Amlodipine downregulates gene expression that involved in the signaling pathways of coagulation process in COVID-19 patients: An observational clinical study

ABSTRACT

The SARS-CoV-2 virus has the property of activating the coagulation process, which is responsible for producing thrombotic events which is considered as one of the most serious COVID-19 complications. Hypertension is a hazard factor for COVID-19 complications, and people who are treated with calcium entry blockers may halt the occurrence of thrombotic events. to evaluate the effect of amlodipine on some genes involved in the activation of the coagulation procedure in COVID-19 patients with hypertensive. observational, cross-sectional study. This study was carried out in the Department of Pharmacy at Al-Kut University College in Wasit, Iraq, in conjunction with Al Zahraa Hospital from June 2021 to March 2022. A total of 45 COVID-19 patients participated in this study who were grouped into as follows: Group I (n = 23) who had no previous history of hypertension and Group II (n = 22) who had previous hypertension and were treated with amlodipine. Expression of the calcium-sensing receptor (CaSR), coagulation factor V (F5), and methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 Like (MTHFD1L) genes was determined. P values were calculated by Chi-square test for categorized facts and the Mann–Whitney test for incessant data. P ≤ 0.05 was considered statistically significant. Group II patients had significantly lower levels of CaSR, F5, and MTHFD1L gene expression compared with the corresponding levels in Group I patients. The expression level of MTHFD1L was elevated significantly in patients who had currently high blood pressure compared with normotensive patients in both the groups. Amlodipine is preferred in hypertensive patients who have COVID-19 because it attenuates the levels of gene expression that have an impact on the coagulation process.

INTRODUCTION

A viral infection known as COVID-19 can cause adult respiratory distress syndrome or pneumonia, which can make the respiratory condition worse. Venous or arterial thromboembolism is a serious complication of COVID-19, and it can occur in any organ.[1,2,3,4] This complication is linked to coagulopathy, which leads to multiorgan failure and a higher mortality rate.[5,6,7,8] Amlodipine is a calcium entry blocker that processes vasodilation associated with favorable effects on the blood platelets, including inhibition of their aggregation and reducing the mean platelet volume.[9,10,11,12] Therefore, the clinical use of amlodipine in COVID-19 treatment is summarized by reducing blood pressure, improving the survival rate in elderly patients with essential hypertension,[13] and reducing the mortality rate of pulmonary hypertension.[14]

Calcium is an important cation that is essential in blood clotting, and a number of genes are involved in the homeostasis of calcium, including the calcium-sensing receptor (CaSR),[15] coagulation factor V (F5),[16] methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 Like (MTHFD1L) signaling pathway.[17,18] The rationale for this study is related to the modulation of cytosolic and/or extracellular calcium that is involved in causing the thromboembolic phenomenon in COVID-19 patients through the action of various signaling pathways. Prevention of coagulation process considered as one of the mast important targets for of COVID-19 treatment and for this reason the study was targeted to examine the theory that inhibiting calcium entry into cells may be helpful in reducing the signaling pathways that control calcium levels. A real-time polymerase chain reaction (PCR) was used to determine the status of the CaRS, F5, and MTHFD1 genes in COVID-19 patients managed with amlodipine in a comparison with those did not receive amlodipine.

SUBJECTS AND METHODS

The current study was an observational, cross-sectional study which was conducted in the Department of Pharmacy at Al-Kut University College in Wasit, Iraq, in conjunction with Al Zahraa Hospital from June 1, 2021 to March 1, 2022. The institutional scientific committee approved the study (Approval number ZH-4023). According to the Helsinki declaration and before being enrolled in the study every individual gave their written consent, and the dosage regimen of amlodipine as an antihypertensive agent was prescribed according to the instructions for the management of hypertensive patients with COVID-19. Eligible COVID-19 patients of both sexes, aged >18 years, and the diagnosis of COVID-19 confirmed by PCR, serological, and blood testing. The patients were assigned according to their history of hypertension and were under treatment with an oral dosage of amlodipine once daily.

Group I (n = 23): COVID-19 patients who had no history of hypertension, which comprised 16 hypertensive patients and 7 normotensive patients.

Group II (n = 22): COVID-19 patients who were treated with amlodipine (5–10 mg, once daily), which comprised 15 hypertensive patients and 7 normotensive patients.

Furthermore, each group was assigned hypertensive if the patients had a diastolic blood pressure ≥90 mmHg and/or systolic blood pressure ≥140 mmHg [Figure 1]. Patients who presented with cough, dyspnea, and tachypnea were assigned positive respiratory signs and symptoms, while those who presented with constitutional symptoms were assigned negative respiratory signs and symptoms [Figure 1].

Figure 1.

Flowchart of the participants assigned to the study

Venous blood samples were collected from each COVID-19 patient at the time of entry into the hospital before initiation of drug therapy for COVID-19.

FavorPrep™ Tissue Total RNA Mini Kit (Taiwan, number FATRK 001) was used to extract the total RNA from blood sample. The quality and quantity of extracted RNA were assessed using a Thermo Scientific NanoDrop™ 1000 spectrophotometer (Thermo Scientific, Germany) and gel electrophoresis. Then, a DNase-I addition step was performed (Sinagene, Iran. number PR891627), followed by cDNA synthesis of extracted RNA (1 g) by accidental primers and a cDNA Synthesis Kit (number A101161, Pars Tous Biotechnology, Iran).

A quantitative real-time PCR was approved using the SYBR^® Premix Ex Taq™ II kit (TaKaRa, Japan). The primers for quantitating the CaSR, F5, MTHFD1L, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) are shown in Table 1.

Table 1.

The sequences of the gene primers and the yields of the polymerase chain reaction

Gene	Primer sequence (5’–3’)	Yield (base pair)
CaSR	Forward: GAGTAGACCAAGTGCAACAGG Reverse: AGACTCAGGTCAAGCGTTGC	134
Clotting factor V	Forward: GGCTATGTGCCTGAGAGCAT Reverse: TGGGTCCCCACACTACAGAA	83
MTHFD 1L	Forward: GGGGAAACACCAGAATCAAG Reverse: CCCCAGAGAAAGAAGAGGAG	198
GAPDH	Forward: AATGGGCAGCCGTTAGGAAA Reverse: GCGCCCAATACGACCAAATC	168

GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, MTHFD1L: Methylenetetrahydrofolate dehydrogenase (NADP+dependent) 1L, CaSR: Calcium-sensing receptor

In brief, the real-time PCR assay was performed using the Rotor-Gene (6000 Corbett) platform, which was accomplished by thermal cycling conditions as follows: the reaction steps began with a 5-min activation phase at 95°C, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. Standard curves for each gene were plotted from diluted samples. The yield of each gene was electrophoresed on 2% agarose gels to determine the size of the yield molecule. The GAPDH gene was then utilized as a housekeeping gene to normalize the results of the comparisons, and the 2^−∆∆Ct method was used to determine the comparative expressions in this case. Each quantitative PCR experiment was performed in triplicate.

Statistical analysis

The results are obtainable as a digit, mean, median, and interquartile range. The facts were investigated by the Statistical Package for the Social Sciences (SPSS) version 24 (IBM, USA). P values were calculated by Chi-square test for categorized facts and the Mann–Whitney test for incessant data. P ≤ 0.05 was considered statistically significant.

RESULTS

The results illustrated in Table 2 showed the participants’ characteristic features which revealed that Groups I differ nonsignificantly from Group II in the mean values of age, sex, and residency distribution or the frequency of participants with higher blood pressure.

Table 2.

Characteristics of the participants

Characteristics	Group I (n=23)	Group II (n=22)	P
Age (years), mean±SD	43.4±12.3	45.8±7.2	0.432*
Sex (male: female)	14:9	14:8	0.982**
Residency
Urban	15	12	0.766**
Rural	8	10
Respiratory signs and symptoms	18	17	0.997**
BP (systolic ≥140 and/or diastolic ≥90 mmHg)	16	15	0.995**

*t-test, **Chi-square test. SD: Standard deviation, BP: Blood pressure

Table 3 shows a significantly higher median MTHFF1L gene level among COVID-19 patients who presented with higher blood pressure compared with the corresponding values in both the groups. The median levels of the CaSR and F5 genes stayed nonsignificantly changed in patients who presented with higher blood pressure compared with the equivalent patients in Group I. The median value of the F5 gene level was nonsignificantly lower in hypertensive patients compared with normotensive patients in Group II.

Table 3.

Changes in the gene levels in COVID-19 patients according to status of blood pressure

Genes	Group I, median (IQR)		P	Group II, median (IQR)		P
	Normotensive (n=7)	Higher BP (n=16)		Normotensive (n=7)	Higher BP (n=15)
CaSR	4.2 (2.4–5.3)	5.3 (4.55–7.1)	0.055*	2.2 (1.8–2.7)	2.7 (2–3.3)	0.332*
F5	6.4 (5.5–6.8)	7.2 (6.0–7.98)	0.376*	2.6 (1.7–4.0)	2.0 (1.7–2.3)	0.123*
MTHFD1L	6.0 (5.5–7.2)	8.05 (7.05–8.5)	0.039*	2.6 (2.1–3.2)	4.0 (3.0–4.3)	0.014*

*Mann–Whitney test. CaSR: Calcium-sensing receptor, F5: Coagulation factor V, MTHFD1L: Methylenetetrahydrofolate dehydrogenase (NADP + dependent) 1L, IQR: Interquartile range, BP: Blood pressure

Table 4 shows that COVID-19 patients who were on treatment with amlodipine (5–10 mg once daily) had significantly lower median levels of the CaSR, F5, and MTHFD1L genes, whatever the current blood pressure levels, compared with Group I patients who were not treated with amlodipine.

Table 4.

Effects of amlodipine on the changes in the gene levels in COVID-19 patients

Genes	Normotensive (n=14)		P	Higher BP (n=31)		P
	Group I	Group II		Group I	Group II
CaSR	4.2 (2.4–5.3)	2.2 (1.8–2.7)	0.017*	5.3 (4.55–7.1)	2.7 (2–3.3)	0.001*
F5	6.4 (5.5–6.8)	2.6 (1.7–4.0)	0.007*	7.2 (6.0–7.98)	2.0 (1.7–2.3)	0.001*
MTHFD1L	6.0 (5.5–7.2)	2.6 (2.1–3.2)	0.001*	8.05 (7.05–8.5)	4.0 (3.0–4.3)	0.001*

*Mann–Whitney test. CaSR: Calcium-sensing receptor, F5: Coagulation factor V, MTHFD1L: Methylenetetrahydrofolate dehydrogenase (NADP + dependent) 1L, BP: Blood pressure

Table 5 shows that the median gene levels were significantly lower in Group II, which had respiratory signs and symptoms, compared with the equivalent values in Group I. A significantly lower median level of the F5 gene in COVID-19 patients who had amlodipine treatment and presented with constitutional symptoms. In general, the median levels of CaSR, F5, and MTHFD1L genes were higher in Group I participants who had respiratory signs and symptoms compared with the equivalent values in the absence of respiratory symptoms.

Table 5.

The distribution of gene levels in COVID-19 patients according to the presence of respiratory signs and symptoms

Genes	Positive respiratory signs and symptoms (n=35)		P	Negative respiratory signs and symptoms (n=10)		P
	Group I (n=18)	Group II (n=17)		Group I (n=5)	Group II (n=5)
CaSR	5.3 (4.48–6.9)	2.7 (2.0–3.3)	0.001*	3.6 (2.35–6.7)	2.1 (1.9–2.55)	0.056*
F5	7.0 (6.0–7.93)	2.1 (1.7–2.55)	0.001*	5.7 (4.25–7.4)	2.0 (1.75–2.5)	0.008*
MTHFD1L	7.75 (6.3–8.5	3.3 (2.6–4.3)	0.001*	5.95 (4.987.4)	3.6 (2.5–4.1)	0.056*

*Mann–Whitney test. CaSR: Calcium-sensing receptor, F5: Coagulation factor V, MTHFD1L: Methylenetetrahydrofolate dehydrogenase (NADP + dependent) 1L

DISCUSSION

The results show that the expression of the CaSR, F5, and MTHFD1L genes was affected by current high blood pressure, the presence of COVID-19 respiratory symptoms, and concomitant use of amlodipine therapy. A significantly upgraded expression of the MTHFD1L gene was associated with a higher blood pressure, the presence of respiratory symptoms, and using amlodipine.

This indicates that the synthesis of mitochondrial tetrahydrofolate in these situations is increased. Therefore, the upregulation of the MTHFD1L gene in COVID-19 is a defense mechanism to ameliorate the respiratory symptoms of COVID-19, as there is evidence that using folic acid or leucovorin could prevent the access of COVID-19 into the host cell.[19] Another piece of evidence showed that administration of folic acid could reduce blood pressure, D-dimer levels, and fibrinogen in patients with hypertension.[20] In addition, amlodipine impacts positively on the upgrading of the MTHFD1L gene by maintaining the ultrastructure and function of the mitochondria via increasing the capillary number.[21]

Amlodipine users had significantly downregulated F5 gene expression irrespective of their current blood pressure or the presence of respiratory symptoms, which may be related to the effect of amlodipine on the homeostasis as it has been found that amlodipine reduces the platelet-fibrin clot.[22] The literature survey does not show that amlodipine has a specific effect on the F5 or MHFD1L gene expression, but amlodipine impacts some genes that are associated with hypertension, as amlodipine significantly decreased systolic blood pressure in patients with the rs10491334 CC genotype and CT genotype in a comparison with patients having the rs10491334 TT genotype.[23]

Amlodipine users had significantly lower levels of CaSR in both normotensive and hypertensive patients as well as patients with positive respiratory symptoms. This observation indicates that amlodipine has a calcilytic effect, and at the same time, COVID-19 can be considered a disease that is associated with CaSR.[24] There is evidence that SARS-CoV-2, which has strong coagulation properties, enhances the activation of CaSR.[25] Some authors proposed that dihydropyridines (e.g. nifedipine and amlodipine) may act as an unintended pharmacoperone, which may alter the mutation or expression of CaSR.[26]

In addition, CaSR, which is a surface cell receptor that is activated in different pathological conditions, including hypertension and inflammation, is possibly to be deactivated in amlodipine users.[27] In brief, expression of these CaSR, F5, and MTHFD1L is involved in the activation of the coagulation process. The limitations of this study included the small sample size, the baseline levels of CaSR, F5, and MTHFD1L in healthy subjects, and hypertension without COVID-19 infections.

CONCLUSIONS

It was concluded that amlodipine users showed significant favorable changes in the expression in that it reduces the expression of genes involved in the activation of the coagulation process. This effect is highly valuable in patients with COVID-19, as this virus activates the coagulation process and considered as the most serious complication.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.