metabolic enzymes is altered in Arc1 mutants is not fully understood. Experiments designed to address these questions are necessary to better our understanding of the metabolic functions of Arc1 .

In conclusion, we show that the Arc1 gene plays a role in regulating fat storage in adult Drosophila . Portions of Drosophila Arc1 are conserved in the mammalian Arc gene, which is a master regulator of synaptic plasticity in the brain (Shepherd and Bear, 2011; Mattaliano et al., 2007) . Therefore, our results could further our knowledge of the functions of the Arc gene in humans, particularly any putative metabolic roles . Together, the results of this study expand our understanding of the genes important for regulating lipid homeostasis and could have implications for increasing our understanding of the pathogenesis of metabolic diseases like obesity or type II diabetes in humans.

Methods

Fly husbandry. Flies were grown at room temperature on sugar-cornmeal-yeast medium (9 g Drosophila agar (Genesee Scientific), 100 mL Karo Lite Corn Syrup, 65 g cornmeal, 40 g sucrose, and 25 g whole yeast in 1.25 L water) and 1-2 week old male flies were used in all experiments.

Triglyceride, Glycogen, and Free glucose Assays. Five male w ¹¹¹⁸ or Arc1 ^esm18 Drosophila were placed in lysis buffer (140 mM NaCl, 50 mM Tris-HCl, pH 7.5, 0.1% Triton-X with 1X protease inhibitor cocktail (Roche)) and homogenized. A Bradford assay was then conducted using 1X Bradford Reagent (Bio-Rad) as per the manufacturer’s instructions.

The free glucose levels in each sample were measured using Pointe Specific Glucose oxidase reagent (Fisher) as per the manufacturer’s instructions. To measure glycogen levels, each sample was incubated for 2 hours at 37°C in amyloglucosidase (8 mg/mL in 0.2M citrate buffer, pH 5.0 (Sigma)). Pointe Specific Glucose oxidase reagent (Fisher) was added to the digested samples to determine the total glucose concentration in each sample (as per the manufacturer’s instructions.). The free glucose values were then subtracted from the total glucose to determine glycogen concentrations. The triglyceride levels of each sample were determined using Infinity triglyceride reagent (Fisher) as per the manufacturer’s instructions. All free glucose, glycogen and triglyceride values were normalized using corresponding protein concentrations.

Feeding Assay. Food consumption was measured as previously described (Ja et al., 2007) . Briefly, groups of 4 male flies were placed in Drosophila vials containing 1% agar. 5 μL capillary tubes were filled with dyed 5% sucrose and the amount of sucrose consumed over 24 hours was measured. A vial with no flies was used as an evaporation control. The distance that the sucrose travelled in each capillary tube was divided by the number of flies in each vial and averaged.

RNA Isolation and Quantitative PCR. Groups of 10 male w ¹¹¹⁸ and Arc1 ^esm18 mutant flies were homogenized in Trizol (Invitrogen) per manufacturer’s instructions. 5 μg of RNA was then treated with DNase as per manufacturer’s instructions (Ambion). DNase-treated RNA (1 μg) was then reverse transcribed into cDNA using qScript Ultra SuperMix (Quanta Bio) according to manufacturer’s instructions.

Quantitative PCR was performed to amplify the following genes: bmm, FASN1, Tpi, whd, and rp49 (see primer sequences below). Each reaction was prepared using 1 μL of cDNA, 200 nM of each primer, and 1X Perfecta SYBR Green (Quanta Bio) as per manufacturer’s instructions. The qPCR cycling conditions included: 95℃ for 3 min, 40 cycles of 95℃ for 30 sec, 60℃ for 60 sec, and 72℃ for 30 sec followed by a melt curve. The relative expression of each gene was normalized by the corresponding rp49 expression.

Gene	Forward (5’ to 3’)	Reverse (5’ to 3’)
bmm	ACGTGATCATCTCGGAGTTTG	ATGGTGTTCTCGTCCAGAATG
FASN1	CTGGCTGAGCAAGATTGTGTG	TCGCACAACCAGAGCGTAGTA
Tpi	ATCAGGCTCAAGAGGTCCAC	GCGTTGATGATGTCCACGAA
whd	GCAAGTGCAAATTGAGGAAA	AAGTGCTCCTCACCTTCCAC
rp49	GACGCTTCAAGGGACAGTATCTG	AAACGCGGTTCTGCATGAG

Statistical Analysis. Data from each assay was averaged and compared via an unpaired two-tailed t-test with p < 0.05 indicating a significant difference. A p-value of 0.05 or less is indicated by a single asterisk. A p-value of 0.01 or less is indicated by two asterisks.

Reagents

Strain	Genotype	Available from
w 1118	w 1118	Bloomington Stock Center #3605
Arc1 mutant	w[*]; Arc1 esm18	Bloomington Stock Center #37530

Funding Statement

Funds from Pennsylvania State University, Berks Campus were used to support this research.