Skip to main content
NCBI home page
Food Science & Nutrition logoLink to Food Science & Nutrition
. 2023 Jun 27;11(9):5296–5303. doi: 10.1002/fsn3.3488

Isolation and identification of endophytic actinobacteria from Iris persica and Echium amoenum plants and investigation of their effects on germination and growth of wheat plant

Hakimeh Oloumi 1,✉, Moj Khaleghi 2, Ava Dalvand 2
PMCID: PMC10494643  PMID: 37701213

Abstract

Plant biotechnology helps to develop different types of new products with increased resistance to disease, greater tolerance to drought and salt stress, and better nutritional value. The interaction of plants and microorganisms will play a significant role to achieve this purpose. The aims of this study were to isolate endophyte Actinobacteria strains of some medicinal plants and the investigation of their bioactive potential. 15 Actinobacteria strains were selectively isolated from Persian iris and Echium amoenum plants, and then their belonging to Actinobacteria phylum was confirmed using an Actinobacteria‐specific primer pair. The antioxidant activity of the crude extract obtained from the isolated strains was investigated based on DPPH method. Investigating the antioxidant activity of the crude extract showed that at a concentration of 100 μg/mL, the two strains EG1 and EG2 had 71% and 78% antioxidant activity, respectively. According to the phylogeny studies, it was determined that two strains belonged to the Streptomyces genus. The effect of supernatant achieved from selected endophytic strain on 35‐day wheat plants showed that the supernatant considerably promotes root and shoot growth and chlorophyll content under salinity stress (150 mM NaCl). In general, it can be concluded strains that live symbiotically with medicinal plants are rich sources of bioactive compounds. Therefore, identification of the bioactive compounds in the extract of isolated Actinobacteria from medicinal plants and further studies on their metabolism are suggested.

Keywords: antioxidant activity, Endophytic Actinobacteria , salinity stress, Streptomyces, wheat plant

Actinobacteria strains were selectively isolated from Persian iris and Echium amoenum plants, and then their belonging to Actinobacteria phylum was confirmed using an Actinobacteria‐specific primer pair. The effect of supernatant achieved from selected endophytic strain on 35‐day wheat plants showed that the supernatant considerably promotes root and shoot growth and chlorophyll content under salinity stress (150 mM NaCl).

graphic file with name FSN3-11-5296-g001.jpg

1. INTRODUCTION

During their growth, plants are constantly in contact with soil microorganisms, and in the meantime, some microorganisms create a symbiotic relationship with plants, plant–microorganism interaction have some beneficial effects such as accelerating plant growth (Ghodhbane‐Gtari et al., 2019). However, endophytic microorganisms living in plant tissues such as branches, leaves, roots, stems, and bark of plants have received much attention in recent years due to the wide range of secondary metabolites they produce (Zheng et al., 2016). Endophytes are microorganisms in plants that coexist with plants without harming them. Among all the symbiotic microorganisms, Actinobacteria have a great contribution in this interaction, Actinobacteria is one of the important groups of bacteria known as plant growth‐promoting bacteria (PGPB) due to their high distribution in the soil (108–109 per g) (Hamedi & Mohammadipanah, 2015). These bacteria are an important part of the soil microbial community and their uniqueness as producers of bioactive compounds has been well defined in the past years. The study of endophytic Actinobacteria leads to the isolation of new bioactive compounds having therapeutic, agricultural, and industrial properties (Nafis, Elhidar, et al., 2018; Nalini & Prakash, 2017).

Biological interactions between plants and endophytic microorganisms may cause reduced amounts of biological stressors. In fact, metabolic studies have shown that endophytic microorganisms play a role in strengthening and growing plants by stimulating the production of plant hormones such as auxins and gibberellins, or as plant protection agents against microbial pathogens and insects (Ek‐Ramos et al., 2019; Oubaha et al., 2019). In a research conducted in 2014, it was observed that the overexpression of malic acid‐producing genes in the endophytic bacterial strains increased the release of phosphate in the soil, and as a result led to higher number of lateral branches with higher length of the stem and roots in wheat plants (Jog et al., 2014). In the research of Yandigeri et al., 2012 46 endophyte Actinobacteria strains were isolated from the roots of drought‐resistant plants. Their results also showed that these bacterial strains had the ability to increase plant growth and increase drought tolerance. In molecular identification, the top three strains were confirmed as Streptomyces sp (Yandigeri et al., 2012).

In recent years, the attention of researchers has been drawn to endophytic microorganisms as producers of bioactive compounds useful for various industries, manifesting the importance of this group of microorganisms. Almost all plant species can be resources of endophytic microorganisms and are considered as promising sources of new biological compounds. Persian iris (Iris persica) and Echium Amoenum were selected in this study to isolate their endophytic Actinobacteria strains. In this project, the standard DPPH assay was used to determine antioxidant activity of isolated Actinobacteria extracts. The role of endophytic bacteria extract was studied on plants under salinity stress. For this purpose, effects of the bioactive compounds extracted from selected endophyte strains were studied on the root and shoot growth, total chlorophyll amounts and relative water content of wheat seedlings under salinity stress.

2. MATERIALS AND METHODS

2.1. Collection of plant samples

Plant parts of two medicinal plants iris (Iris persica) and Echium amoenum, were collected from Jiroft city, Kerman province (57 49 14/591E, 28 53 51/735 N) (57 28 26/168E, 29 11 21/098 N). In order to isolate endophytic Actinobacteria plant samples stored in sterile containers and transported to the laboratory as soon as possible. The isolation of strains was done from the roots, stems and leaves of the plants. For this purpose, different plant organs including leaves, shoots and roots were sterilized with 70% ethanol for 5 min and 3% sodium hypochlorite solution for 20 min. Samples were then washed with sterile distilled water for three times, and from washing water transferred to the NA (Nutrient agar: Peptone 5 g/L, Meat extract 3 g/L, Agar 15 g/L) culture medium to ensure the absence of microbial and fungal contaminations (Verma et al., 2009).

2.2. Selective isolation of endophytic Actinobacteria

The specific growth media of Actinobacteria, including ISP2 (yeast extract 4 g/L, malt extract 10 g/L, dextrose 4 g/L, distilled water 1L), ISP4 (soluble starch 10 g/L, MgSO4 7H2O 1 g/L, NaCl 1 g/L, (NH4)2SO4 2 g/L, CaCO3 2 g/L, trace salt solution 1 mL, distilled water 1 L), AIA (actinomycete isolation agar: sodium caseinate 2 g/L, L‐asparagine 0.1 g/L, sodium propionate 4 g/L, dipotassium phosphate 0.5 g/L, magnesium sulphate 0.1 g/L, ferrous sulphate 0.001 g/L, agar 15 g/L, distilled water 1L), gauze (Soluble Starch 20 g/L, KNO3 1 g/L, NaCl 0.5 g/L, MgSO4 7H2O 0.5 g/L, K2HPO4 0.5 g/L, FeSO4 7H2O 0.01 g/L, distilled water 1L), ISP3 (Oatmeal 20 g/L, trace salt solution 1 mL, distilled water 1L), SCA (starch casein Agar: soluble starch 10 g/L, casein 0.3 g/L, KNO3 2 g/L, MgSO4.7H2O 0.05 g/L, K2HPO4 2 g/L, NaCl 2 g/L, CaCO3 0.02 g/L, FeSO4 7H2O 0.01 g/L, distilled water 1 L), containing nalidixic acid (10 μg/mL) and nystatin (50 μg/mL) were used to isolate Actinobacteria endophyte strains from plant tissues. Isolated Actinobacteria incubated for 21 days at 30°C. After the incubation period, colonies with chalky and powdery morphology were isolated and purified stored in 20% glycerol at −20°C for further studies (Ranjan & Jadeja, 2017). Visual observations of morphological and microscopic features were also performed using a stereomicroscope light microscope and gram staining.

2.3. DNA extraction and molecular identification

To determine the phylogenetic characteristics, the genomic DNA of strains was extracted using the Bacterial DNA isolation kit (DENA Zist). Polymerase chain reaction (PCR) for the 16SrRNA gene was performed from the DNA samples extracted as follows: initial denaturation for 5 min at 95°C, denaturation at 94°C with 35 cycles for 1 min, annealing at 56°C for 1.5 min, extension at 72°C for 2 min, and final extension for 10 min at 72°C (Musa et al., 2020).

The belonging of the strains to Actinobacteria phylum was validated with the help of Actinobacteria specific primer pair S‐C‐Act‐235 (5’‐CGCGGCCTATCAGCTTGTTG‐3′), S‐C‐Act‐878 (5′‐ CCGTACTCCCCAGGCGGGG −3′). The universal primer pair 27F (5’ AGAGTTTGATCCTGGCTCAG‐3′) and 1492 R (5’‐GGTTACCTTGTTACGACTT‐3′) was used as a template for sequencing. The PCR products were purified using a PCR kit (Thermo Scientific) and sequenced by Macrogen (South Korea).

The similarity of the studied strains was checked using BLAST analysis (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Alignment and drawing of phylogenic tree were done by MEGA X software and Bootstrap analysis with 1000 repetitions (Kumar et al., 2018).

2.4. Fermentation and extraction

Actinobacteria strains were incubated in 200 mL Gauze medium (soluble starch 20 g/L, KNO3 1 g/L, NaCl 0.5 g/L, MgSO4 7 H2O 0.5 g/L, K2HPO4 0.5 g/L, FeSO4 7 H2O 0.01 g/L, distilled water 1 L), for 7 days at 30°C and 140 rpm. Then, microbial suspension was centrifuged at 11,000 g and 4°C for 30 min, and the obtained supernatant was sterilized using a 22‐μm filter. The sterile supernatant was mixed with the organic solvent ethyl acetate (Merck) (1:1 (v/v)) and the organic phase was separated after 24 h, (Mohammadi et al., 2022). The obtained extract was dried and stored at −20°C.

2.5. Antioxidant assay

The free radical inhibition activity was measured using the DPPH (Sigma‐Aldrich) (1,1‐diphenyl‐2‐picrylhydrazyl) method, as a standard method for determining antioxidant power of extract. 100 μL of 0.1% DPPH solution was added to 100 μL of different concentrations (100, 80, 60, 40, 20, 10 μg/mL) of microbial extracts in a 96‐well microtiter plate. The plates were incubated at room temperature for 30 minutes in the dark, and the optical density was measured using a spectrophotometer at 515 nm (Dahal et al., 2020). The absorbance of the DPPH was noted as control (no extract/standard) and ascorbic acid was used as a positive control. The inhibition percentage was calculated using the following equation where 𝐴 defines absorbance of DPPH in control and 𝐵 is sample absorbance.

Inhibitory Activity%=[(34𝐴−34𝐴𝐵)/34𝐴𝐵𝐴]×100

2.6. Endophytic supernatant treatment on wheat seedlings

In order to investigate the effect of microbial supernatant on plant growth, 25‐day‐old plants were used. Wheat seeds (Triticum sativum Amir) obtained from the Agricultural Research Center; Kerman, Iran, were cultivated in pots containing acid‐washed sandy soil under greenhouse conditions in a completely randomized design. One week after germination, the seedlings were irrigated with complete Hoagland’ nutrient solution. In the third week of seedling growth, the pots were divided into two groups of control and saline groups. On the control group, irrigation was done every other day with nutrient solution and on the salinity stressed group, irrigation was done with nutrient solution containing 150 mM sodium chloride. One week later, each group was again divided into two groups of supernatant or water spray group. Plants in these group were sprayed with the microbial supernatant or sterilized distilled water, every 2 days in between. The supernatant was obtained from isolated EG2 Actinobacteria strains with the highest antioxidant activity among all isolated strains. The supernatant or water was sprayed on seedling shoots until the liquid began to drip off from the leaves. After 10 days from the start of supernatant treatment, the plants were harvested to measure roots and shoots length. The extended leaf of each plant was used to measure relative water content and total chlorophyll. The total chlorophyll content was measured using a portable chlorophyll meter and the leaf water content was measured based on method Mullan and Pietragalla (2012) (Mullan & Pietragalla, 2012). To measure RWC, leaf fresh weight, turgid weight (held 5 hours in deionized water), and the leaf dry weight (72 h at 70°C) were recorded for the extended leaf of harvested seedlings. Relative water content was calculated using following equation:

Fresh Weight−DryWeightTorgor weight−Dryweight×100

2.7. Statistical analysis

All experiments were performed with three replications. The results were analyzed using SPSS 21 software and one way ANOVA. To compare means of groups, Duncan’ test was carried out with p value ≥.05.

3. RESULTS

3.1. Isolation and identification of Actinobacteria

In this research, Actinobacteria strains were isolated from Persian iris and borage. Totally, 15 strains of Actinobacteria were isolated based on colony morphology. Powdery and cottony colonies were selected (Figure 1a) and Gram's method staining was done for Actinobacteria identification. The staining results confirmed the presence of Gram‐positive filamentous bacteria (Figure 1b). Two Actinobacteria‐specific primes including S‐C‐Act‐235(5’‐CGCGGCCTATCAGCTTGTTG‐3′), and S‐C‐Act‐878(5’‐CCGTACTCCCCAGGCGGGG‐3′), were used for PCR analysis. Results showed the presence of a 600‐bp single band (Figure 2) which confirms that the isolates belonged to Actinobacteria phylum. Based on these results, 9 strains among 15 isolated strains belonged to E. amoenum plants (7 strains from the root and 2 strains from the leaves), and 6 of them have been extracted from Persian Iris (3 strains from the root, 2 strains from the leaves, and 1 strain from the stem). In Table 1 shows the characteristics of the colony morphology of the isolates are given.

FIGURE 1.

FIGURE 1

Open in a new tab

EG2 strain isolated from Echium amoenum roots. Morphology of colony (a), morphology of bacteria (b).

FIGURE 2.

FIGURE 2

Open in a new tab

Image of 600‐bp band of Actinobacteria phylum‐specific primer.

TABLE 1.

Colony morphology of endophyte strains isolated from Echium amoenum and Iris persica plants.

Strain Aerial mycelium color Substrate mycelium color Pigment color Plant Organ
EG1 Gray White Brown E. amoenum Root
EG2 White White Purple E. amoenum Root
EG3 White White Yellow E. amoenum Root
EG4 Red‐Black Yellow Black E. amoenum Leaf
EG5 White White – E. amoenum Root
EG6 White‐Yellow White – E. amoenum Root
EG7 White White White‐yellow E. amoenum Root
EG8 Green‐Gray Brown Green‐black E. amoenum Leaf
EG9 White‐Gray Yellow Gray I. persica Root
EG10 White Brown – I. persica Stem
EG11 White Gray Green I. persica Root
EG12 Gray Brown Brown I. persica Root
EG13 Gray White Brown I. persica Leaf
EG14 White White Creamy I. persica Leaf
EG15 White Colorless Creamy I. persica Root
Open in a new tab

3.2. Antioxidant assay

All 15 strains were investigated for their antioxidant activity based on DPPH method. Our results showed that strains EG1 and EG2 isolated from E. amoenum root plant had the highest antioxidant activity (Figure 3). According to the obtained results, the EG2 strain at a concentration of 100 μg/mL has 78% antioxidant activity and the EG1 strain at the same concentration has 71% antioxidant effect, since ascorbic acid (Sigma‐Aldrich) as a control had 91% antioxidant activity at 100 μg/mL. Results also showed that the antioxidant activity of both strains was dose‐dependent and it promoted with increasing concentration (Figure 3).

FIGURE 3.

FIGURE 3

Open in a new tab

Antioxidant effects of Actinobacteria strains based on DPPH method, (a) the antioxidant activity of different concentrations of EG1 strain extracts and (b) EG2 strain.

3.3. Identification of EG1, EG2 strains

Based on the sequence analysis of 16S rRNA, the top two strains of this study were belonged to the genus Streptomyces. According to the results, strain EG1 with more than 99% similarity was identified as Streptomyces umbrinus strain NBRC 15410 and strain EG2 with more than 99% similarity as Streptomyces carpaticus strain NBRC 15390 (Figure 4).

FIGURE 4.

FIGURE 4

Open in a new tab

The neighbor‐joining tree based on the 16S rRNA sequences of selected strains shows the relationship between EG1, EG2 strain, and other related taxa. The numbers at the nodes indicate the levels of bootstrap support based on 1000 resampled data sets. Nocardia aobensis NBRC 100429 strain IFM 0372 (NR 040995.1) was used as an out‐group.

3.4. The supernatant effects on growth and physiological parameters of wheat seedlings

In this study, the effect of microbial supernatant from EG2 strains was investigated on wheat plants under salinity stress. Our results showed that the foliar spray of supernatant improved the growth and physiological parameters of wheat seedlings under both salt stress and nonstress conditions (Figure 5).

FIGURE 5.

FIGURE 5

Open in a new tab

The effect of EG2 supernatant on wheat plants under NaCl (150 mM) stress. (a) Plant length, (b) relative water content (RWC), (c) chlorophyll content. Columns with the same letters do not show significant differences based on Duncan's test (p ≤ .05).

Based on the morphological analysis, our results showed that the longitudinal growth of roots and shoots were significantly (p < .05) increased in supernatant treated wheat plants grown under natural and salinity conditions (Figure 5a). The results also showed that the relative water content of leaves was improved by up to 20% in plants under salt stress treated with the Actinobacteria supernatant comparing to salt‐stressed seedlings (Figure 5b). Under salinity stress, total chlorophyll content increased by 15% in supernatant treated seedlings, but supernatant had no significant effect on chlorophyll content of plants grown under control condition (no salinity, Figure 5c).

4. DISCUSSION

Endophytic Actinobacteria has been shown as potentially rich sources of metabolites which give them ability of promoting the growth of their host plant. These metabolites also lead to the improvement of the disease symptoms caused by plant pathogens or various environmental stresses (Golinska et al., 2015).

In this study, we investigated the ability of endophytic Actinobacteria isolated from two medicinal plants collected from their natural habitants in south of Iran. Different parts of E. amoenum and iris plants were gathered and transported into laboratory for further studies and isolation of their Actinobacteria strains. Actinobacteria‐specific culture media such as ISP2, ISP3, ISP4, Gauze, SCA, AIA, were used for isolation of Actinobacteria strains. Colonies of Actinobacteria appeared on the agar surface after 2 weeks. Among all colonies, 15 powdery and dried colonies were isolated and purified as Actinobacteria strains.

The antioxidative activities of identified strains were also investigated. Among 15 investigated strains, two strains showed the best results, as EG1 and EG2 at 100 μg/mL, inhibited more than 70% of free radicals, which according to previous researches on Actinobacteria isolates from various sources is a desirable result (Janardhan et al., 2014). In research conducted by Siddharth & Vittal, 2018, the studied Actinobacteria strain was able to inhibit 56% of free radicals at a concentration of 1 mg/mL. As it was observed from our results, the strains EG1 and EG2 in this study at 0.1 mg/mL, showed more than 70% inhibitory effects on DPPH radicals, which is significantly high compared to previous studies (Siddharth & Vittal, 2018). We also observed that the antioxidant power of the Actinobacteria strains reinforce with increasing the supernatant concentration. The obtained results from (Karthik et al., 2013) research also confirm the dose‐dependent antioxidative effects of Actinobacteria. Results from 16S rRNA analysis showed that selected strains EG1 and EG2 were belonging to Streptomyces species. Studies have shown that Streptomyces species of Actinobacteria phylum as endophytes, are able to communicate with various types of plants (Verma et al., 2009), In the study of Nafis et al., the NAF‐1 strain isolated from medicinal plant Aloe vera, having various biological properties and antioxidant activity, was identified as a strain of the genus Streptomyces (Nafis et al., 2018b).

Streptomyces species are known as important bacterial source of secondary metabolites (Takahashi & Nakashima, 2018), therefore, their performance as the superior strains of this study, especially the EG1 strain, was not far from expectation. Similar to the results of present study, Nafis et al., reported that the strain AS25 isolated from the rhizosphere soil of Alyssum spinosum belonging to the genus Streptomyces, is a producer of some important bioactive compounds (Nafis, Oubaha, et al., 2018). Many researchers recommend the application of Actinobacteria as effective and stimulator factor in plant growth promotion. These studies show that plant growth‐stimulating microorganisms are rich sources of valuable secondary metabolites which can be used in sustainable agriculture (Pellegrini et al., 2020).

Our results showed that the supernatant obtained from EG2 Actinobacteria strain would improve wheat plant growth under normal and stress conditions. Therefore, significant improvement of wheat plants growth under normal and stress conditions by Actinobacteria supernatant can be associated to the nutritional enrichment of supernatant which is absorbed by plant leaf surface.

Salt stress cause a wide range of damaging symptoms on plants, such as inhibition of shoot and root growth, imbalance of ion homeostasis, and metabolic changes (carbon and metabolism, photosynthetic pigments disruption induction of oxidative stress) (Xu et al., 2016). Salinity condition considerably reduced wheat plant growth, relative water content, and total chlorophyll content of leaves. In this project, however, the improved growth of wheat plant after supernatant treatment was accompanied with higher chlorophyll content and relative water content in salt‐stressed plants. Similar to our results, Zahra et al. (2020) reported growth retardation of sunflower plants under salinity. In their experiments using endophytic Actinobacteria of a halophytic desert plant, Pteropyrum olivieri, they show that endophytic Actinobacteria improve growth of sunflower plants through modulation of protein and chlorophyll content (Zahra et al., 2020). Passari et al also reported that tomato plants inoculated with Streptomyces thermocarboxydus strain BPSAC147 show disease resistance and improved growth through the positive effect on the electron transport rate (ETR) of PSII, and the process of photosynthesis, and enhanced chlorophyll fluorescence achieved after inoculation (Passari et al., 2019). However, there is lack of information about the mode of action of endophytic Actinobacteria on chlorophyll content in plants. It seems that Actinobacteria having antioxidative properties protect chlorophyll against degradation in salt stress conditions.

Plants’ tolerance to salt stress is also associated with the modulation of antioxidant enzymes. Antioxidant defense systems are involved in the removal of ROS either by antioxidant enzyme activities or production of antioxidant compounds such as glutathione and ascorbic acid (Rouhier et al., 2008). In barley plants, it was reported by Sarma et al. (2011) that Piriformospora indica, an endophytic bacteria induces salt tolerance by increasing the levels of antioxidants (Sarma et al., 2011). As we observed in this project, the EG2 strain extract has a powerful antioxidant capacity, based on DPPH method. Therefore, plant growth improvement in salt‐stressed wheat plants treated by EG2 supernatant may be attributed to its antioxidant compounds.

The present study suggests that the endophytic Actinobacteria isolated from E. amoenum plants can be used as an agent to control salinity stress in T. sativum plants, for their high antioxidant capacity. However, more complementary researches are still needed about their gene expression and physiological and biochemical impacts of Actinobacteria on plants under stress.

AUTHOR CONTRIBUTIONS

Hakimeh Oloumi: Conceptualization (equal); formal analysis (equal); funding acquisition (equal); investigation (equal); methodology (equal); project administration (equal); supervision (equal); validation (equal); visualization (equal); writing – original draft (equal); writing – review and editing (equal). Moj Khaleghi: Methodology (equal); resources (equal); software (equal); validation (equal); visualization (equal); writing – original draft (equal). Ava Dalvand: Formal analysis (equal); investigation (equal); software (equal); writing – original draft (equal).

CONFLICT OF INTEREST STATEMENT

All authors declared that they have no conflict of interest.

ACKNOWLEDGMENTS

Authors wish to thanks Institute of Science and High Technology and Environmental Sciences, Graduate University of Advanced Technology, for supporting the funds through contract number: 00/507.

Oloumi, H. , Khaleghi, M. , & Dalvand, A. (2023). Isolation and identification of endophytic actinobacteria from Iris persica and Echium amoenum plants and investigation of their effects on germination and growth of wheat plant. Food Science & Nutrition, 11, 5296–5303. 10.1002/fsn3.3488

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Dahal, R. H. , Nguyen, T. M. , Shim, D. S. , Kim, J. Y. , Lee, J. , & Kim, J. (2020). Development of multifunctional cosmetic cream using bioactive materials from Streptomyces sp. T65 with synthesized mesoporous silica particles SBA‐15. Antioxidants, 9, 278–302. 10.3390/antiox9040278 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ek‐Ramos, M. J. , Gomez‐Flores, R. , Orozco‐Flores, A. A. , Rodríguez‐Padilla, C. , González‐Ochoa, G. , & Tamez‐Guerra, P. (2019). Bioactive products from plant‐endophytic gram‐positive bacteria. Frontiers in Microbiology, 10, 463–475. 10.3389/fmicb.2019.00463 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ghodhbane‐Gtari, F. , Nouioui, I. , Hezbri, K. , Lundstedt, E. , D'angelo, T. , McNutt, Z. , Laplaze, L. , Gherbi, H. , Vaissayre, V. , & Svistoonoff, S. (2019). The plant‐growth‐promoting actinobacteria of the genus Nocardia induces root nodule formation in Casuarina glauca. Antonie Van Leeuwenhoek, 112, 75–90. 10.1007/s10482-018-1147-0 [DOI] [PubMed] [Google Scholar]
  4. Golinska, P. , Wypij, M. , Agarkar, G. , Rathod, D. , Dahm, H. , & Rai, M. (2015). Endophytic actinobacteria of medicinal plants: Diversity and bioactivity. Antonie Van Leeuwenhoek, 108, 267–289. 10.1007/s10482-015-0502-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hamedi, J. , & Mohammadipanah, F. (2015). Biotechnological application and taxonomical distribution of plant growth promoting actinobacteria. Journal of Industrial Microbiology and Biotechnology, 42, 157–171. 10.1007/s10295-014-1537-x [DOI] [PubMed] [Google Scholar]
  6. Janardhan, A. , Kumar, A. P. , Buddolla Viswanath, D. V. R. S. , & Narasimha, G. (2014). Production of bioactive compounds by actinomycetes and their antioxidant properties. Biotechnology Research International, 2014, 1–8. 10.1155/2014/217030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Jog, R. , Maharshi Pandya, G. N. , & Rajkumar, S. (2014). Mechanism of phosphate solubilization and antifungal activity of Streptomyces spp. isolated from wheat roots and rhizosphere and their application in improving plant growth. Microbiology, 160, 778–788. 10.1099/mic.0.074146-0 [DOI] [PubMed] [Google Scholar]
  8. Karthik, L. , Kumar, G. , & Rao, K. V. B. (2013). Antioxidant activity of newly discovered lineage of marine actinobacteria. Asian Pacific Journal of Tropical Medicine, 6, 325–332. 10.1016/S1995-7645(13)60065-6 [DOI] [PubMed] [Google Scholar]
  9. Kumar, S. , Stecher, G. , Li, M. , Knyaz, C. , & Tamura, K. (2018). MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35, 1547–1549. 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Mohammadi, M. , Khaleghi, M. , Shakeri, S. , Hesni, M. A. , Samandari‐Bahraseman, M. R. , & Dalvand, A. (2022). Isolation of Actinobacteria strains from environmental samples and assessment of their bioactivity. Avicenna Journal of Clinical Microbiology and Infection, 9, 8–15. 10.34172/ajcmi.2022.02 [DOI] [Google Scholar]
  11. Mullan, D. , & Pietragalla, J. (2012). Leaf relative water content. In Physiological breeding II: A field guide to wheat phenotyping. Cimmyt;  (pp. 25–27). [Google Scholar]
  12. Musa, Z. , Ma, J. , Egamberdieva, D. , Mohamad, O. A. A. , Abaydulla, G. , Liu, Y. , Li, W.‐J. , & Li, L. (2020). Diversity and antimicrobial potential of cultivable endophytic actinobacteria associated with the medicinal plant thymus roseus. Frontiers in Microbiology, 11, 191–209. 10.3389/fmicb.2020.00191 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Nafis, A. , Elhidar, N. , Oubaha, B. , Samri, S. E. , Niedermeyer, T. , Ouhdouch, Y. , Hassani, L. , & Barakate, M. (2018). Screening for non‐polyenic antifungal produced by actinobacteria from Moroccan habitats: Assessment of antimycin A19 production by Streptomyces albidoflavus AS25. International Journal of Molecular and Cellular Medicine, 7(2), 133–145. 10.22088/IJMCM.BUMS.7.2.133 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Nafis, A. , Kasrati, A. , Azmani, A. , Ouhdouch, Y. , & Hassani, L. (2018). Endophytic actinobacteria of medicinal plant Aloe vera: Isolation, antimicrobial, antioxidant, cytotoxicity assays and taxonomic study. Asian Pacific Journal of Tropical Biomedicine, 8(10), 513. 10.4103/2221-1691.244160 [DOI] [Google Scholar]
  15. Nafis, A. , Oubaha, B. , Elhidar, N. , Ortlieb, N. , Kulik, A. , Niedermeyer, T. , Hassani, L. , & Barakate, M. (2018). Novel production of two new nonpolyenic antifungal macrolide derivatives by Streptomyces Z26 isolated from moroccan Rhizospheric soil. Journal of Biological Sciences, 18, 176–185. 10.3844/ojbsci.2018.176.185 [DOI] [Google Scholar]
  16. Nalini, M. S. , & Prakash, H. S. (2017). Diversity and bioprospecting of actinomycete endophytes from the medicinal plants. Letters in Applied Microbiology, 64, 261–270. 10.1111/lam.12718 [DOI] [PubMed] [Google Scholar]
  17. Oubaha, B. , Nafis, A. , Baz, M. , Mauch, F. , & Barakate, M. (2019). The potential of antagonistic moroccan Streptomyces isolates for the biological control of damping‐off disease of pea (Pisum sativum L.) caused by Aphanomyces euteiches. Journal of Phytopathology, 167(2), 82–90. 10.1111/jph.12775 [DOI] [Google Scholar]
  18. Passari, A. K. , Upadhyaya, K. , Singh, G. , Abdel‐Azeem, A. M. , Thankappan, S. , Uthandi, S. , Hashem, A. , Fathi Abd_Allah, E. , Malik, J. A. , & As, A. (2019). Enhancement of disease resistance, growth potential, and photosynthesis in tomato (Solanum lycopersicum) by inoculation with an endophytic actinobacterium, Streptomyces thermocarboxydus strain BPSAC147. PLoS One, 14, e0219014. 10.1371/journal.pone.0219014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Pellegrini, M. , Pagnani, G. , Bernardi, M. , Mattedi, A. , Spera, D. M. , & Gallo, M. D. (2020). Cell‐free supernatants of plant growth‐promoting bacteria: A review of their use as biostimulant and microbial biocontrol agents in sustainable agriculture. Sustainability, 12, 9917–9939. 10.3390/su12239917 [DOI] [Google Scholar]
  20. Ranjan, R. , & Jadeja, V. (2017). Isolation, characterization and chromatography based purification of antibacterial compound isolated from rare endophytic actinomycetes Micrococcus yunnanensis. Journal of Pharmaceutical Analysis, 7, 343–347. 10.1016/j.jpha.2017.05.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Rouhier, N. , Koh, C. S. , Gelhaye, E. , Corbier, C. , Favier, F. , Didierjean, C. , & Jacquot, J.‐P. (2008). Redox based anti‐oxidant systems in plants: Biochemical and structural analyses. Biochimica et Biophysica Acta (BBA) – General Subjects, 1780, 1249–1260. 10.1016/j.bbagen.2007.12.007 [DOI] [PubMed] [Google Scholar]
  22. Sarma, M. V. R. K. , Kumar, V. , Saharan, K. , Srivastava, R. , Sharma, A. K. , Prakash, A. , Sahai, V. , & Bisaria, V. S. (2011). Application of inorganic carrier‐based formulations of fluorescent pseudomonads and Piriformospora indica on tomato plants and evaluation of their efficacy. Journal of Applied Microbiology, 111, 456–466. 10.1111/j.1365-2672.2011.05062.x [DOI] [PubMed] [Google Scholar]
  23. Siddharth, S. , & Vittal, R. R. (2018). Evaluation of antimicrobial, enzyme inhibitory, antioxidant and cytotoxic activities of partially purified volatile metabolites of marine Streptomyces sp S2A. Microorganisms, 6, 72–85. 10.3390/microorganisms6030072 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Takahashi, Y. , & Nakashima, T. (2018). Actinomycetes, an inexhaustible source of naturally occurring antibiotics. Antibiotics, 7, 45–62.  10.3390/antibiotics7020045 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Verma, V. C. , Gond, S. K. , Kumar, A. , Mishra, A. , Kharwar, R. N. , & Gange, A. C. (2009). Endophytic actinomycetes from Azadirachta indica a. Juss: Isolation, diversity, and anti‐microbial activity. Microbial Ecology, 57, 749–756. 10.1007/s00248-008-9450-3 [DOI] [PubMed] [Google Scholar]
  26. Xu, Z. , Jiang, Y. , Jia, B. , & Zhou, G. (2016). Elevated‐CO2 response of stomata and its dependence on environmental factors. Frontiers in Plant Science, 7, 1–15. 10.3389/fpls.2016.00657 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Yandigeri, M. S. , Meena, K. K. , Singh, D. , Malviya, N. , Singh, D. P. , Solanki, M. K. , Yadav, A. K. , & Arora, D. K. (2012). Drought‐tolerant endophytic actinobacteria promote growth of wheat (Triticum aestivum) under water stress conditions. Plant Growth Regulation, 68, 411–420. 10.1007/s10725-012-9730-2 [DOI] [Google Scholar]
  28. Zahra, T. , Hamedi, J. , & Mahdigholi, K. (2020). 'Endophytic actinobacteria of a halophytic desert plant Pteropyrum olivieri: Promising growth enhancers of sunflower', 3 . Biotech, 10, 1–13. 10.1007/s13205-020-02507-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Zheng, L. P. , Zou, T. , Ma, Y. J. , Wang, J. W. , & Zhang, Y. Q. (2016). Antioxidant and DNA damage protecting activity of exopolysaccharides from the endophytic bacterium Bacillus cereus SZ1. Molecules, 21, 174. 10.3390/molecules21020174 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Food Science & Nutrition are provided here courtesy of Wiley

RESOURCES