Abstract
Owing to the feature of strong α-glucosidase inhibitory activity, 1-deoxynojirimycin (1-DNJ) has broad application prospects in areas of functional food, biomedicine, etc., and this research wants to construct an efficient strain for 1-DNJ production, basing on Bacillus amyloliquefaciens HZ-12. Firstly, using the temperature-sensitive shuttle plasmid T2 (2)-Ori, gene ptsG in phosphotransferase system (PTS) was weakened by homologous recombination, and non-PTS pathway was strengthened by deleting its repressor gene iolR, and 1-DNJ yield of resultant strain HZ-S2 was increased by 4.27-fold, reached 110.72 mg/L. Then, to increase precursor fructose-6-phosphate (F-6-P) supply, phosphofructokinase was weaken, fructose phosphatase GlpX and 6-phosphate glucose isomerase Pgi were strengthened by promoter replacement, moreover, regulator gene nanR was deleted, 1-DNJ yield was further increased to 267.37 mg/L by 2.41-fold. Subsequently, promoter of 1-DNJ synthetase cluster was optimized, as well as 5′-UTRs of downstream genes in synthetase cluster, and 1-DNJ produced by the final strain reached 478.62 mg/L. Last but not the least, 1-DNJ yield of 1632.50 mg/L was attained in 3 L fermenter, which was the highest yield of 1-DNJ reported to date. Taken together, our results demonstrated that metabolic engineering was an effective strategy for 1-DNJ synthesis, this research laid a foundation for industrialization of functional food and drugs based on 1-DNJ.
Keywords: 1-Deoxynojirimycin, Bacillus amyloliquefaciens, Metabolic engineering, Glucose transport pathway, Fructose 6-phosphate, 1-DNJ synthetase Gene cluster
1. Introduction
Diabetes mellitus (DM) is one of the most common chronic diseases in the world, and is also a major public health issue [1]. Basing on the latest data reported by International Diabetes Foundation, the number of global diabetes patients reached 537 million in 2021, which was expected to rise to 643 million in 2030 (IDF Diabetes Atlas 2021). Acting as an antidiabetic drug, α-glucosidase inhibitory (α-GI) has showed the good efficiency compared with other oral hypoglycemic drugs, and are the most commonly used oral diabetes drugs in Asian countries [2]. At present, commercial α-GI inhibitors include miglitol, acarbose, voglibose, etc, however, these drugs may cause adverse reactions, such as diarrhea or abdominal distension, and prolonged use causes liver toxicity [3]. Therefore, people need to find more effective and safer α-GI.
1-DNJ is an important α-GI that separated from mulberry leaves, and it could beacted as the bulk drug for the treatmentof non-insulin-dependent (type II) diabetes [4]. In addition, 1-DNJ possesses various biological activities, such as anti-obesity, antiviral, etc [5,6]. Compared with acarbose, 1-DNJ showed better anti-hyperglycemia properties in the treatment of hyperglycemia rats induced by streptozotocin and high-fat diet, and the hyperglycemic state was returned more slowly in 1-DNJ-treated group, compared to acarbose-treated group [5]. Moreover, 1-DNJ can reduce liver damage and improve hepatic glucose metabolism in mouse [7]. Bacillus and Streptomyces are the promising strains for 1-DNJ synthesis. Previously, 1-DNJ-producing strain Streptomyces SID9135 was isolated from soil, which yield was increased to 640 mg/L by optimizing fermentation process [8]. Bacillus amyloliquefaciens AS385 was screened from 750 microorganisms, and 1-DNJ yield was increased to 460 mg/L in the medium with sorbitol addition [9]. The biosynthetic pathway of microbial 1-DNJ begins from fructose-6-phosphate [10], an intermediate product of glycolysis, and genes gabT1, yktC1, and gutB1 were proven to be involved in 1-DNJ biosynthesis pathway [9,11]. Meantime, metabolic engineering approach was also applied for the efficient synthesis of 1-DNJ. Through over-expressing fructokinase gene yjf and fructose phosphatase gene glpX in E. coli, 1-DNJ yield was reached 273 mg/L, combining with medium optimization [12]. B. amyloliquefaciens HZ-12 is a 1-DNJ producing strain that isolated in our previous research [13], and over-expression of 1-DNJ synthetase gene cluster and glucose transporter GlcP led to a 32.52% increase of 1-DNJ yield [14]. However, the synthesis level of 1-DNJ by microorganisms is still too low, which limits its application and promotion.
With the continuous progress of bio-breeding technology driven by synthetic biology and metabolic engineering, biomanufacturing has achieved various achievements in the areas of energy, chemical, food, agriculture, etc. Based on the promising effect of artemisinin in malaria treatment, Jay et al. have established the de novo synthesis pathway of artemisinin in Saccharomyces cerevisiae, which overturned the traditional method of artemisinin production [15]. Meanwhile, to increase N-acetylglucosamine (GlcNAc) production in Bacillus subtilis, Liu et al. have systematically modified glucose transport, central carbon metabolism, and GlcNAc synthesis pathway, etc., which significantly enhanced GlcNAc production [16]. In addition, in order to achieve the fine regulation of genes and metabolic pathways in Bacillus, a variety of gradient promoter libraries were constructed by our group [17], for efficient production of proteins [18], poly γ-glutamic acid [19], 2-phenylethanol [20], etc. Based on the guidance of synthetic biology concept and preliminary basis of our group in Bacillus biotechnology, the synthesis capability of 1-DNJ was expected to be improved through the approach of metabolic engineering breeding.
In the previous work of our group, a 1-DNJ synthesis strain B. amyloliquefaciens HZ-12 was isolated, and the solid-state fermentation process for 1-DNJ production was also established [13]. Furthermore, the 1-DNJ yield was significantly increased by over-expression of glucose transporter GlcP [14]. Here, to increase 1-DNJ production in B. amyloliquefaciens HZ-12, the modules of glucose transportation, central carbon metabolism, and 1-DNJ synthetase cluster were systematically engineered, and fermentation process was also optimized in 3 L fermenter. Our results demonstrated that metabolic engineering was an effective strategy for enhanced production of 1-DNJ, and this research laid a foundation for the industrialization of functional food and drugs based on 1-DNJ.
2. Material and methods
2.1. Bacteria, plasmids andcultivation conditions
The strains and plasmids used in this study were listed in Table S1. B. amyloliquefaciens HZ-12 was used as the parental strain for recombinant strain construction, and E. coli DH5α was served as the host for plasmid establishment. Plasmid pHY300PLK was used for constructing gene expression vector, and plasmid T2(2)-Ori was applied for gene integration, gene deletion and promoter replacement. The primers used for strain construction and gene transcriptional level assays were provided in Table S2. LB medium (10 g/L Tryptone, 5 g/L Yeast, 10 g/L NaCl) was served as the basic medium for strain cultivation, and corresponding antibiotic (20 μg/mL tetracycline or 20 μg/mL kanamycin) was added, when necessary. For 1-DNJ production in flask, the seeds were cultivated in a 250 mL shake flask containing 50 mL LB medium for 8–12 h, then transferred into 250 mL shake flask containing 30 mL fermentation medium (40 g/L glucose, 20 g/L peptone, 15 g/L yeast extract, 1 g/L KH2PO4, 0.5 g/L MgSO4·7H2O, 0.2 g/L FeSO4·7H2O, 0.02 g/L MnCl2), and then cultivated for 60 h. Each fermentation experiment was repeated at least three times.
2.2. Construction of gene over-expression strain
The gene expression plasmid was established basing on plasmid pHY300PLK, according to our previously reported method [21], and gene nanR over-expression strain was served as an example. Briefly, P43 promoter from B. subtilis 168, nanR from B. amyloliquefaciens HZ-12, amyL terminator from Bacillus licheniformis WX-02 were amplified by corresponding primers, and fused by spliced overlap extension PCR (SOE-PCR). Then, the fused fragment was inserted into pHY300PLK at the restriction sites EcoRI/XbaI, diagnostic PCR and DNA sequence was applied to verify the successful construction of recombinant vector, named as pHY-NanR. Then, pHY-NanR was electro-transferred into B. amyloliquefaciens HZ-12 to attain nanR overexpression strain HZ/pHY-NanR.
2.3. Gene deletion in B. amyloliquefaciens
Gene deletion in B. amyloliquefaciens was referred to our previously reported method [22], basing on vector T2(2)-Ori, and the construction procedure of gene nanR deletion strain was served as an example. Briefly, the upstream and downstream homologous arms of gene nanR were amplified, and fused by SOE-PCR. The fused fragment was inserted into T2(2)-Ori at the restriction sites SacI/XbaI, resulting in gene deletion vector T2-nanR. Then, T2-nanR was electro-transformed into B. amyloliquefaciens, and the positive transformants were verified by kanamycin resistance and diagnostic PCR. The positive transformants were cultivated in LB medium (containing 20 mg/L kanamycin) at 45 °C for three generations, and then transferred into LB medium without kanamycin for six generations at 37 °C. Colonies without kanamycin resistance were screened, and nanR-deficient strain was verified by diagnostic PCR and DNA sequencing. Similarly, other gene deletion strains were attained by the same method.
2.4. Construction of promoter replacement strain in B. amyloliquefaciens
Promoter replacement is an effective strategy to regulate the intensities of gene expression and metabolic pathway. Here, the construction procedure of gene ptsG promoter replacement strain was served as an example. Briefly, upstream and downstream homologous arms of original promoter of gene ptsG, promoter Pundh attained in our previous research [17], were amplified and fused. Then, the fused fragment was inserted into T2(2)-Ori to attain the promoter replacement vector, named as T2-Pundh-ptsG. T2-Pundh-ptsG was electro-transformed into B. amyloliquefaciens, and the promoter replacement strain was obtained by homologous double-exchanges, the same as that of gene deletion.
2.5. 1-DNJ production in 3 L fermenter
For 1-DNJ production in 3 L fermentor, B. amyloliquefaciens was cultivated in 1.8 L 1-DNJ production medium. The inoculation ratio was 6%, and aeration rate was 1.0 vvm throughout the fermentation process. The agitation rate was 300 rpm at lag phase (0–4 h), and the dissolved oxygen was associated with stirring, to maintain the dissolved oxygen percentage between 15 and 25% (6–60 h). Glucose was feed to maintain the glucose concentration between 5 and 10 g/L, and samples were taken every 6 h to measure the cell biomass and 1-DNJ concentration.
2.6. Analysis methods
To determine the concentration of 1-DNJ, the volume of 1 mL fermentation supernatant was mixed 20 mL distilled water. The 1-DNJ concentration was determined by Agilent HPLC 1260 (Agilent Technologies, USA), equipped with Agilent Lichrospher C18 column (4.6 mm × 250 mm, 5 μm), the detection wavelength was 254 nm, and mobile phase was acetonitrile: 0.1% acetic acid (11:16, V/V). The injection volume was 10 μL, and flow rate was 1.0 mL/min. In addition, cell biomass was measured by dilution method. Glucose concentration was detected using a biosensor analyzer. Gene transcriptional levels were measured by RT-qPCR, according to our previous research [23].
2.7. Statistical analysis
Each experiment was performed at least three replicates, and software SPSS was used for data analysis. All data were subjected to analysis of variance at P < 0.05 (*) and P < 0.01 (**), and t-test was performed with statistical software STATISTICA 6.0.
3. Results
3.1. Optimization of glucose transport pathway for 1-DNJ synthesis
Acting as the most common carbon source for cell growth and metabolite synthesis, glucose efficient utilization is essential for the synthesis of target product. In Bacillus, glucose is mainly transported into cell by phosphotransferase system (PTS), accompanying with the conversion of phosphoenolpyruvate (PEP) to pyruvate (PYR). This phenomenon leads to the accumulation of excess pyruvate, coupled with the generally weak TCA cycle, resulted in the vigorous overflow metabolic and overproduction of acetoin, 2,3-butanediol and acetate in Bacillus. Thus, Bacillus was proven as the wonderful strain for acetoin and 2,3-butanediol production [24]. In addition, there is another glucose transport pathway (Non-PTS pathway) in Bacillus, and glucose transports by which was not accompanied with pyruvate generation. Served as the critical gene in PTS pathway, ptsG expression determines the metabolic flux of PTS pathway, glucose transporter GlcP and glucokinase GlcK served as the vital genes in non-PTS pathway, and both of them were negatively regulated by regulator IolR [25]. Here, we want to optimize the glucose transport pathway to increase the synthesis capabilityof 1-DNJ (see Fig. 1).
Fig. 1.
Metabolic engineering of B. amyloliquefaciens for efficient production of α-glucosidase inhibitor 1-deoxynojirimycin, including the modules of glucose transport pathway, F-6-P metabolic node and 1-DNJ synthetase gene cluster.
Basing on the original strain B. amyloliquefaciens HZ-12 (HZ-S), the promoter of gene ptsG was replaced by promoter Pundh, a weak promoter attained in our previous research [17], resulting in strain HZ-S1. Based on our results of Fig. 2, the maximum cell biomass and glucose consumption rates were significantly reduced by 33.74% and 25.00% in HZ-S1, respectively. However, 1-DNJ produced by HZ-S1 was increased to 93.04 mg/L by 3.42-fold, compared with that of original strain HZ-S (21.03 mg/L). Furthermore, to increase the glucose transportation and cell growth, non-PTS pathway was strengthened by knocking out of regulator gene iolR, and transcriptional level of genes glcP and glcK were respectively increased by 2.62-fold and 4.21-fold in the resultant strain HZ-S2, and 1-DNJ produced by HZ-S2 reached 110.72 mg/L, increased by 19.00% and 4.26-fold compared to HZ-S1 and HZ-S, respectively. Meanwhile, cell growth of HZ-S2 was dramatically improved, and the maximum cell biomass was increased by 23.75% compared to HZ-S1. Glucose consumption rate of HZ-S2 was reduced by 16.67%, and by-products, acetoin and 2, 3-butediol, were respectively reduced by 34.73% and 32.39%, compared to HZ-S. Thus, these results indicated that rewiring glucose transportation pathway weakened the overflow metabolism and promoted 1-DNJ synthesis.
Fig. 2.
Optimization of glucose transport pathways for 1-DNJ synthesis. A: Schematic diagram of glucose transport in B. amyloliquefaciens HZ-12, B: 1-DNJ yields, C: Glucose concentrations, D: Cell biomass, E: Transcriptional levels of genes glcP and glcK, F: The yields of by-products (acetoin and 2,3-butandieol).
3.2. Strengthening precursor fructose 6-phosphate supply for 1-DNJ synthesis
Sufficient precursor supply is an important basis for high-level production of target product. Fructose 6-phosphate (F-6-P) is an important intermediate in glycolytic pathway, and is also the key precursor for DNJ synthesis. Here, genes around F-6-P metabolite node were manipulated to improve its supply for 1-DNJ synthesis.
Phosphofructokinase, encoded by two iso-enzyme genes pfkA and pfkB, is responsible for catalyzing the reactionfrom F-6-P to fructose 1,6-bisphosphate (F-1,6–2P) [26], additionally, fructose 1,6-bisphosphatase GlpX catalyzes the reverse reaction in gluconeogenic pathway. Firstly, genes pfkA and pfkB were deleted to improve F-6-P accumulation, resulting in strain HZ-S3 and HZ-S4, respectively. Based on our results of Fig. 3A, knocking out of pfkB benefited 1-DNJ synthesis, and 1-DNJ yield was increased to 118.82 mg/L by 7.31%. However, the growth status of pfkA-null strain (HZ-S3) was very poor, resulting in the significant reduction of 1-DNJ yield, and which may be due to that pfkA plays as the major function of phosphofructokinase, and metabolic disorder was occurred in pfkA deletion strain. Then, promoter Pundh was applied to weaken pfkA expression in HZ-S4, and transcriptional level of pfkA was reduced by 62.00% in resultant strain HZ-S4-Pundh-PfkA (HZ-S5), 1-DNJ yield was 137.29 mg/L, increased by 15.54% compared to HZ-S4. In addition, cell biomass showed no significant difference between HZ-S5 and HZ-S4. Furthermore, the original promoter of glpX was replaced by strong promoter PbacA, to strengthen the transformation from F-1,6–2P to F-6-P in gluconeogenic pathway, and 1-DNJ yield produced by the attained strain HZ-S5-PbacA-GlpX (HZ-S6) was 169.41 mg/L, increased by 23.40% compared to HZ-S5.
Fig. 3.
Strengthening precursor F-6-P supply for 1-DNJ synthesis. A: Schematic diagram of F-6-P metabolic node in B. amyloliquefaciens HZ-12, B: 1-DNJ yields, C: Cell biomass, D: The transcriptional levels of genes pfkA and glpX. E: 1-DNJ yields, F: The transcriptional levels of genes nagA, nagB and pgi.
Generally, F-6-Pcan also be generated by GlcNAc-6P, under the catalysis of N-acetylglucosamine-6-phosphate deacetylase NagA and glucosamine-6-phosphate deaminase NagB, both of them are regulated by transcription factor NanR. Here, to strengthen the catalysis reaction from GlcNAc-6P to F-6-P, gene nanR was respectively deleted and over-expressed in HZ-S6, resulting in recombinant strains HZ-S6△nanR(HZ-S7) and HZ-S6/pHY-NanR(HZ-S8), respectively. The transcriptional levels of genes nagA and nagB were respectively increased by 2.26-fold and 1.93-fold in nanR deletion strain, which led to a 21.40% increase of 1-DNJ yield, compared to HZ-S6, meanwhile, 1-DNJ yieldwas decreased by 11.54% in NanR overexpression strain HZ-S8 (Fig. 3E).
Glucose 6-phosphate isomerase Pgi catalyzes the conversion of G-6-P to F-6-P, which is an important source of F-6-P. Here, the original promoter was replaced by promoter PbacA, a strong promoter confirmed in our previous research [27], attaining recombinant strain HZ-S9(HZ-S7-PbacA-Pgi). Based on our results of Fig. 3F, the transcriptional level of gene pgi was increased by 3.26-fold, and 1-DNJ yield of strain HZ-S9 reached 267.37 mg/L, increased by 30.00% compared to HZ-S7.
3.3. Enhancing the expression intensity of 1-DNJ synthesis gene cluster for 1-DNJ production
Genes gabT1, yktC1 and gutB1, encoding for 4-aminobutyrate aminotransferase, myo-inositol-1(or 4)-monophosphatase and zinc-binding dehydrogenase [10], were proven as the critical genes in 1-DNJ synthesis pathway in Bacillus [9,11], all of these genes were driven by promotrt PgabT1. To improve the gene cluster expression for 1-DNJ synthesis, the original promoter was replaced by promoters P43, PbacA, and dual promoter PykzA-P43, attaining recombinant strains HZ-S10(HZ-S9-P43-TYB), HZ-S11(HZ-S9-PbacA-TYB) and HZ-S12(HZ-S9-PykzA-P43-TYB), respectively. Based on the results of Fig. 4, promoter replacement benefited 1-DNJ synthesis, and 1-DNJ yields produced by the relative strains were respectively increased by 25.49%, 41.80% and 47.47%, which positively consisted with the results of gene transcriptional levels in Fig. 4C.
Fig. 4.
Effects of promoter replacement of 1-DNJ synthetase gene cluster on 1-DNJ production. A: Schematic diagram of promoter and 5′-UTR replacement of 1-DNJ synthetase gene cluster, B: 1-DNJ yields, C: Genes transcription level.
In general, the expression level of downstream gene in the gene clusters is limited, due to lower transcription and translation efficiency, and gene gabT1 transcriptional level was higher than those of yktC1 and gutB1 in HZ-S11.5′-UTR was confirmed to play the critical role in mRNA translation initiation and stability, thereby affecting the gene expression level. In the previous research of our group, a 5′-UTR library has been established for gene expression regulation in Bacillus [28]. Here, to improve gene gutB1 expression, the original 5′-UTR of gutB1 was replaced by UTR12 (GTATATTAGAAAGGAGGAATATATA), attained recombinant strain HZ-S13, and 1-DNJ yield produced by HZ-S13 reached 426.71 mg/L, increased by 8.22% compared to HZ-S12 (Fig. 5A). Additionally, 5′-UTR replacement decreased the △G of mRNA secondary structure (Fig. 5B and C), which benefited mRNA translation initiation and secondary stability. Meanwhile, similar strategy was applied for yktC1 expression enhancement in HZ-S13, and 1-DNJ produced by the resultant strain HZ-S14 was 478.6 mg/L, increased by 12.17% compared to HZ-S13.
Fig. 5.
Effects of 5′-UTR replacement of genes yktC1 and gutB1 on 1-DNJ production. A: 1-DNJ yields, B: The mRNA secondary structure of yktC1 with its original 5′-UTR, C: The mRNA secondary structure of yktC1 with UTR12, D: The mRNA secondary structure of gutB1 with its original 5′-UTR, E: The mRNA secondary structure of gutB1 with UTR12.
3.4. 1-DNJ production of B. amyloliquefaciens HZ-S14 in 3 L fermenter
To further increase 1-DNJ yield, fed-batch fermentation of strain HZ-S14 was performed in a 3-L fermenter (Fig. 6), with a fermentation period of 96 h. The pH was controlled between 6.5 and 7.4 throughout the fermentation process, and glucose was supplemented to maintain its concentration at 5–10 g/L. In the first 50 h of fermentation, cells grew rapidly, and the maximum cell biomass (OD600) reached 57.81 at 72 h. 1-DNJ was synthesized from 48 h, and the synthesis rate was significantly accelerated after 60 h, and the maximum1-DNJ yield was 1632.5 mg/L at 96 h, whichwas the highest yield of 1-DNJ reported so far.
Fig. 6.
The fermentation process curve of strain HZ-S14 in 3 L fermenter.
4. Discussions
Synthetic biology and metabolic engineering promoted the development of food biotechnology, and boosted the basic research and application of future food science. Post et al., have made the first artificial meat burger in the world [29], and researchers have successfully constructed the cell factory for the production of hemoglobin, the colorant of artificial meat in Yarrowia lipolytica [30]. Furthermore, co-expression of molecular chaperone led to the 2-fold increases of thaumatin production in Pichia pastoris [31], and microbial production of lactoprotein has also become a research hotspot in recent years, which laid the foundation for nutritional protein production by microorganism. Meanwhile, synthetic biology has also been widely used in the production of metabolites. Through metabolic engineering breeding, the yield of citric acid reached 200 g/L in Y. lipolytica AWG7 INU 8, with a yield of 0.51 g/L·h [32]. Meanwhile, one-step synthesis process of Vitamin C was established by introducing the different combinations of l-sorbose dehydrogenases and l-sorbosone dehydrogenases in Gluconobacter oxydans WSH-003, which overturned the traditional manufacturing process of vitamin C [33]. In this research, efficient synthesis of α-glucosidase inhibitor1-DNJ was achieved basing on the rational-design and optimization of metabolic pathways, which might change the traditional bio-manufacturing process of 1-DNJ production that mainly exacted from mulberry leaves, and is expected to be applied in the production of hypoglycemic functional foods. Taken together, developments in synthetic biology and metabolic engineering are transforming the food industry [34], which could improve the traditional food production and manufacturing, as well as enhance food nutrition and functions, in addition, the traditional fermented food production can also be altered by the genetically engineered microbial [35].
The optimal regulation of central carbon metabolism plays the vital role in cell growth and target metabolite synthesis, which could improve the utilization ratio of carbon sources for target product production. For example, in order to improve PEP accumulation for tryptophan synthesis in E. coli, genes encoding for pyruvate oxidase B (poxB), pyruvate formate lyase (pflB), lactate dehydrogenase (ldhA), alcohol dehydrogenase (adhE), acetate kinase A (ackA) and phosphoacetyltransferase (pta) were knocked out in E. coli, and tryptophan yield was increased by 12% [36]. In B. subtilis, through repressing genes pfkA and zwf by CRISPRi, the carbon flux was partially diverted from pentose phosphate pathway (PPP) and glycolysis to hyaluronic acid biosynthesis, which led to the 108% increase of hyaluronic acid titer [37]. Meanwhile, a “push-pull-promote” strategy was established to rewire carbon metabolism for GlcNAc synthesis, and GlcNAc yield was increased to 24.5 g/L by 3.71 folds, and this research provided new methods and ideas for reconstructing metabolic networks to improve carbon atom economy [38]. Also, various approaches were conducted to optimize the glucose metabolism and shikimic acid synthesis pathway in E. coli, and shikimic acid yield was increased to 78.4 g/L in final strain [39]. In this study, in order to improve the intracellular accumulation of F-6-P, the expression levels of genes in glucose transport, glycolysis, peptidoglycan synthesis, and gluconeogenesis pathways were manipulated, which led to a 86.74%increase of 1-DNJ yield, and byproducts (acetoin and 2,3-butandieol) were also reduced simultaneously. In addition, our research found that NanR acted as a negative regulator for the repression of nagA and nagB expression in B. amyloliquefaciens HZ-12, which positively correlated with the previous result [40]. Moreover, the intracellular 1-DNJ might affect cell metabolism, and no intracellular 1-DNJ was detected by our results, suggested that 1-DNJ could be rapidly transported to extracellular. Unfortunately, there was no report about 1-DNJ transporter, we tried to excavate the suspected transporters surround 1-DNJ synthetase gene cluster in our previous work, but failed, and we will continue to carry out the relevant research on this aspect of work in future research. Taken together, all these researches demonstrated that precise regulation of central carbon metabolism is an effective strategy to achieve efficient synthesis of target products.
Gene cluster is widespread in the metabolitesynthesis, and the existence of which is in favor of genome simplification and genetic manipulation, however, it might also affect gene expression level, especially genes that are supposed to maintain the metabolic balance. Thus, it is necessary to modify the relevant elements to optimize its expression. 5′-UTR affects gene expression via regulating the mRNA translation initiation and secondary stability. Previously, a 5′-UTR library was established in our group [28], which significantly increased the yields of red fluorescence protein, green fluorescence protein, keratinase, bacitracin, etc, however, all these modifications mainly focused on the single gene or gene cluster. Here, our results implied that lower transcriptional levels of downstream genes (yktC1 and gutB1) in 1-DNJ synthetase gene cluster might be the bottleneck for 1-DNJ synthesis, and 5′-UTR replacement significantly improved mRNA secondary stability, which benefited the improvement of target gene expression and 1-DNJ synthesis. This study expands the application field of 5′-UTR, and provided a new strategy for efficient synthesis of metabolites based on streamlined genomes.
5. Conclusions
1-DNJ, an efficient α-glucosidase inhibitory, has broad application prospects in the areas of functional food, biomedicine, etc. 1-DNJ is mostly extracted from mulberry leaves with high cost and low purity, which limited its extension application. Synthetic biology has made the great achievements in the fields of food, agriculture, chemical industry, etc. Here, to improve 1-DNJ production in B. amyloliquefaciens, the modules of glucosetransportation, F-6-P supply, 1-DNJ synthetase cluster were rewired, combining with feed-fermentation in 3 L fermenter, 1-DNJ yield was reached 1632.5 mg/L, increased by 77.62-fold compared to the original strain HZ-12, and which was the highest yield of 1-DNJ synthesis until now. Our results demonstrated that metabolic engineering was an efficient approach for enhanced production of 1-DNJ, and this research provided a promising strain for 1-DNJ industrial production.
Data availability statement
The data used to support the findings of this study are available from the corresponding authors upon request.
CRediT authorship contribution statement
Xujie Li: Methodology, Investigation, Data curation, Software, Writing – original draft. Meng Zhang: Investigation, Data curation, Software. Yu Lu: Methodology, Investigation, Data curation. Ningyang Wu: Investigation. Jian'gang Chen: Methodology, Investigation, Data curation. Zhixia Ji: Writing – review & editing. Yangyang Zhan: Writing – review & editing. Xin Ma: Data curation, Writing – review & editing. Junyong Chen: Data curation, Writing – review & editing. Dongbo Cai: Supervision, Data curation, Writing – review & editing. Shouwen Chen: Supervision, Writing – review & editing.
Declaration of competing interest
Authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Acknowledgments
This work was supported by Key research and development program of Hubei Province (2022BBA0031), the Key Science and Technology Innovation Project of Hubei Province (2021BAD001), Wuhan Science and Technology Project (2020020602012124), and Knowledge Innovation Program of Wuhan-Shuguang Project (2022020801020334).
Footnotes
Peer review under responsibility of KeAi Communications Co., Ltd.
Supplementary data to this article can be found online at https://doi.org/10.1016/j.synbio.2023.05.002.
Contributor Information
Junyong Chen, Email: 437877891@qq.com.
Dongbo Cai, Email: caidongbo@hubu.edu.cn.
Shouwen Chen, Email: chenshouwen@hubu.edu.cn.
Appendix A. Supplementary data
The following is the Supplementary data to this article.
The strains and primers used in this study were provided in Table S1 and Table S2, respectively, and Supporting information is available free of charge on the corresponding website.
References
- 1.Popovic-Djordjevic J.B., Katanic Stankovic J.S., Mihailovic V., Pereira A.G., Garcia-Oliveira P., Prieto M.A., et al. Algae as a source of bioactive compounds to prevent the development of type 2 diabetes mellitus. Curr Med Chem. 2021;28:4592–4615. doi: 10.2174/0929867328666210325100654. [DOI] [PubMed] [Google Scholar]
- 2.Standl E., Schnell O. Alpha-glucosidase inhibitors 2012-cardiovascular considerations and trial evaluation. Diabetes Vasc Dis Res. 2012;9:163–169. doi: 10.1177/1479164112441524. [DOI] [PubMed] [Google Scholar]
- 3.Chiasson J.-L., Josse R.G., Gomis R., Hanefeld M., Karasik A., Laakso M. Acarbose for prevention of type 2 diabetes mellitus: the STOP-NIDDM randomised trial. Lancet. 2002;359:2072–2077. doi: 10.1016/S0140-6736(02)08905-5. [DOI] [PubMed] [Google Scholar]
- 4.Kang K.D., Cho Y.S., Song J.H., Park Y.S., Lee J.Y., Hwang K.Y., et al. Identification of the genes involved in 1-deoxynojirimycin synthesis in Bacillus subtilis MORI 3K-85. J Microbiol. 2011;49:431–440. doi: 10.1007/s12275-011-1238-3. [DOI] [PubMed] [Google Scholar]
- 5.Kong W.H., Oh S.H., Ahn Y.R., Kim K.W., Kim J.H., Seo S.W. Antiobesity effects and improvement of insulin sensitivity by 1-deoxynojirimycin in animal models. J Agric Food Chem. 2008;56:2613–2619. doi: 10.1021/jf073223i. [DOI] [PubMed] [Google Scholar]
- 6.Yoshihiro Kojima T.K., Nakagawa Kiyotaka, Asai Akira, Hasumi Keiji, Oikawa Shinichi, Miyazawa Teruo. Effects of mulberry leaf extract rich in 1-deoxynojirimycin on blood lipid profiles in humans. J Clin Biochem Nutr. 2010;47:155–161. doi: 10.3164/jcbn.10-53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Liu Q., Li X., Li C., Zheng Y., Wang F., Li H., et al. 1-Deoxynojirimycin alleviates liver injury and improves hepatic glucose metabolism in db/db mice. Molecules. 2016;21:279. doi: 10.3390/molecules21030279. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Paek N.S., Kang D.-J., Choi Y.-J., Lee J., Kim T.H., Kim K.W. Articles: production of 1- deoxynojirimycin by Streptomyces sp. SID9135. J Microbiol Biotechnol. 1997;7:262–266. [Google Scholar]
- 9.Onose S., Ikeda R., Nakagawa K., Kimura T., Yamagishi K., Higuchi O., et al. Production of the alpha-glycosidase inhibitor 1-deoxynojirimycin from Bacillus species. Food Chem. 2013;138:516–523. doi: 10.1016/j.foodchem.2012.11.012. [DOI] [PubMed] [Google Scholar]
- 10.Lee H., Jung D.H., Seo D.H., Chung W.H., Seo M.J. Genome analysis of 1-deoxynojirimycin (1-DNJ)-producing Bacillus velezensis K26 and distribution of Bacillus sp. harboring a 1-DNJ biosynthetic gene cluster. Genomics. 2021;113:647–653. doi: 10.1016/j.ygeno.2020.09.061. [DOI] [PubMed] [Google Scholar]
- 11.Clark L.F., Johnson J.V., Horenstein N.A. Identification of a gene cluster that initiates azasugar biosynthesis in Bacillus amyloliquefaciens. Chembiochem. 2011;12:2147–2150. doi: 10.1002/cbic.201100347. [DOI] [PubMed] [Google Scholar]
- 12.Rayamajhi V., Dhakal D., Chaudhary A.K., Sohng J.K. Improved production of 1-deoxynojirymicin in Escherichia coli through metabolic engineering. J Microbiol Biotechnol. 2018;34:77. doi: 10.1007/s11274-018-2462-3. [DOI] [PubMed] [Google Scholar]
- 13.Cai D., Liu M., Wei X., Li X., Wang Q., Nomura C.T., et al. Use of Bacillus amyloliquefaciens HZ-12 for high-level production of the blood glucose lowering compound, 1-deoxynojirimycin (DNJ), and nutraceutical enriched soybeans via fermentation. Appl Biochem Biotechnol. 2017;181:1108–1122. doi: 10.1007/s12010-016-2272-8. [DOI] [PubMed] [Google Scholar]
- 14.Lu Y., Cheng X., Deng H., Chen S., Ji Z. Improvement of 1-deoxynojirimycin production of Bacillus amyloliquefaciens by gene overexpression and medium optimization. LWT. 2021;149 [Google Scholar]
- 15.Ro D.K., Paradise E.M., Ouellet M., Fisher K.J., Newman K.L., Ndungu J.M., et al. Production of the antimalarial drug precursor artemisinic acid in engineered yeast. Nature. 2006;440:940–943. doi: 10.1038/nature04640. [DOI] [PubMed] [Google Scholar]
- 16.Liu Y., Zhu Y., Li J., Shin H.D., Chen R.R., Du G., et al. Modular pathway engineering of Bacillus subtilis for improved N-acetylglucosamine production. Metab Eng. 2014;23:42–52. doi: 10.1016/j.ymben.2014.02.005. [DOI] [PubMed] [Google Scholar]
- 17.Rao Y., Li P., Xie X., Li J., Liao Y., Ma X., et al. Construction and characterization of a gradient strength promoter library for fine-tuned gene expression in Bacillus licheniformis. ACS Synth Biol. 2021;10:2331–2339. doi: 10.1021/acssynbio.1c00242. [DOI] [PubMed] [Google Scholar]
- 18.Rao Y., Cai D., Wang H., Xu Y., Xiong S., Gao L., et al. Construction and application of a dual promoter system for efficient protein production and metabolic pathway enhancement in Bacillus licheniformis. J Biotechnol. 2020;312:1–10. doi: 10.1016/j.jbiotec.2020.02.015. [DOI] [PubMed] [Google Scholar]
- 19.Cai D., Hu S., Chen Y., Liu L., Yang S., Ma X., et al. Enhanced production of poly-gamma-glutamic acid by overexpression of the global anaerobic regulator fnr in Bacillus licheniformis WX-02. Appl Biochem Biotechnol. 2018;185:958–970. doi: 10.1007/s12010-018-2693-7. [DOI] [PubMed] [Google Scholar]
- 20.Zhan Y., Shi J., Xiao Y., Zhou F., Wang H., Xu H., et al. Multilevel metabolic engineering of Bacillus licheniformis for de novo biosynthesis of 2-phenylethanol. Metab Eng. 2022;70:43–54. doi: 10.1016/j.ymben.2022.01.007. [DOI] [PubMed] [Google Scholar]
- 21.Cai D., Chen Y., He P., Wang S., Mo F., Li X., et al. Enhanced production of poly-γ-glutamic acid by improving ATP supply in metabolically engineered Bacillus licheniformis. Biotechnol Bioeng. 2018;115:2541–2553. doi: 10.1002/bit.26774. [DOI] [PubMed] [Google Scholar]
- 22.Wu F., Cai D., Li L., Li Y., Yang H., Li J., et al. Modular metabolic engineering of lysine supply for enhanced production of bacitracin in Bacillus licheniformis. Appl Microbiol Biotechnol. 2019;103:8799–8812. doi: 10.1007/s00253-019-10110-y. [DOI] [PubMed] [Google Scholar]
- 23.Hu S., He P., Zhang Y., Jiang M., Wang Q., Yang S., et al. Transcription factor DegU-mediated multi-pathway regulation on lichenysin biosynthesis in Bacillus licheniformis. Metab Eng. 2022;74:108–120. doi: 10.1016/j.ymben.2022.10.003. [DOI] [PubMed] [Google Scholar]
- 24.Qiu Y., Zhang J., Li L., Wen Z., Nomura C.T., Wu S., et al. Engineering Bacillus licheniformis for the production of meso-2,3-butanediol. Biotechnol Biofuels. 2016;9:117. doi: 10.1186/s13068-016-0522-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Zhang X., Lai L., Xu G., Zhang X., Shi J., Koffas M.A.G., et al. Rewiring the central metabolic pathway for high-yield l-serine production in Corynebacterium glutamicum by using glucose. Biotechnol J. 2019;14 doi: 10.1002/biot.201800497. [DOI] [PubMed] [Google Scholar]
- 26.Keseler I.M., Bonavides-Martínez C., Collado-Vides J., Gama-Castro S., Gunsalus R.P., Johnson D.A., et al. EcoCyc: a comprehensive view of Escherichia coli biology. Nucleic Acids Res. 2009;37:D464–D470. doi: 10.1093/nar/gkn751. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Shi J., Zhan Y., Zhou M., He M., Wang Q., Li X., et al. High-level production of short branched-chain fatty acids from waste materials by genetically modified Bacillus licheniformis. Bioresour Technol. 2019;271:325–331. doi: 10.1016/j.biortech.2018.08.134. [DOI] [PubMed] [Google Scholar]
- 28.Xiao J., Peng B., Su Z., Liu A., Hu Y., Nomura C.T., et al. Facilitating protein expression with portable 5'-UTR secondary structures in Bacillus licheniformis. ACS Synth Biol. 2020;9:1051–1058. doi: 10.1021/acssynbio.9b00355. [DOI] [PubMed] [Google Scholar]
- 29.Post M.J. Cultured beef: medical technology to produce food. J Sci Food Agric. 2014;94:1039–1041. doi: 10.1002/jsfa.6474. [DOI] [PubMed] [Google Scholar]
- 30.Mironczuk A.M., Kosiorowska K.E., Biegalska A., Rakicka-Pustulka M., Szczepanczyk M., Dobrowolski A. Heterologous overexpression of bacterial hemoglobin VHb improves erythritol biosynthesis by yeast Yarrowia lipolytica. Microb Cell Factories. 2019;18:176. doi: 10.1186/s12934-019-1231-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Healey R.D., Lebhar H., Hornung S., Thordarson P., Marquis C.P. An improved process for the production of highly purified recombinant thaumatin tagged-variants. Food Chem. 2017;237:825–832. doi: 10.1016/j.foodchem.2017.06.018. [DOI] [PubMed] [Google Scholar]
- 32.Rakicka M., Wolniak J., Lazar Z., Rymowicz W. Production of high titer of citric acid from inulin. BMC Biotechnol. 2019;19:11. doi: 10.1186/s12896-019-0503-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Gao L., Hu Y., Liu J., Du G., Zhou J., Chen J. Stepwise metabolic engineering of Gluconobacter oxydans WSH-003 for the direct production of 2-keto-L-gulonic acid from D-sorbitol. Metab Eng. 2014;24:30–37. doi: 10.1016/j.ymben.2014.04.003. [DOI] [PubMed] [Google Scholar]
- 34.Katz L., Chen Y.Y., Gonzalez R., Peterson T.C., Zhao H., Baltz R.H. Synthetic biology advances and applications in the biotechnology industry: a perspective. J Ind Microbiol Biotechnol. 2018;45:449–461. doi: 10.1007/s10295-018-2056-y. [DOI] [PubMed] [Google Scholar]
- 35.Lv X., Wu Y., Gong M., Deng J., Gu Y., Liu Y., et al. Synthetic biology for future food: research progress and future directions. Future Foods. 2021;3 [Google Scholar]
- 36.Guo L., Ding S., Liu Y., Gao C., Hu G., Song W., et al. Enhancing tryptophan production by balancing precursors in Escherichia coli. Biotechnol Bioeng. 2022;119:983–993. doi: 10.1002/bit.28019. [DOI] [PubMed] [Google Scholar]
- 37.Westbrook A.W., Ren X., Oh J., Moo-Young M., Chou C.P. Metabolic engineering to enhance heterologous production of hyaluronic acid in Bacillus subtilis. Metab Eng. 2018;47:401–413. doi: 10.1016/j.ymben.2018.04.016. [DOI] [PubMed] [Google Scholar]
- 38.Gu Y., Lv X., Liu Y., Li J., Du G., Chen J., et al. Synthetic redesign of central carbon and redox metabolism for high yield production of N-acetylglucosamine in Bacillus subtilis. Metab Eng. 2019;51:59–69. doi: 10.1016/j.ymben.2018.10.002. [DOI] [PubMed] [Google Scholar]
- 39.Li Z., Gao C., Ye C., Guo L., Liu J., Chen X., et al. Systems engineering of Escherichia coli for high-level shikimate production. Metab Eng. 2022;75:1–11. doi: 10.1016/j.ymben.2022.10.010. [DOI] [PubMed] [Google Scholar]
- 40.Horne C.R., Venugopal H., Panjikar S., Wood D.M., Henrickson A., Brookes E., et al. Mechanism of NanR gene repression and allosteric induction of bacterial sialic acid metabolism. Nat Commun. 2021;12:1988. doi: 10.1038/s41467-021-22253-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
The strains and primers used in this study were provided in Table S1 and Table S2, respectively, and Supporting information is available free of charge on the corresponding website.
Data Availability Statement
The data used to support the findings of this study are available from the corresponding authors upon request.






