Skip to main content
The Onderstepoort Journal of Veterinary Research logoLink to The Onderstepoort Journal of Veterinary Research
. 2023 Jul 26;90(1):2085. doi: 10.4102/ojvr.v90i1.2085

Monitoring the genetic variation of some Escherichia coli strains in wild birds and cattle

Ghada A Ibrahim 1, Ahmed M Salah-Eldein 2, Mayasar I Al-zaban 3, Amal SA El-Oksh 4, Elsayyad M Ahmed 5, Doaa S Farid 6, Enas M Saad 2,
PMCID: PMC10483432  PMID: 37526530

Abstract

To date, there is limited data about the genetic relationship of Escherichia coli between wild birds and cattle because these birds act as silent vectors for many zoonotic bacteria. This study aimed to elucidate the role of rooming wild birds in the vicinity of cattle farm in transmission of the same pathogenic E. coli variants, identifying their virulence, resistance traits and genetic similarities of fimH virulence gene. About 240 faecal/cloacal swabs were collected from both species and examined bacteriologically. Escherichia coli was yielded in 45.8% and 32.5%, respectively, of examined cattle and wild birds. The most prevalent detected E. coli serovar was O26. High tetracycline and chloramphenicol resistance were recorded; however, gentamycin and ciprofloxacin exhibited the highest sensitivity rates. Polymerase chain reaction (PCR) conserved genotypic resistance (tetA and blaCTX-M) and virulence attributes (fimH, stx1, eaeA and ompA) of E. coli isolates were discussed in detail. The fimH gene revealed 100% sequence similarity when comparing with different E. coli isolates globally and locally. Finally, a close genetic association of E. coli with both wild birds and cattle was detected, thus strengthening its role in the dissemination of the infection via environment. Prevention and conservative policy should be carried as E. coli constitute enormous significant zoonotic risks to livestock and animal workers. Also, further studies to the whole genome sequencing of fimH, other virulence and resistance genes of E. coli are recommended trying to limit the possibilities of co-infection and transfer among different species.

Contribution

The current study recorded updated data about the critical infectious role of wild birds to livestock, including cattle farms in Egypt. It also delivered some recommendations for good hygienic practices in cattle farms which must be implemented for handling animal manure.

Keywords: E. coli, wild birds, cattle, virulence genes, resistant genes, PCR, antibiotics, sequencing

Introduction

Wildlife constitutes a magnificent network that might spread a number of potentially significant bacterial diseases with their antimicrobial-resistance traits among livestock animals and infrastructure because of high bird travel and mobilisation in multiple countries during different seasons (Arnold et al. 2016). Migratory and non-migratory wild birds could serve as the main transmitter for the infection with the family Enterobacteriaceae specifically Escherichia coli spp. (Shobrak & Abo-Amer 2014).

Escherichia coli is a Gram-negative environmental bacterium that commensally inhabits the intestinal tract of warm-blooded animals and birds. However, these bacteria could cohabit with other bacteria forming the commensal gut microbiota; some E. coli variants might develop virulent characteristics producing the disease (Umpiérrez et al. 2021).

Hence, the antimicrobial resistance problems could extremely extend to transfer the antibiotic-resistant genes among different species via plasmid or transposon (Borges et al. 2017). For antimicrobial resistance in the veterinary field, E. coli resistance was consistently the highest (Fahim et al. 2019). Furthermore, E. coli had also been regarded as a reliable indicator bacteria for tracking antibiotic resistance in domestic and wild animals. However, enteropathogenic (EPEC) and Shiga toxigenic E. coli (STEC) are categorised under diarrheagenic E. coli, and the intestinal microbiota of wild birds could include both serovars with their multi-drug resistance attributes (Borges et al. 2017). Moreover, the precise genetic bacterial profile enables more knowledge for the most disseminating genotypes to distinguish its potential links to virulence factors that could infect many animals and free-living birds (Skarżyńska et al. 2021).

As wildlife could play the main role in the microbial spreading in cattle farms, the mechanisms of this bacterial spreading among species in the farm environment are poorly understood (Tormoehlen et al. 2019). The current investigation was conducted to estimate the likelihood of E. coli infections transfer by wild birds that were frequently in contact with cattle and identifying the interrelationship between both species in farms in Egypt. Also, to study the most virulence and antibiotic resistance traits of the E. coli spp. isolates with a special regard to partial-genome resistance of fimH gene.

Research methods and design

Sampling

A total of 240 rectal and cloacal swab samples were collected from cattle species (n = 60 apparently healthy, n = 60 diarrhoeic cattle) and 120 from different resident wild birds from Ismailia Governorate, Egypt. Cows and buffaloes were included in this study of native breeds. Resident free-living wild birds (Hooded crow [n = 21], cattle egret [n = 18], spur-winged plover [n = 24], pied kingfisher [n = 21], green bee-eater [n = 24] and stone curlew [n = 12]) were captured with nets nearby these cattle farms and released after swabbing. Animals were housed in open yards surrounded by a fence, partially covered with sheds and muddy floors. All cattle rectal and bird cloacal swabs were collected aseptically and transferred immediately under hygienic measures to the laboratories of the Animal Health Research Institute (AHRI) Ismailia branch in ice thermal boxes for bacteriological examination, serological and polymerase chain reaction (PCR) identification.

Bacterial cultivation and identification

All cattle rectal and bird cloacal swabs were enriched overnight onto buffered peptone broth and then incubated at 37 °C under aerobic conditions. Subsequently, the cultures were isolated (on MacConkey, EMB and sheep blood agar plates) and identified using conventional techniques (Quinn et al. 2002). Furthermore, the pathogenicity of each one of E. coli recovered isolates was evaluated separately onto Congo red agar plate medium then they were kept overnight at 37 °C. The cultures were kept at room temperature for 48 h (Singh et al. 2014). After 48 h at room temperature, Congo red-positive pathogenic E. coli isolates appeared with a brick red colour while non-pathogenic ones were colourless (Saha et al. 2020).

Serological identification

The recovered E. coli isolates were serotyped based on their ‘O’ antigen according to the manual of the Reference Lab for Veterinary Quality Control on Poultry Production, Animal Health Research Institute, Dokki, Egypt. The identified isolates were preserved in tryptone broth 1% with adding glycerol to a final concentration of 15%. The tubes were kept at −20 °C for further analysis.

Antimicrobial susceptibility testing

The purified E. coli isolates were characterised for antibiotic susceptibility on Mueller–Hinton agar plates by the disc diffusion method using 11 different antibiotic discs (tetracycline, chloramphenicol, amoxiclavulinic acid, penicillin, piperacillin, streptomycin, fosfomycin, gentamycin, danofloxacin ciprofloxacin and cefepime), which were selected according to the panel of antibiotics of interest to the dairy industry and public health in our country. The results were interpreted using the standard guidelines of the Clinical and Laboratory Standards Institute (CLSI 2020).

Polymerase chain reaction screening of virulence and resistant traits of Escherichia coli spp.

Following the manufacturer’s instructions of QIAamp DNA Mini Kit (QIAGEN, Germany), the genomic deoxyribonucleic acid (DNA) of E. coli bacterial isolates was extracted. The PCR was performed using thermal profiles and oligonucleotides primers (Table 1) and a 25 μL reaction volume containing; 12.5 μL Master Mix (EmeraldAmp Max PCR, Takara, Japan), 1 μL (20 pmol) from each forward and reverse primer (Metabion, Germany), 5.5 μL Dnase free water and 5 μL DNA template. The amplified genes fragments were visualised in ethidium bromide-stained agarose gel 1.5% against 100 base pair (bp) DNA ladder (GeneDirex, Taiwan) in 1× Tris-borate EDTA (TBE) buffer at 100 voltage (V) per 30 min and then recorded using the SynGene Gel Documentation System. All reactions included a negative (non-template) and positive control of reference E. coli strains supplied by AHRI, Dokki, Giza, Egypt.

TABLE 1.

Primer sequences and amplicon sizes of target genes.

Target gene The function of the target gene Primers sequences (5′-3′) Amplicon size bp References
fimH Fimbriae binding virulence gene TGCAGAACGGATAAGCCGTGG 508 Ghanbarpour & Salehi 2010
GCAGTCACCTGCCCTCCGGTA
Stx1 Shiga toxin 1 virulence gene ACACTGGATGATCTCAGTGG 614 Dipineto et al. 2006
CTGAATCCCCCTCCATTATG
Stx2 Shiga toxin 2 virulence gene CCATGACAACGGACAGCAGTT 779 Dipineto et al. 2006
CCTGTCAACTGAGCAGCACTTTG
eaeA Intimate attachment virulence gene ATGCTTAGTGCTGGTTTAGG 248 Bisi-Johnson et al. 2011
GCCTTCATCATTTCGCTTTC
hly Haemolysin virulence gene AACAAGGATAAGCACTGTTCTGGCT 1177 Piva et al. 2003
ACCATATAAGCGGTCATTCCCGTCA
ompA Outer membrane protein A virulence gene AGCTATCGCGATTGCAGTG 919 Ewers et al. 2007
GGTGTTGCCAGTAACCGG
tetA Tetracycline resistant gene CCTTATCATGCCAGTCTTGC 576 Sabarinath et al. 2011
ACTGCCGTTTTTTCGCC
blaCTX-M β-lactam resistant gene ATGTGCAGYACCAGTAARGTKATGGC 593 Archambault et al. 2006
TGGGTRAARTARGTSACCAGAAYCAGCGG

Source: Please see the full reference list of the article for more information

bp, base pair.

Gene sequencing of fimH gene

Two retrieved E. coli isolates one from diarrhoeic cattle and the other from Hooded crow were selected for genotyping of the fimH gene. QIAquick® Gel Extraction Kit (QIAGEN, Germany) was used to purify the PCR products. The sequence reactions were performed using the BigDyeTM Terminator version 3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, United States [US]) and then were analysed using the 3130 Genetic Analyzer (Applied Biosystems™, US). The obtained sequences were trimmed, consensus generated and analysed using the Uniport Ugene software version 43.0 (Okonechnikov et al. 2012). Sequences were investigated using the National Center for Biotechnology Information (NCBI) online basic local alignment tool (BLAST at https://blast.ncbi.nlm.nih.gov/Blast.cgi). For phylogenetic analysis, fimH gene sequences from different sources and origins including Egypt were selected and retrieved from the GenBank in FATSA format. Sequence alignments (MSA) were performed using MUSCLE algorism with the same software Multiple (Okonechnikov et al. 2012). IQ-TREE was used to construct the phylogenetic tree (Nguyen et al. 2014) using the maximum likelihood method, best model finder and 1000 bootstrap replicates for both nucleotide and protein sequences. The constructed trees were annotated using the Interactive tree of life (iTOL) (Letunic & Bork 2021).

Results

Phenotypic characterisation of the recovered Escherichia coli isolates in cattle and wild birds

The suspected E. coli colonies revealed a pink colouration on MacConkey agar medium, metallic green sheen on EMB and some (enterohaemorrhagic) strains gave haemolysis on blood agar. Microscopically, the isolates appear as Gram-negative rod-shaped motile bacilli. Also, their pathogenicity was confirmed on Congo red medium (gave positive orange or bright red colonies). Biochemically, they all were identified and confirmed as E. coli spp.

The isolation rate of Escherichia coli in cattle and wild birds

Bacterial examination of 120 rectal swabs of both apparently healthy and diarrhoeic cattle revealed that E. coli was recovered from 55 of 120 (45.8%) animals. It was detected in 17 of 60 (28.3%) apparently healthy animals; however, it was isolated from 38 of 60 (63.3%) diarrhoeic animals. Moreover, in wild birds, 39 (32.5%) were positive for E. coli, of which 18 of 21 (85.7%) were isolated from the hooded crow, 10 of 18 (55.6%) from cattle egret, pied kingfisher 3 of 24 (12.5%), spur-winged plover 3 of 21 (14.3%) and 5 of 12 (41.7%) from stone curlew (Table 2).

TABLE 2.

The prevalence of different Escherichia coli serotypes in cattle and wild birds.

Species Source of samples Number of positive E. coli
Serotypes of E. coli isolates
N n % O26 O114 O128 O125 O78 O111 O55 O44
Cattle Apparently healthy 60 17 28.3 2 4 2 3 1 3 2 -
Diarrhoeic cattle 60 38 63.3 12 8 6 4 3 - 3 2
Total cattle 120 55 45.8 14 12 8 7 4 3 5 2
Wild bird Hooded crow 21 18 85.7 3 4 1 5 1 2 2 -
Cattle egret 18 10 55.6 3 2 - 1 1 3 - -
Pied kingfisher 24 3 12.5 1 1 - - 1 - - -
Spur-winged plover 21 3 14.3 - 1 - 1 - 1 - -
Stone curlew 12 5 41.7 - - - 3 - 2 - -
Green bee-eater 24 0 0.0 - - - - - - - -
Total wild bird 120 39 32.5 7 8 1 10 3 8 2 0

Total isolates 240 94 - 21 § 20 § 9 § 17 § 7 § 11 § 7 § 2 §

, Number out of 55;

, Numer out of 39;

§

, Number out of 94.

Serological identification of recovered isolates

Serological identification revealed different serotypes, according to O-antigen in which the most predominant serotype was O26 (n = 21/94, 22.4%), followed by O114 (n = 20/94, 21.3%), O128 (n = 9/94, 9.6%), O125 (n = 17/94, 18.1%), O111 (n = 11/94, 11.7%), O78 (n = 7/94, 7.4%), O55 (n = 7/94, 7.4%) and O44 (n = 2/94, 2.1%). Enterohaemorrhagic (EHEC) E. coli serovars were screened in this study in 38 of 94 (40.4%), 16 of 94 (17%) were enterotoxigenic (ETEC), 29 of 94 (30.9%) were EPEC and 11 of 94 (11.7%) were enteroaggregative (EAEC) as shown in Table 2.

Antibiotic resistance pattern

Most examined E. coli isolates demonstrated high multidrug resistance levels against tetracycline and chloramphenicol (95.7% and 93.6%), respectively, followed by piperacillin, penicillin and streptomycin (90.4%, 88.3% and 88%), respectively. A moderate resistance level was recorded against both fosfomycin (54.3%) and amoxiclav (47.9%). Meanwhile, gentamycin, cefepime, ciprofloxacin and danofloxacin recorded the lowest resistance rates (9.6% and 10.6%, 12.8% and 26.6%), respectively, as shown in Table 3.

TABLE 3.

Phenotypic characterisation of antibiotic resistance profile of Escherichia coli isolates.

Chemotherapeutic group Chemotherapeutic agents/disc Potency μg/disc No. of resistant strains
N n %
Aminoglycoside Gentamycin (CN) (10 μg) 94 9 9.6
Streptomycin (S) (10 μg) 94 78 83.0
Cephalosporins 4th generation Cefepime (FEP) (30 μg) 94 10 10.6
Fluoroquinolones Ciprofloxacin (CIP) (5 μg) 94 12 12.8
Danofloxacin (DAN) (5 μg) 94 25 26.6
Other Fosfomycin (FF) (50 μg) 94 51 54.3
Penicillins β-lactamase inhibitors Piperacillin (PRL) (100 μg) 94 83 88.3
Penicillin (P) (10 μg) 94 85 90.4
Amoxiclav (AMC) (30 μg) 94 45 47.9
Chloramphenicol Chloramphenicol (C) (30 μg) 94 88 93.6
Tetracycline Tetracycline (T) (30 μg) 94 90 95.7

Polymerase chain reaction investigations of virulence and resistant attributes of the recovered isolates

Polymerase chain reaction screening of the virulence genes of most 10 multi-drug resistant (MDR) E. coli isolates (Figure 1a–f) revealed that fimH and ompA genes were detected in all isolates 10 of 10 (100%) (Figure 1a and b), while the eaeA gene was detected in 1 of 10 (10%) only of total isolates (Figure 1c), Stx1 gene was demonstrated in 6 of 10 (60%) of MDR isolates (Figure 1d), PCR failed to detect hly and Stx2 genes in the examined E. coli isolates. The presence of tetA and blaCTX-M genes of tetracycline and penicillin β-lactamase inhibitors resistance was confirmed in all 10 of 10 (100%) of MDR tested E. coli isolates (Figure 1e and f) as data shown in Table 4.

FIGURE 1.

FIGURE 1

The electrophoretic gel pattern of MDR genes from E. coli isolates: (a): lane 1–10 positive for fimH at 508 bp, (b): lane 1–10 positive for ompA at 919 bp, (c): lane 1 positive for eaeA at 248 bp, (d): lane 1, 2, 3, 4, 5, 6, 7 positive for Stx1 at 614 bp, (e): lane 1–10 positive for tetA at 576 bp, (f): lane 1–10 positive for blaCTX-M at 593 bp.

TABLE 4.

Polymerase chain reaction amplification results of different virulence and resistant genes of isolates.

Isolates no. Source of isolates Serotype Antimicrobial susceptibility Virulence genes
Resistant genes
fimH ompA eaeA Stx1 Stx2 hly tetA blaCTX-M
1 Hooded crow O125
EHEC
CN,FEP,C,T,AMC,FF,PRL,S,CIP,DAN,P + + + + - - + +
2 Cattle egret O111
EHEC
CN,FEP,C,T,AMC,FF,PRL,S,CIP,DAN,P + + - + - - + +
3 Stone curlew O125
EHEC
CN,FEP,C,T,AMC,FF,PRL,S,CIP,DAN,P + + - - - - + +
4 Pied kingfisher O26
STEC
CN,FEP,C,T,AMC,FF,PRL,S,CIP,DAN,P + + - + - - + +
5 Spur-winged plover O114
STEC
CN,FEP,C,T,AMC,FF,PRL,S,CIP,DAN,P + + - + - - + +
6 Cattle O128
STEC
CN,FEP,C,T,AMC,FF,PRL,S,CIP,DAN,P + + - + - - + +
7 Cattle O78
STEC
CN,FEP,C,T,AMC,FF,PRL,S,CIP,DAN,P + + - + - - + +
8 Cattle O55
EHEC
CN,FEP,C,T,AMC,FF,PRL,S,CIP,DAN,P + + - - - - + +
9 Cattle O44
EHEC
CN,FEP,C,T,AMC,FF,PRL,S,CIP,DAN,P + + - - - - + +
10 Cattle O26
EHEC
CN,FEP,C,T,AMC,FF,PRL,S,CIP,DAN,P + + - - - - + +

Total (%) 100.0 100.0 10.0 60.0 0.0 0.0 100.0 100.0

STEC, Shiga toxigenic Escherichia coli.

Phylogenetic analysis of fimH virulence gene

The fimH was detected in all examined isolates with the conventional PCR technique. fimH gene sequences from two selected wild birds (hooded crow) and cattle isolates were examined and then documented in the Gene Bank database and assigned the accession numbers (ON239271 and ON239272), respectively. The phylogenetic analysis of the fimH gene selected from two isolates revealed 99% nucleotides identity between their sequences (cattle and wild bird isolates, Figure 2). Only three single nucleotides polymorphism (SNP) in cattle isolates were shown at positions 192.291,348, but these SNPs did not show any effect at amino acid (a.a) level because they were identical (100% identity, Figure 3). Both cattle and wild bird isolates showed 100% homology with most sequences retrieved from the GenBank from Egypt and geographical locations also from different isolation sources including different animal species, food and environmental source (Table 5). These translated a.a phylogeny results confirmed the high conservation level of the sequenced fimH gene for both retrieved Egyptian E. coli isolates and globally (Figure 4).

FIGURE 2.

FIGURE 2

The maximum likelihood (ML) phylogenetic tree for partially nucleotide sequenced FimH gene of E. coli isolated from wild bird and cattle. The tree was constructed in IQ-TREE with Model Finders. The accession number and a brief GenBank ID are assigned to each retrieved sequence from different l isolation sources and origins. The two isolates are highlighted in red with a green background, various clades are designated with different colours, and the numbers above the branches are the branch length. The bootstrap values were computed from 1000 bootstrap repeats and branch length as visualised by iTOL. The tree’s roots are in the middle.

FIGURE 3.

FIGURE 3

The MSA for partial nucleotide fimH gene fragment of the identified Escherichia coli isolates compared with other isolates and strains retrieved from the Gene Bank visualised by UGEN programme. The dot (.) represents identity, while a single alphabet highlights the differences among aligned sequences.

TABLE 5.

Source modifier tabulates for fimH gene isolates and strains sequences retrieved from GenBank for alignment, phylogenetic analysis, and tree construction for isolates from wilds birds and cattle in Egypt.

Country (location) Sequence identification GenBank accession number Collection date Host and sources
Egypt E. coli-WILD, BIRD-ISMALIA-F1-fimH-2022 ON239271 2022 Wild bird (Hooded crow)
Egypt E. coli-CATTLE-ISMALIA-F2-fimH-2022 ON239272 2022 Cattle (diarrhoea)
Egypt Strain CFSAN061769 chromosome, complete genome CP042969.1 2016 Raw milk cheese
Egypt strain CFSAN061762 chromosome, complete genome CP042901.1 2016 Raw milk cheese
Egypt strain GH_12 fimH (fimH) gene, partial CDs ON032639.1 2018 Cow (faeces)
Egypt strain E2 chromosome, complete genome CP048915.1 2015 Homo sapiens (Ascitic fluid)
Egypt strain CFSAN061768 chromosome, complete genome CP042973.1 2016 Raw milk cheese
Egypt strain GH_13 fimH (fimH) gene, partial CDs ON032640.1 2018 Cow (faeces)
China TMUSHC1839 fimH (fimH) gene JN408573 2011 Homo sapiens
The Gambia strain GF3-3 chromosome, complete genome CP053259.1 2016 Guinea fowl
Iran O55:H7 strain DEC5E chromosome, complete genome CP038383.1 1963 Homo sapiens
Hong Kong strain ISHS7 chromosome, complete genome CP092252.1 2020 Felix cat (faeces)
Belgium isolate APEC 17 fimH (fimH) gene, complete cds AF490853.1 2003 Avian
Vietnam 2017.15.01CC DNA, complete genome AP021890.1 2017 Homo sapiens
Japan strain KFu024 chromosome, complete genome CP091659.1 2022 River water
Austria strain 9m fimH (fimH) gene, partial cds GQ303226.1 2016 Meat
China strain CP61_Sichuan chromosome, complete genome CP053730.1 2016 Pig (slaughterhouse)
China strain TMUSHC1839 fimH (fimH) gene, partial cds JN408573.1 2011 Homo sapiens
India strain 97/K fimH adhesin (fimH) gene MN340234.1 2019 Bubalus bubalis (milk)
India strain NZ/3/G-10/12 fimH adhesin (fimH) gene MN340235.1 2018 Bos indicus (metritis)
United States O145:H28 str. RM13514, complete genome CP006027.1 2014 Homo sapiens (faeces)
Japan O145:H28 122715 DNA, complete genome AP019708.1 2012 Homo sapiens (faeces)
China O157:H7 str. EC10 chromosome CP060946.1 2016 Homo sapiens (urine)
United Kingdom O157:H7 strain Z1767 chromosome CP062733.1 2015 Bovine (faeces)
Belgium strain EH485 adhesin (fimH) gene DQ465493.1 2007 Bovine (faeces)
Denmark O157:H7 strain DEC4E chromosome CP038398.1 1988 Homo sapiens
United States O157:H7 strain 2571 chromosome CP038425.1 2020 Bovine
United States strain TB2755 type 1 fimbrial adhesin (fimH) gene FJ865717.1 2016 Homo sapiens
Iraq strain ECO/irq.Hill12 fimH protein (fimH) gene, partial cds MK732912.1 2018 Homo sapiens (wound)
Iran fimbrial adhesin protein (fimH) gene KY848625.1 2018 Broiler chicken (faeces)
Iraq strain E17-R D-mannose binding protein (fimH) gene MK825753.1 2017 Homo sapiens (urine)
United States O157:H7 strain 2571 chromosome, complete genome CP038425.1 2020 Bovine
Finland Escherichia coli fimH (fimH) gene AF089840 2020 Homo sapiens (meningitis)
Belgium isolate APEC 15 fimH (fimH) gene AF490851.1 2003 Avian
Austria strain 90mb fimH (fimH) gene GQ303239.1 2016 Meat
Austria strain 76s fimH (fimH) gene GQ303206.1 2016 Meat
China strain TMUSHB3626 fimH (fimH) gene JN408559.1 2011 Homo sapiens
Belgium O145:H28 str. RM12761, CP007133.1 2014 Ice cream
Belgium clone B1290 fimH (fimH) gene AY392522.1 2004 Bovine clinical case
United States strain BSD2780120874b_170522_F6 NODE_38_length_41060_cov_32.1749 NZ_JADMUR010000038.1 2017 Homo sapiens (stool)
China strain 18FS24-1 NODE_16_length_111283_cov_38.446139 NZ_JADDNH010000016.1 2016 Waterfowl
Singapore strain 2EC2 contig_2, whole genome shotgun sequence NZ_JAFHAN010000002.1. 2019 Homo sapiens (faeces)
United States strain KCJ2K2235 NODE_5_length_345482_cov_18.390569 NZ_JAHMTJ010000005.1. 2019 Cow
China strain w183 NODE_50_length_27035_cov_162.619 NZ_JAJNDO010000050.1. 2019 Chicken
Pakistan strain EC_43 NODE_4_length_262439_cov_19.018654 NZ_SHIQ01000004.1 2016 Gallus domesticus
Canada strain WW223 NODE_62_length_30559_cov_31.906 NZ_NNAO01000062.1 2011 Wastewater
United States strain KCJ2K2539 NODE_15_length_112297_cov_10.368824 NZ_JAHMSX010000015.1 2019 Farm soil
Tanzania strain 10432wG5 NODE_3_length_591091_cov_50.1463 NZ_WTNF01000003.1 2018 Cattle faeces
Tanzania strain 10432wG5 NODE_3_length_591091_cov_50.1463 NZ_WHZM01000107.1 2018 Chicken meat
Czech strain ET33 contig016_Escherichia_coli NZ_QYZK01000016.1 2014 Bos taurus
China strain STEC814 Contig_71_174.05, NZ_JAKGAB010000071. 2018 Mutton
United States O15:H12 strain 2273-PO3 chromosome NZ_CP061749.1 2025 Ovis aries
United States strain MOD1-ECOR27 ECOR27_13_length_156310_cov_130.462 NZ_QOXM01000013.1 2015 Giraffe
Japan KS-P089 DNA, sequence59 NZ_BGBR01000059.1 2013 Bos taurus
Norway strain 2-346 NODE_12_length_116060_cov_25.614484 NZ_JADZJD010000012.1 2020 Sewage

STEC, Shiga toxigenic E. coli; DNA, deoxyribonucleic acid.

FIGURE 4.

FIGURE 4

Rooted maximum likelihood phylogenetic tree for a translated protein of fimH gene Escherichia coli sequences obtained from wild bird and cattle isolates. The branch colour represents the homology between protein sequences. Rings from inner to outer: the first ring (origin) represents the geographical location of selected isolates, the second ring (source) is for the sample source of isolates, the branch length, and bootstrap values computed from 1000 bootstrap repeats are also visualised.

Discussion

Many studies implicated the crucial role of wild birds in the pathogenesis of E. coli spp. in livestock animals (Fadel, Afifi & Al-Qabili 2017; Fahim et al. 2019). However, its pathogenesis in these birds was still unclear. Diarrhoeagenic strains of E. coli were isolated from different wild bird species including migratory and non-migratory (Ahmed et al. 2019), Passeriformes, Columbiformes and Pelecaniformes (Sanches et al. 2017). Escherichia coli also was isolated from birds of prey, waterfowls and passerines. Farm animals could infect wild birds or vice versa (Fadel et al. 2017). They infiltrated animal enclosures in search of water and food hence infecting them with different pathogens or even acquiring the infection from these animals. Moreover, the feeding practice of cattle in open yards could result in the accumulation of their manure and so the attraction of these wild birds to those farms (Medhanie et al. 2015).

The present article stated that E. coli was detected higher (45.8%) from all examined apparently healthy and diarrhoeic cattle than from different wild birds (32.5%). For apparently healthy cattle, it was detected in 17 of 60 (28.3%); however, it was isolated from 38 of 60 (63.3%) of diarrhoeic animals. However, from different wild bird species, 18 of 21 isolates were obtained from the hooded crow (85.7%), 9 of 18 (50%) cattle egret, pied kingfisher (n = 3/24, 12.5%), spur-winged plover (n = 3/21, 14.3%), 6 of 12 (50%) from stone curlew.

In the same way, recent studies discussed the propagation rate of E. coli in wild birds, cattle and their environment in which it was found in a range of 17% – 47% in the faeces samples of wild birds (house sparrows, red-winged blackbirds, European starling and brown-headed cowbirds) despite its percentage was recorded higher in cattle farms (Tormoehlen et al. 2019). Also, 478 positive E. coli samples of migratory birds were reported in China from a total of 1387 (34.7%) faecal, cloacal and throat samples (Yuan et al. 2021). Ahmed et al. (2019) isolated E. coli from 60% and 45% of examined hooded crows and cattle egrets in Egypt, respectively. However, a higher rate of E. coli was recovered from the faeces of wild birds (70%) than migratory waterfowls (33.3%) (Fahim et al. 2019). From a different point of view, a large number of E. coli were isolated from egret wild birds than from cattle in the same study (Fashae et al. 2021) This variation in the isolation rate in different studies might be because of either insensitivity testing method or other anonymous agents (Ballem et al. 2021).

Moreover, E. coli isolates were recorded also in the United States (21% of beef cattle and 13% of dairy cattle) (Venegas-Vargas et al. 2016). Also, 112 of 409 positive E. coli isolates were retrieved from cattle in Portugal with a prevalence of 27.4%, and 133 STEC isolates were identified (Ballem et al. 2021). In addition, 106 and 29 E. coli isolates were yielded from 77 diarrheic and in-contact calves (Awad et al. 2020).

From a serological view, the most predominant type of E. coli in this study was O26 (n = 26/94), followed by O114, O128, O125, O111, O78, O55 and O44 (Table 2). Corresponding results were reported by (Mahmoud et al. 2015; Navarro-Gonzalez et al. 2020) in which different subtypes of E. coli O26, O55, O111, O124, O119, O114, O26, O44 and O163 were recorded.

Antibiotic-resistant bacteria could pose a rising hazard to global public health and accompanied environmental contamination problems (WHO 2017). The Regulation (EC) no. 1831/2003 of the European Parliament and of the council of 22 September 2003 on additives for use in animal nutrition banned the use of growth-promoting antimicrobials in animal production. As a result of the diversity in ecological niches, the migratory birds act as reservoirs and transporters of antibiotic-resistant bacteria and consequently play a significant epidemiological role in the dissemination of antibiotic-resistant genes (ARGs) (Cao et al. 2020). These birds could carry ARGs during migration leading to the dissemination of MDR bacteria and ARGs through the environment (Yuan et al. 2021).

The presented information in this study displayed MDR phenomena of the yielded isolates because they showed high antimicrobial resistances against tetracycline and chloramphenicol with prevalence rates of 95.7% and 93.6%, respectively, followed by piperacillin, penicillin and streptomycin (90.4%, 88.3% and 88%), respectively. Meanwhile, gentamycin, cefepime, ciprofloxacin and danofloxacin were highly sensitive where the lowest resistance was recorded (9.6% and 10.6%, 12.8% and 26.6%), respectively, as shown in Table 3. These results might be of good importance in management routines for cattle farms to control the spread of antimicrobial resistance.

Similar to this, the wild bird E. coli isolates exhibited bacterial resistance in many studies in the last years. Escherichia coli isolates showed great resistance to penicillin G, piperacillin, tetracycline, cotrimoxazole, ampicillin and nitrofurantoin (Shinde et al. 2020). Also, 376 recovered E. coli isolates from Hooded and White-naped cranes in Japan were found resistant to oxytetracycline, ampicillin and nalidixic acid antibiotics. A high resistance level was also recorded against tetracycline followed by sulfamethoxazole, ampicillin, trimethoprim and ciprofloxacin in most E. coli isolates (Suenaga et al. 2019). Furthermore, 87 of 88 egret’s and 53 of 55 cattle E. coli isolates were found to have MDR against more than one antimicrobial. Tetracycline resistance was highest in E. coli isolates from egret birds (n = 85/87), further followed by streptomycin (n = 69/87) and ciprofloxacin resistance (n = 38/87).

For cattle E. coli isolates multiple authors reported MDR patterns of E. coli isolates (Iweriebor et al. 2015, Mahmoud et al. 2020). The MDR phenomena are of great concern because the resistant strain could be transmitted to humans by consumption of either milk or food carrying antibiotic-resistant bacteria, which could lead to the acquisition of antibiotic-resistant infections (Geletu, Usmael & Ibrahim 2022), and also could be transmitted to accompanying animals and their offspring (Roca-Saavedra et al. 2018). It was previously documented that resistant strains selected during an antimicrobial treatment last for a long time in the intestinal tract when this treatment ceases. In addition, these resistant strains could modify animal health.

The results in this study were consistent with Geletu et al. (2022) who revealed that tetracycline (80%) was the drug that most E. coli isolates from dairy cattle were extremely resistant to, followed by ceftriaxone and vancomycin (83%). However, gentamycin (90%) and nitrofurantoin (70%) were the most sensitive drugs, respectively. Additionally, tetracycline resistance (n = 47/53) was the most often seen phenotype in cow cefotaxime-resistant E. coli, followed by streptomycin (n = 46/53) and ciprofloxacin (n = 17/53) resistance (Fashae et al. 2021). Moreover, Mahmoud et al. (2015) recorded the E. coli. resistance against oxytetracycline and ampicillin in cattle samples. Moreover, the most responsive medications, nevertheless, were ceftiofur (40%) and lincospectine (56.6%), followed by danofloxacin (56.6%), enrofloxacin (40%) and danofloxacine (56.6%). Furthermore, sulfamethoxazole, ampicillin, trimethoprim and ciprofloxacin were the antibiotics with the highest rates of resistance in E. coli isolates, followed by tetracycline (Hang et al. 2019). In the present study, the highest resistance levels of E. coli isolates might be because of the non-judicious use of antibiotics on a cattle farm. Also, this high antimicrobial resistance of E. coli isolates in cattle might confer a selective advantage towards intestinal colonisation, which might itself increase the faecal shedding of antimicrobial-resistant E. coli (Harkins, McAllister & Reynolds 2020).

Studying the genotypic virulence attributes of the isolated bacterial species was applied by conventional PCR technique. Our results indicated that the fimH gene, one of the virulence genes involved in bacterial adhesion, was found to be present in 10 of 10 (100%) of the tested E. coli. Also, identical findings were recorded by Nüesch-Inderbinen (et al. 2018) who discovered that the fimH gene was present in all (100%) of their isolates. In the present study, eaeA (attaching and effacing virulence factor) was detected in 1 of 10 (10%) of tested E. coli isolates, despite this finding complied with a study by Sanches et al. (2017) in which eaeA gene was found in a rate of 5.74%. Moreover, Mohamed and Sayed (2017) implied that eaeA gene was exhibited in 43.75% of yielded E. coli isolates. These results disagreed with the finding by Nüesch-Inderbinen et al. (2018) who recorded that eaeA gene was not present in any of the studied E. coli isolates.

Depending on the retrieved data in this study, PCR confirmed the positivity of the ompA gene (outer membrane protein A) virulence gene in 10 of 10 (100%) of E. coli isolates. The frequency of detected ompA gene in our study was much higher than another study in which this gene was detected in (82%) of E. coli isolates (Ammar et al. 2015).

While the presence of virulence factors such as Shiga toxin (Stx1 and Stx2) and α-haemolysin (hly) of E. coli is pivotal for suggesting the increased pathogenicity of these strains, serogroups are still crucial for identifying potential diseases. In this study, the prevalence of Stx1 virulence gene was 6 of 10 (60%), while (Stx2 and hly) genes failed to be detected. In accordance with the recorded result, Nasef, El Oksh and Ibrahim (2017) detected Stx1, Stx2 and hly (45%, 65% and 80%), respectively.

Studying the antimicrobial genotypic attributes of the isolates was applied by PCR to investigate the presence of tetracycline and penicillin β-lactams resistance gene (tetA and blaCTX-M), the results indicated positive detection in all 10 of 10 (100% for each) of the tested E. coli. Similar outcomes were reported by (Fashae et al. 2021) who detected the blaCTX-M gene in 83.3% of MDR E. coli isolates. Furthermore, according to Gholami-Ahangaran et al. (2021), all E. coli isolates from faecal samples of pet birds included the tetA gene.

The phylogenetic analysis of the fimH gene of two selected E. coli isolates from both resident free-living wild birds and cattle, which was in contact, demonstrated a high conservation level of the gene at (a.a) level as previously proved by Vandemaele, Hensen and Goddeeris (2004). The homology was 100% with gene sequence from different resources including avian, cattle, birds, pig and from food sources such as milk and ice cream and also from environmental sources such as water, sewage and farm soil prove the potential role of wild birds as a reservoir for E. coli having MDR genes. This was concordant with results mentioned by Nabil et al. (2020). However, the detected SNPs between both examined samples represented no change at protein level proves the common source nature of pathogens suggesting the possible role of wild birds to contaminate water sources and disseminating the infection to cattle farms (Fahim et al. 2019). Also, our findings could highlight the public health concern of presence of wild birds carrying E. coli with MDR genes in contact with dairy cattle farms and its surrounding environment that could transmit infection to human through the food chain.

Conclusion

This study reported updated data about the critical infectious role of faecal matter of wild birds to cattle farm. Highly virulent and resistant pathogenic serovar of E. coli could be disseminated towards different animal species triggering several diseases, threatening their health and impairing the animal farm economy. Hence, strict recommendations for animal manure with good hygienic practices in cattle farms should be implicated. Also, one health approach should be implicated to inherit the dispersion of multiple antimicrobial resistance phenomena. Furthermore, more advanced sequencing approaches should be studied on the whole genome level for such bacteria to indicate the interrelationship of virulent and resistant genes in different animal, human and wild bird species.

Acknowledgements

The authors would like to thank Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia, for funding and financial support. The authors also thank Prof. Dr. Abdelazeem Algammal, Professor of Microbiology, Faculty of Veterinary Medicine, Suez Canal University, for his help in reviewing and editing this work.

Competing interests

The authors declare that they have no financial or personal relationships that may have inappropriately influenced them in writing this article.

Authors’ contributions

G.A.I. conducted the laboratory investigations, writing of the original draft and editing. A.M.S.-E. assisted with the article methodology, sample collection and reviewing. M.A.-z. assisted with the conceptualisation, supervision, review and editing. A.S.E.O. conducted laboratory investigations and writing of the original draft. E.M.A. conducted gene sequencing analysis, writing and editing the original draft. D.S.F. assisted with methodology, data interpretation and editing of the original draft. E.M.S. assisted with the conceptualisation, sample collection and editing of the original draft. All authors read and approved the final manuscript.

Ethical considerations

No experimental animals were used in this study. All the procedures of the study were adapted according to the ethical and humane principles of the Ethics and Animal Experimentation Committee of Suez Canal University (approval no. 2022007). All the diagnostic methods and laboratory work were conducted according to isolation, biosafety, and quality standards of AHRI, Agricultural Research Council, Dokki, Giza, Egypt.

Data availability

The authors confirm that the data supporting the findings of this study are available within the article.

Disclaimer

The opinions expressed in this article are those of the authors and do not necessarily reflect the official policy of any affiliated institution of the authors and the publisher.

Footnotes

How to cite this article: Ibrahim, G.A., Salah-Eldein, A.M., Al-zaban, M.I., El-Oksh, A.S., Ahmed, E.M., Farid, D.S. et al., 2023, ‘Monitoring the genetic variation of some Escherichia coli strains in wild birds and cattle’, Onderstepoort Journal of Veterinary Research 90(1), a2085. https://doi.org/10.4102/ojvr.v90i1.2085

References

  1. Ahmed, Z.S., Elshafiee, E.A., Khalefa, H.S., Kadry, M. & Hamza, D.A., 2019, ‘Evidence of colistin resistance genes (mcr-1 and mcr-2) in wild birds and its public health implication in Egypt’, Antimicrobial Resistance & Infection Control 8, 1–8. 10.1186/s13756-019-0657-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ammar, A.M., El-Hamid, M.I.A., Eid, S.E.A. & El-Oksh, A.S., 2015, ‘Insights into antimicrobial resistance and virulence genes of emergent multidrug resistant avian pathogenic Escherichia coli in Egypt: How closely related are they?’, Revue de Médecine Vétérinaire 166, 304–314, viewed n.d., from http://www.revmedvet.com/2015/RMV166. [Google Scholar]
  3. Archambault, M., Petrov, P., Hendriksen, R.S., Asseva, G., Bangtrakulnonth, A., Hasman, H. et al. 2006, ‘Molecular characterization and occurrence of extended-spectrum β-lactamase resistance genes among Salmonella enterica serovar Corvallis from Thailand, Bulgaria, and Denmark’, Microbial Drug Resistance 12(3), 192–198. 10.1089/mdr.2006.12.192 [DOI] [PubMed] [Google Scholar]
  4. Arnold, K.E., Williams, N.J., Bennett, M. & Bennett, M., 2016, ‘“Disperse abroad in the land’: The role of wildlife in the dissemination of antimicrobial resistance’, Biology Letters 12(8), 20160137. 10.1098/rsbl.2016.0137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Awad, W.S., El-Sayed, A.A., Mohammed, F.F., Bakry, N.M., Abdou, N.-E.M.I. & Kamel, M.S., 2020, ‘Molecular characterization of pathogenic Escherichia coli isolated from diarrheic and in-contact cattle and buffalo calves’, Tropical Animal Health and Production 52, 3173–3185. 10.1007/s11250-020-02343-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Ballem, A., Gonçalves, S., Garcia-Meniño, I., Flament-Simon, S.C., Blanco, J.E., Fernandes, C. et al., 2021, ‘Prevalence and serotypes of Shiga toxin-producing Escherichia coli (STEC) in dairy cattle from Northern Portugal’, PLoS One 15(12), e0244713. 10.1371/journal.pone.0244713 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bisi-Johnson, M.A., Obi, C.L., Vasaikar, S.D., Baba, K.A. & Hattori, T., 2011, ‘Molecular basis of virulence in clinical isolates of Escherichia coli and Salmonella species from a tertiary hospital in the Eastern Cape, South Africa’, Gut Pathogens 3, 9. 10.1186/1757-4749-3-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Borges, C.A., Cardozo, M.V., Beraldo, L.G., Oliveira, E.S., Maluta, R.P., Barboza, K.B. et al., 2017, ‘Wild birds and urban pigeons as reservoirs for diarrheagenic Escherichia coli with zoonotic potential’, Journal of Microbiology 55, 344–348. 10.1007/s12275-017-6523-3 [DOI] [PubMed] [Google Scholar]
  9. Cao, J., Hu, Y., Liu, F., Wang, Y., Bi, Y., Lv, N. et al., 2020, ‘Metagenomic analysis reveals the microbiome and resistome in migratory birds’, Microbiome 8, 26. 10.1186/s40168-019-0781-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. CLSI , 2020, Performance standards for antimicrobial susceptibility testing. CLSI supplement M100, pp. 106–112, Clinical and Laboratory Standards Institute. [Google Scholar]
  11. Dipineto, L., Santaniello, A., Fontanella, M., Lagos, K., Fioretti, A. & Menna, L., 2006, ‘Presence of Shiga toxin-producing Escherichia coli O157:H7 in living layer hens’, Letters in Applied Microbiology 43(1), 293–295. 10.1111/j.1472-765X.2006.01954.x [DOI] [PubMed] [Google Scholar]
  12. Ewers, C., Li, G., Wilking, H., Kieβling, S., Alt, K., Antáo, E.-M., Laturnus, C. et al., 2007, ‘Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: How closely related are they?’, International Journal of Medical Microbiology 297(3), 163–176. 10.1016/j.ijmm.2007.01.003 [DOI] [PubMed] [Google Scholar]
  13. Fadel, H.M., Afifi, R. & Al-Qabili, D.M., 2017, ‘Characterization and zoonotic impact of Shiga toxin producing Escherichia coli in some wild bird species’, Veterinary World 10, 1118. 10.14202/vetworld.2017.1118-1128 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fahim, K.M., Ismael, E., Khalefa, H.S., Farag, H.S. & Hamza, D.A., 2019, ‘Isolation and characterization of E. coli strains causing intramammary infections from dairy animals and wild birds’, International Journal of Veterinary Science and Medicine 7, 61–70. 10.1080/23144599.2019.1691378 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Fashae, K., Engelmann, I., Monecke, S., Braun, S.D. & Ehricht, R., 2021, ‘Molecular characterisation of extended-spectrum ß-lactamase producing Escherichia coli in wild birds and cattle, Ibadan, Nigeria’, BMC Veterinary Research 17, 1–12. 10.1186/s12917-020-02734-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Geletu, U.S., Usmael, M.A. & Ibrahim, A.M., 2022, ‘Isolation, identification, and susceptibility profile of E. coli, Salmonella, and S. aureus in dairy farm and their public health implication in Central Ethiopia’, Veterinary Medicine International 2022, 1887977. 10.1155/2022/1887977 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ghanbarpour, R. & Salehi, M., 2010, ‘Determination of adhesin encoding genes in Escherichia coli isolates from omphalitis of chicks’, American Journal of Animal and Veterinary Sciences 5, 91–96. 10.3844/ajavsp.2010.91.96 [DOI] [Google Scholar]
  18. Gholami-Ahangaran, M., Karimi-Dehkordi, M., Miranzadeh-Mahabadi, E. & Ahmadi-Dastgerdi, A., 2021, ‘The frequency of tetracycline resistance genes in Escherichia coli strains isolated from healthy and diarrheic pet birds’, Iranian Journal of Veterinary Research 22, 337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hang, B.P.T., Wredle, E., Börjesson, S., Sjaunja, K.S., Dicksved, J. & Duse, A., 2019, ‘High level of multidrug-resistant Escherichia coli in young dairy calves in southern Vietnam’, Tropical Animal Health and Production 51, 1405–1411. 10.1007/s11250-019-01820-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Harkins, V., McAllister, D. & Reynolds, B., 2020, ‘Shiga-toxin E. coli hemolytic uremic syndrome: Review of management and long-term outcome’, Current Pediatrics Reports 8, 16–25. 10.1007/s40124-020-00208-7 [DOI] [Google Scholar]
  21. Iweriebor, B.C., Iwu, C.J., Obi, L.C., Nwodo, U.U. & Okoh, A.I., 2015, ‘Multiple antibiotic resistances among Shiga toxin producing Escherichia coli O157 in feces of dairy cattle farms in Eastern Cape of South Africa’, BMC Microbiology 15, 1–9. 10.1186/s12866-015-0553-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Letunic, I. & Bork, P., 2021, ‘Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation’, Nucleic Acids Research 49(W1), W293–W296. 10.1093/nar/gkab301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mahmoud, A., Mittal, D., Filia, G., Ramneek, V. & Mahajan, V., 2020, ‘Prevalence of antimicrobial resistance patterns of Escherichia coli faecal isolates of cattle’, International Journal of Current Microbiology and Applied Sciences 9(3), 1850–1859. 10.20546/ijcmas.2020.903.214 [DOI] [Google Scholar]
  24. Mahmoud, A.K.A., Khadr, A.M., Elshemy, T.M., Hamoda, H.A. & Ismail, M.I., 2015, ‘Some studies on E-coli mastitis in cattle and buffaloes’, Alexandria Journal of Veterinary Sciences 45, 105–112. 10.5455/ajvs.178113 [DOI] [Google Scholar]
  25. Medhanie, G.A., Pearl, D.L., McEwen, S.A., Guerin, M.T., Jardine, C.M. & LeJeune, J.T., 2015, ‘Dairy cattle management factors that influence on-farm density of European starlings in Ohio, 2007–2009’, Preventive Veterinary Medicine 120(2), 162–168. 10.1016/j.prevetmed.2015.04.016 [DOI] [PubMed] [Google Scholar]
  26. Mohamed, H.M. & Sayed, H., 2017, ‘Detection of virulence factors of E. coli isolated from quail meat and its organs’, Animal Health Research Journal 5(4). [Google Scholar]
  27. Nabil, N.M., Erfan, A.M., Tawakol, M.M., Haggag, N.M., Naguib, M.M. & Samy, A., 2020, ‘Wild birds in live birds markets: Potential reservoirs of enzootic avian influenza viruses and antimicrobial resistant enterobacteriaceae in Northern Egypt’, Pathogens 9(3), 196. 10.3390/pathogens9030196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nasef, S.A., El Oksh, A.S. & Ibrahim, G.A., 2017, ‘Studies on enterohaemorrhagic escherichia coli (ehec) non o157: h7 strains in chicken with regard to antibiotic resistance gene on plasmid’, Assiut Veterinary Medical Journal 63(2), 157–165. 10.21608/avmj.2017.170661 [DOI] [Google Scholar]
  29. Navarro-Gonzalez, N., Wright, S., Aminabadi, P., Gwinn, A., Suslow, T. & Jay-Russell, M., 2020, ‘Carriage and subtypes of foodborne pathogens identified in wild birds residing near agricultural lands in California: A repeated cross-sectional study’, Applied and Environmental Microbiology 86(3), e01678–01619. 10.1128/AEM.01678-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Nguyen, L.-T., Schmidt, H.A., Von Haeseler, A. & Minh, B.Q., 2014, ‘IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies’, Molecular Biology and Evolution 32(1), 268–274. 10.1093/molbev/msu300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Nüesch-Inderbinen, M., Cernela, N., Wüthrich, D., Egli, A. & Stephan, R., 2018, ‘Genetic characterization of Shiga toxin producing Escherichia coli belonging to the emerging hybrid pathotype O80:H2 isolated from humans 2010–2017 in Switzerland’, International Journal of Medical Microbiology 308(8), 534–538. 10.1016/j.ijmm.2018.05.007 [DOI] [PubMed] [Google Scholar]
  32. Okonechnikov, K., Golosova, O., Fursov, M. & Team, T.U., 2012, ‘Unipro UGENE: A unified bioinformatics toolkit’, Bioinformatics 28(8), 1166–1167. 10.1093/bioinformatics/bts091 [DOI] [PubMed] [Google Scholar]
  33. Piva, I.C., Pereira, A.L., Ferraz, L.R., Silva, R.S., Vieira, A.C., Blanco, J.E. et al., 2003, ‘Virulence markers of enteroaggregative Escherichia coli isolated from children and adults with diarrhea in Brasilia, Brazil’, Journal of Clinical Microbiology 41(5), 1827–1832. 10.1128/JCM.41.5.1827-1832.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Quinn P.J., Markey, B.K., Carter M.E., Donnelly W.J.C. & Leonard F.C., 2002, Veterinary microbiology and microbial siseases, 1st edn., Blackwell Science Ltd, Oxford. [Google Scholar]
  35. Roca-Saavedra, P., Mendez-Vilabrille, V., Miranda, J.M., Nebot, C., Cardelle-Cobas, A., Franco, C.M. et al. 2018, ‘Food additives, contaminants and other minor components: Effects on human gut microbiota – A review’, Journal of Physiology and Biochemistry 74, 69–83. 10.1007/s13105-017-0564-2 [DOI] [PubMed] [Google Scholar]
  36. Sabarinath, A., Tiwari, K.P., Deallie, C., Belot, G., Vanpee, G., Matthew, V. et al., 2011, ‘Antimicrobial resistance and phylogenetic groups of commensal Escherichia Coli isolates from healthy pigs in Grenada’, WebmedCentral Veterinary Medicine 2(5), WMC001942. 10.9754/journal.wmc.2011.001942 [DOI] [Google Scholar]
  37. Saha, O., Hoque, M.N., Islam, O.K., Rahaman, M.M., Sultana, M. & Hossain, M.A., 2020, ‘Multidrug-resistant avian pathogenic Escherichia coli strains and association of their virulence genes in Bangladesh’, Microorganisms 8, 1135. 10.3390/microorganisms8081135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sanches, L.A., Gomes, M.D.S., Teixeira, R.H.F., Cunha, M.P.V., Oliveira, M.G.X.dD, Vieira, M.A.M. et al., 2017, ‘Captive wild birds as reservoirs of enteropathogenic E. coli (EPEC) and Shiga-toxin producing E. coli (STEC)’, Brazilian Journal of Microbiology 48(4), 760–763. 10.1016/j.bjm.2017.03.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Shinde, D.B., Singhvi, S., Koratkar, S.S. & Saroj, S.D., 2020, ‘Isolation and characterization of Escherichia coli serotype O157:H7 and other verotoxin-producing E. coli in healthy Indian cattle’, Veterinary World 13(10), 2269. 10.14202/vetworld.2020.2269-2274 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Shobrak, M.Y. & Abo-Amer, A.E., 2014, ‘Role of wild birds as carriers of multi-drug resistant Escherichia coli and Escherichia vulneris’, Brazilian Journal of Microbiology 45, 1199–1209. 10.1590/S1517-83822014000400010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Singh, P., Bist, B., Sharma, B. & Jain, U., 2014, ‘Virulence associated factors and antibiotic sensitivity pattern of Escherichia coli isolated from cattle and soil’, Veterinary World 7, 369–372. 10.14202/vetworld.2014.369-372 [DOI] [Google Scholar]
  42. Skarżyńska, M., Zajac, M., Bomba, A., Bocian, Ł., Kozdruń, W., Polak, M. et al., 2021, ‘Antimicrobial resistance glides in the sky – Free-living birds as a reservoir of resistant Escherichia coli with zoonotic potential’, Frontiers in Microbiology 12, 656223. 10.3389/fmicb.2021.656223 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Suenaga, Y., Obi, T., Ijiri, M., Chuma, T. & Fujimoto, Y., 2019, ‘Surveillance of antibiotic resistance in Escherichia coli isolated from wild cranes on the Izumi plain in Kagoshima prefecture, Japan’, Journal of Veterinary Medical Science 81(9), 1291–1293. 10.1292/jvms.19-0305 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Tormoehlen, K., Johnson-Walker, Y.J., Lankau, E.W., San Myint, M. & Herrmann, J.A., 2019, ‘Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations’, PeerJ 7, e6460. 10.7717/peerj.6460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Umpiérrez, A., Ernst, D., Fernández, M., Oliver, M., Casaux, M.L., Caffarena, R.D. et al., 2021, ‘Virulence genes of Escherichia coli in diarrheic and healthy calves’, Revista Argentina de Microbiología 53, 34–38. 10.1016/j.ram.2020.04.004 [DOI] [PubMed] [Google Scholar]
  46. Vandemaele, F.J., Hensen, S.M. & Goddeeris, B.M., 2004, ‘Conservation of deduced amino acid sequence of FimH among Escherichia coli of bovine, porcine and avian disease origin’, Veterinary Microbiology 101(2), 147–152. 10.1016/j.vetmic.2004.03.013 [DOI] [PubMed] [Google Scholar]
  47. Venegas-Vargas, C., Henderson, S., Khare, A., Mosci, R.E., Lehnert, J.D., Singh, P. et al., 2016, ‘Factors associated with Shiga toxin-producing Escherichia coli shedding by dairy and beef cattle’, Applied and Environmental Microbiology 82, 5049–5056. 10.1128/AEM.00829-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. WHO , 2017, Critically important antimicrobials for human medicine: Ranking of antimicrobial agents for risk management of antimicrobial resistance due to non-human use, World Health Organization, Geneva. [Google Scholar]
  49. Yuan, Y., Liang, B., Jiang, B.-W., Zhu, L.-W., Wang, T.-C., Li, Y.-G. et al., 2021, ‘Migratory wild birds carrying multidrug-resistant Escherichia coli as potential transmitters of antimicrobial resistance in China’, PLoS One 16(12), e0261444. 10.1371/journal.pone.0261444 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the article.


Articles from The Onderstepoort Journal of Veterinary Research are provided here courtesy of AOSIS

RESOURCES