Abstract
Background
Methylenetetrahydrofolate reductase (MTHFR) is an important enzyme involved in folate and homocysteine metabolism, which are necessary for DNA methylation and nucleotide synthesis. Genetic polymorphisms that reduce MTHFR activity have been linked to several diseases, including prostate cancer. In this study, we aimed to investigate whether MTHFR polymorphisms, along with serum levels of folate, vitamin B12, and homocysteine, are associated with prostate cancer risk in the Algerian population.
Methods
A total of 106 Algerian men with newly diagnosed prostate cancer and 125 healthy controls were included in this case‐control study. The MTHFR C677T and A1298C polymorphisms were analyzed using PCR/RFLP and Real‐Time PCR TaqMan® assays, respectively. Serum levels of folate, total homocysteine, and vitamin B12 were measured using an automatic biochemistry analyzer.
Results
We found no significant differences in the genotype frequency of A1298C and C677T between prostate cancer patients and controls. Moreover, serum levels of folate, total homocysteine, and vitamin B12 were not significantly associated with prostate cancer risk (p > 0.05). However, age and family history were identified as significant risk factors (OR = 1.178, p = 0.00 and OR = 10.03, p = 0.007, respectively).
Conclusion
Our study suggests that MTHFR C677T and A1298C, as well as serum levels of folate, total homocysteine, and vitamin B12, are not associated with prostate cancer risk in the Algerian population. However, age and family history are significant risk factors. Further studies with a larger sample size are required to confirm these findings.
Keywords: folate, genetic polymorphism, homocysteine, methylenetetrahydrofolatereductase, prostate cancer, vitamin B12
The objective of this study was to evaluate an eventual association between MTHFR polymorphisms and prostate cancer within an Algerian population, taking into consideration serum levels of folate, vitamin B12, and homocysteine and some environmental factors. Our results suggest that MTHFR C677T and A1298C as folate, total homocysteine, and vitamin B12 do not contribute to the risk of prostate cancer. Similarly for tobacco.
1. INTRODUCTION
Prostate cancer (PCa) is one of the most important diagnosed neoplasm and is the fifth cause of cancer‐related death in men around the world. According to GLOBOCAN 2020 database, 1.4 million new cases and 375,000 deaths from PCa were estimated in 2020, with the highest rates are in developed countries (Sung et al., 2021). In Algeria, PCa is the second most frequent cancer affecting men (17.0 per 100,000) and the fourth leading cancer‐caused mortality (6.8 per 100,000; Sung et al., 2021).
Prostate cancer is a multifactorial disease that arises from a complex interplay of genetic and environmental factors. Age, family history, and ethnicity are well‐established risk factors for PCa. Other factors such as diet, androgen exposure, and smoking have been suggested to play a role in the disease's development, but their exact contributions remain unclear (Crawford, 2003). Recent studies have focused on identifying genetic alterations and polymorphisms associated with PCa, as they may provide important insights into the disease's underlying mechanisms and potential therapeutic targets (Van den Broeck et al., 2014).
Methylenetetrahydrofolate reductase (MTHFR) is a key regulatory enzyme involved in the folate and homocysteine metabolic pathways. Its main function is to catalyze the conversion of 5,10‐methylenetetrahydrofolate (5,10‐methylene THF) to 5‐methyltetrahydrofolate (5‐methyl‐THF), which is the primary circulatory form of folate. 5‐methyl‐THF provides a one‐carbon group for the remethylation of homocysteine to methionine, a reaction that requires vitamin B12 as a coenzyme (Frosst et al., 1995). Methionine is a precursor of S‐adenosylmethionine (SAM), which is the universal methyl donor in biological processes, including the methylation of proteins and DNA (Friso & Choi, 2005). Thus, MTHFR plays a critical role in the production and biosynthesis of dTMP, as well as in the repair and maintenance of DNA stability (Jones & Baylin, 2002).
The human gene MTHFR (OMIM number: 607093) is located in chromosome 1 (1p36.3) and consists of 11 exons that encode a protein of 656 amino acids. There are two common allelic variants of the MTHFR gene: C677T and A1298C. These MTHFR polymorphisms have been linked to reduced MTHFR activity, which can lead to an increased plasma homocysteine level and a decreased plasma folate concentration. The C677T variant is located at exon 4 and causes an amino acid substitution (Ala 222Val). This substitution causes a thermolabile transformation of the enzyme, resulting in a 35%–65% reduction in enzyme activity (Frosst et al., 1995). The A1298C variant is located at exon 7 and results in a glutamate‐to‐valine substitution at codon 429, which affects enzyme function to a lesser extent. Nonetheless, the C677T polymorphism is more strongly associated with decreased MTHFR enzyme activity (Saeedi et al., 2015). MTHFR polymorphisms and the consequent decrease in enzyme function can lead to genomic instability and the activation of oncogenes by DNA hypomethylation or hypermethylation, resulting in cancerization and affecting the progression of malignant tumors (Jones & Baylin, 2002).
Several studies have investigated the link between MTHFR gene polymorphism and an increased risk of PCa (Chen et al., 2015; Collin et al., 2009; Jackson et al., 2013; López‐Cortés et al., 2013), although their findings have been inconsistent and controversial (Guo et al., 2015; Li & Xu, 2012).
In this study, we aim to investigate the genetic polymorphisms of MTHFR in the North‐Center region of Algeria and their potential association with PCa risk, as well as the influence of serum levels of total homocysteine, folate, vitamin B12, and environmental factors such as tobacco. This will be the first study to investigate these factors in this population, and may shed light on the role of MTHFR in PCa etiology.
2. MATERIALS AND METHODS
2.1. Editorial policies and ethical considerations
Written informed consent was obtained from all participants. The local ethical committee approved this study since 01/01/2013 to 01/01/2017 (approval number: F00220130156).
2.2. Target population
This study included 106 patients with histologically confirmed PCa and 125 control subjects who were diagnosed by urologists at the Department of Urology, Mustapha Bacha University Hospital in Algiers, Algeria, between December 2013 and August 2016. The cases were newly diagnosed with PCa, had a median age of 67.98 ± 6.31, and were from the North‐Central region of Algeria. The risk categories of cancer were defined based on cancer stage, Gleason score, and serum prostate‐specific antigen (PSA) levels at diagnosis.
The control group consisted of healthy male volunteers with an average age of 61.06 ± 6.60 years, living in the same geographical area as the patients, and without a prior history of cancer or precancerous lesions. All participants underwent a digital rectal examination, serological PSA testing (<4 ng/mL), and radiological exams to exclude the possibility of prostate hyperplasia or carcinoma.
All men who agreed to participate in the study were interviewed at the time of their initial visit to the urologist, and a standardized questionnaire was administered to collect information on demographics, residency, occupational activity, marital status, medical history, family history, and lifestyle factors such as tobacco for current users.
2.3. Blood sampling and biochemical analysis
Blood samples were collected from fasting participants using tubes without an anticoagulant and centrifuged at 54 g for 20 min at 4°C. The serum was separated, aliquoted and stored at −80°C until analysis. Biochemical assays on the serum were performed at the Department of Biochemistry in the Central Hospital of Army, Algiers. Serum folate and vitamin B12 concentrations were measured by competitive binding assays with electro‐chemiluminescent detection using an automate (Elecsys 2010, Hitachi, Roche or COBASe401), while serum total homocysteine (tHcy) was analyzed through automated fluorescence polarization immunoassay (ARCHITECT system immunoassay, Abbott Laboratories).
2.4. DNA extraction and genotyping
Genomic DNA was isolated from peripheral blood collected in EDTA tubes using the salting out method (Miller et al., 1988). DNA quantity and purity were assessed by a nano spectrophotometer and agarose gel electrophoresis, respectively.
Genotyping for MTHFR C677T (rs1801133 C>T, 607093. 0003) was performed using a polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP) procedure (Frosst et al., 1995). The GenBank reference sequence and version number for the gene is: MTHFR (NM_005957.5). Genomic DNA (50–100 ng) was amplified in a 30 μL PCR reaction mixture containing 1X Taq DNA polymerase buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, 0.4 μM of forward primer (5‐TTTGAGGCTGACCTGAAGCACTTGAAGGAG‐3), 0.4 μM of reverse primer (5‐GAGTGGTAGCCCTGGATGGGAAAGATCCCG‐3), and 1 U of Taq polymerase (Promega). The PCR protocol consisted of an initial denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 68°C for 30 s, and 72°C for 30 s, and a final extension at 72°C for 7 min. The PCR products were then digested with 5 U of HinfI restriction enzyme (Promega) overnight at 37°C. The digestion products were electrophoresed on a 2% agarose gel containing ethidium bromide and visualized under a UV transilluminator.
The genotype for MTHFR A1298C (rs1801131, 607093.0004) was determined using the TaqMan probe real‐time PCR method (7500 Fast Real‐Time PCR System; Applied Biosystems) with commercially available assays (IDs: C_850486_20; Life Technologies). The reaction mixture (10 μL) contained 5 μL of TaqMan GTXpress Master Mix (Life Technologies), 10 ng of DNA, and 0.5 μL of each primer and probe. The temperature profile consisted of an initial denaturation at 95°C for 10 min, followed by 40 cycles of two‐step PCR (denaturation at 95°C for 15 s, annealing and elongation at 60°C for 1 min). The respective FAM and VIC fluorescence dyes on the probes were used for the wild type (A allele) and the mutant type (C allele) to determine the sample genotype.
2.5. Statistical analysis
Statistical analyses were performed using SPSS version 20 (SPSS Science). We first compared genotype distributions to those expected from Hardy–Weinberg equilibrium (HWE) by the χ 2 test. After that, we determined the relationship between MTHFR C677T, A1298C polymorphism, and PCa risk by calculating the crude ratio. The results were expressed as odds ratio (OR) with the corresponding 95% CIs and p‐value. We used for MTHFR C677T four genetic models: homozygote model (TT vs. CC), heterozygote model (CT vs. CC), recessive model (TT + CT vs. CC), and allele model (T vs. C) to detect such relationship. However, four genetic models for MTHFR A1298C were used. Moreover, crude ratio with the corresponding 95% CIs were calculated to explore the relationship of the other covariables studied and PCa.
The analysis of the multivariate logistic regression was performed to calculate the best independent predictors of PCa for variables that have p ˂ 0.25 in the univariate model. Differences were considered statistically significant when the p‐value was <0.05.
3. RESULTS
3.1. Characteristics of the study population
The distributions of the selected demographic, lifestyle habits and clinical characteristics of 106 PCa patients and 125 controls are summarized in Table 1. There was a significant difference between PCa patients and controls regarding age (OR = 1.11, p = 0.00), and family history (OR = 2.53, p = 0.009). However, there were no significant differences in marital status (p = 0.99), residency (OR = 1.08, p = 0.821), occupational activity (OR = 1.28, p = 0.36), and tobacco (OR = 1.001, p = 0.996).
TABLE 1.
Demographic, clinical characteristics, lifestyle habits, and biochemical analyses of the study subjects.
| Characteristics | Cases (n = 106) | Controls (n = 125) | p | OR (95% CI) |
|---|---|---|---|---|
| Age at recruitment (years ± SD) | 67.98 ± 6.31 | 61.06 ± 6.60 | 0.00 * | 1.11 (1.07–1.16) |
| Marital status (n, %) | ||||
| Married | 102 (96.22) | 124 (99.2) | 0.99 | – |
| Single | 04 (3.77) | 01 (0.8) | ||
| Residency (n, %) | ||||
| Urban | 90 (84.1) | 105 (84) | 0.82 | 1.08 (0.53–2.21) |
| Rural | 17 (15.9) | 21 (16) | ||
| Occupational activity (n, %) | ||||
| Manual labor | 69 (64.4) | 78 (62.4) | 0.36 | 1.28 (0.74–2.23) |
| Office job | 36 (35.6) | 47 (37.6) | ||
| Tobacco (n, %) | ||||
| Current smoker | 38 (35.84) | 40 (32) | 0.99 | 1.01 (0.67–1.49) |
| Former smoker | 37 (34.90) | 37 (29.6) | ||
| Never smoker | 30 (28.30) | 44 (35.2) | ||
| Family history of PCa (%) | ||||
| First‐degree family members | 28.3 | 12 | 0.009 * | 2.53 (1.26–5.08) |
| Biochemistry (Mean ± SD) | ||||
| Folic acid (ng/mL) | 8.61 ± 4.00 | 7.79 ± 3.91 | 0.47 | 1.08 (0.86–1.09) |
| Vitamin B12 (pg/mL) | 295.44 ± 2.82 | 362.74 ± 195.71 | 0.18 | 0.99 (0.99–1.01) |
| Homocysteine (μmol) | 10.10 ± 3.19 | 12.34 ± 8.27 | 0.47 | 0.98 (0.91–1.04) |
| Total PSA (ng/mL) | 19.53 ± 17.69 | 3.72 ± 2.77 | 0.00 * | – |
| Clinical characteristics (n, %) | ||||
| Gleason score 5–7 | 88 (92.4) | – | – | – |
| Gleason score 8–10 | 12 (7.6) | |||
| Stage (n, %) | ||||
| I | 15 (14.15) | – | – | – |
| IIa–IIb | 53 (50) | – | – | – |
| III | 03 (2.83) | – | – | – |
| IV | 33 (31.13) | – | – | – |
| Risk category (n, %) | ||||
| Low risk | 37 (34.57) | – | – | – |
| Intermediate to high risk | 38 (35.51) | – | – | – |
| Distant metastases | 32 (29.90) | – | – | – |
Note: Univariate odds ratio of prostate cancer risk. Value of p < 0.05 refers statistical.
Abbreviations: CI, confidence intervals; OR, odds ratio; PCa, prostate cancer; PSA, prostate‐specific antigen.
p < 0.05.
The analysis of biochemical parameters showed that a total PSA value was significantly higher in PCa group (p = 0.000). Moreover, we noted no association between serum tHcy (OR = 0.975, p = 0.466), folate (OR = 1.014, p = 0.472), vitamin B12 (OR = 0.997, p = 0.178) levels, and PCa.
3.2. Genotype frequencies of MTHFR and haplotypes analysis
The distributions of the MTHFR gene polymorphisms were in Hardy–Weinberg equilibrium in both groups (p ˃ 0.05). The investigation of the relationship between C677T and A1298C MTHFR polymorphism and PCa was presented in Table 2. The results indicate that there were no significant differences in genotype and allele frequencies between patients and controls (p > 0.05). The combined effect of the two polymorphisms, 677CT/1298AC genotype, also showed no association with the risk of PCa.
TABLE 2.
Frequency distribution of the MTHFR C677T, A1298C alleles, genotype, and combined genotypes, and their relation with PCa.
| Polymorphism | PCa | Controls | p‐Value | OR (95%CI) |
|---|---|---|---|---|
| n (%) | n (%) | |||
| MTHFR C677T | n = 106 | n = 125 | ||
| CC | 50 (47.16) | 53 (44) | 0.65 | 1. 11 (0.70–1.77) |
| CT | 41 (38.67) | 56 (42.4) | 0.55 | 0. 86 (0.54–1.39) |
| TT | 15 (14.15) | 16 (13.6) | 0.79 | 1.10 (0.52–2.34) |
| TT vs. CC | 0.98 | 0.99 (0.44–2.22) | ||
| CT vs. CC | 037 | 0.77 (0.44–1.35) | ||
| TT + CT vs. CC | 0.47 | 0.82 (0.49–1.39) | ||
| C allele | 141 (66.51) | 162 (64.8) | 0.86 | 1.03 (0.77–1.37) |
| T allele | 71 (33.49) | 88 (35.2) | 0.79 | 0.95 (0.66–1.36) |
| T vs. C | 0.70 | 0.93 (0.63–1.36) | ||
| MTHFR A1298C | n = 105 | n = 106 | ||
| AA | 62 (59.0) | 67 (63.2) | 0.76 | 0.93 (0.60–1.45 |
| AC | 38 (36.2) | 34 (32.1) | 0.66 | 1.13 (0.66–1.93) |
| CC | 05 (4.8) | 05 (4.7) | 0.98 | 1 (0.281–3.59) |
| CC vs. AA | 0.9 | 1.08 (0.30–3.91) | ||
| AC vs. AA | 0.52 | 1.21 (0.68–2.15) | ||
| CC + AC vs. AA | 0.54 | 1.19 (0.68–2.07) | ||
| A allele | 162 (77.14) | 168 (79.24) | 0.85 | 0.97 (0.73–1.30) |
| C allele | 48 (22.85) | 44 (20.75) | 0.68 | 1.1 (0.70–1.73) |
| C vs. A | 0.60 | 1.13 (0.71–1.80) | ||
| C677T/A1298C | n = 105 | n = 105 | ||
| CC/AA | 21 (20) | 28 (27.67) | 0.37 | 0.75 (0.4–1.4) |
| CC/AC | 23 (21.9) | 18 (17.14) | 0.47 | 1.28 (0.65–2.5) |
| CC/CC | 05 (4.76) | 03 (2.85) | 0.49 | 1.66 (0.38–7.15) |
| CT/AA | 28 (27.67) | 29 (27.61) | 0.91 | 0.97 (0.53–1.73) |
| CT/AC | 13 (8.66) | 15 (14.28) | 0.72 | 0.87 (0.39–1.91) |
| CT/CC | 0 | 01 (0.95) | – | – |
| TT/AA | 13 (13.38) | 10 (9.52) | 0.55 | 1.31 (0.55–3.1) |
| TT/AC | 02 (1.90) | 01 (0.95) | 0.57 | 2.02 (0.18–22.4) |
| TT/CC | 0 | 01 (0.95) | – | – |
Note: Crude odds ratio of proste cancer. The Gene reference sequence and version number for the gene is: MTHFR (NM_005957.5). C677T (rs1801133 C>T, 607093. 0003); A1298C (rs1801131, 607093.0004). p < 0.05 Statistically significant.
Abbreviations: CI, confidence intervals; MTHFR, methylenetetrahydrofolate reductase; OR, odds ratio refers to PCa; PCa, prostate cancer.
3.3. Multivariate logistic regression
Multiple logistic regression analyses (Table 3) were conducted to identify the best independent predictors after univariate analysis (Table 1). In this analysis, only age (OR = 1.178, p = 0.00) and family history (OR = 10.03, p = 0.007) were found to be independent risk factors for PCa development.
TABLE 3.
Results of multivariate adjusted analysis between prostate cancer cases and controls according to MTHFR genotypes, biochemistry analysis and demographic parameters.
| p‐Value | OR | 95% CI | |
|---|---|---|---|
| Age | 0.00 | 1.18 | 1.08–1.28 |
| Family history | 0.007 | 10.03 | 1.88–53.62 |
Note: Adjusted OR. p < 0.05 Statistically significant.
Abbreviations: CI, confidence intervals; OR, odds ratio refers to PCa.
4. DISCUSSION
The MTHFR enzyme is crucial for intracellular folate and homocysteine metabolism, which play key roles in DNA methylation, synthesis, and genomic integrity (Selhub, 2002). An imbalance in the levels of circulating folate, homocysteine, and vitamin B12 has been associated with DNA damage, which can lead to genetic instability and increase the risk of various cancers, including PCa (Bistulfi et al., 2010; Collin et al., 2010; Zhang et al., 2015). In murine models of PCa, folate deficiency has been shown to induce CpG island hypermethylation and uracil misincorporation into DNA strands, leading to genetic and epigenetic instability. Interestingly, however, high levels of serum folate and homocysteine have also been linked to an increased risk of PCa progression. This apparent paradox may reflect the dualistic role that folate can play in prostate carcinogenesis (Collin et al., 2010). Additionally, high serum levels of vitamin B12 and homocysteine have been associated with an increased risk of PCa (Collin, 2013). However, in our study, we found no association between these vitamins, homocysteine levels, and the risk of PCa development. Our results were consistent with those of Weinstein et al. (2003) and Beilby et al. (2010).
Regarding the relationship between MTHFR polymorphisms and PCa, our study found no significant differences in our population. This finding is consistent with several meta‐analyses that have reported no association between the C677T and A1298C polymorphisms and PCa risk in Caucasian, mixed, and Asian populations (Abedinzadeh et al., 2015; Collin et al., 2009; Li & Xu, 2012; Yadav et al., 2016). However, some published studies have reported a positive association between the MTHFR C667T polymorphism and PCa development (López‐Cortés et al., 2013; Safarinejad et al., 2010). Furthermore, some studies have suggested that the 677 TT genotype may have a protective effect against PCa in Spanish and Asian. As well as, Cicek et al. (2004) suggested that 677 T and 1298A may be associated with the reduction of PCa progression. These conflicting results may be attributed to differences in control selection methods, dietary habits, geographic regions, ethnic origins, and exposure to various environmental risk factors.
Tobacco is an environmental risk factor for cancer and is responsible for 30% of all human cancers, including PCa (Fontham et al., 2009). Two biological mechanisms have been proposed to explain how tobacco promotes PCa. Firstly, tobacco contains multiple carcinogenic compounds, including polycyclic aromatic hydrocarbons (PAHs) and nitrosamines, which can indirectly induce PCa through their interaction with androgen receptors (Hecht, 2006). Secondly, tobacco use has been linked to increased levels of circulating androgens, including testosterone, androstenedione, and dihydrotestosterone (DHT; (Shiels et al., 2009). It is believed that the carcinogenic compounds found in tobacco can interact with androgen receptors, leading to an increase in androgen signaling and contributing to the development of Pca (Shiels et al., 2009). However, other studies have not supported the link between tobacco smoking and PCa (Hosseini et al., 2010; Pacheco et al., 2016; Rohrmann et al., 2013). Our data showed that tobacco consumption was not associated with PCa (OR = 1.001, p = 0.996). Similar to our findings, other studies found no evidence of an association between tobacco use and PCa in the Western and Eastern populations of Algeria (Benabdelkrim et al., 2018; Berroukche et al., 2012).
Two factors that remained significantly associated with PCa in multivariate analysis were older age and family history of PCa. Older age is a well‐established risk factor for PCa (Hosseini et al., 2010; Pourmand et al., 2007), and our study also revealed this association (OR = 1.178, p = 0.00). In fact, evidence suggests that microscopic lesions of PCa can be found in as many as 42% of men aged 50 (Frankel et al., 2003).
In addition, family history is also a significant independent risk factor for PCa (OR = 2.53, p = 0.009) in our study. Numerous studies have reported an increased risk of PCa in individuals with a positive family history (Cerhan et al., 1999; Muller et al., 2013), and men with first‐degree relatives affected by PCa have been found to have a 2–3‐fold increased risk of developing the disease (Lichtenstein et al., 2000; Watkins Bruner et al., 2003). Our findings are consistent with those of studies conducted by Lassed et al. (2016), which suggest that first‐degree family history for PCa appears to predict a favorable tumor prognosis in of these risk factors in PCa development, earlier diagnosis is essential, particularly for men at higher risk of developing the disease.
5. CONCLUSION
In summary, the present study suggests that there is no association between the two genetic polymorphisms of MTHFR enzyme and PCa risk in the North‐Center of Algeria population. Additionally, folate, homocysteine, and vitamin B12 do not appear to be risk factors for PCa in this population. Tobacco use also did not show a significant association. However, age and family history seem to play a significant role in the development of PCa. It is important to note that further studies with a larger sample size are necessary to confirm these findings.
AUTHOR CONTRIBUTIONS
Rima Mouhoub‐Terrab performed the molecular analyses, interpreted the data, prepared the tables, and drafted the initial version of the manuscript. Malika Khelil conceptualized the study, designed the experiments, analyzed the data, reviewed and edited the manuscript, and submitted it for publication. Abdel Aziz Chibane contributed to the collection of clinical data. All authors have contributed to and approved the final version of the manuscript.
CONFLICT OF INTEREST STATEMENT
The authors declare no conflict of interest.
ETHICS STATEMENT
The local ethical committee approved this study (approval number: F00220130156).
CONSENT TO PARTICIPATE
Written informed consent was obtained from all participants.
ACKNOWLEDGMENTS
We would like to express our appreciation to all participants for their contribution to this study. We also extend our gratitude to Professor Reda Djidjik, Professor Ghouti Kacimi, Dr. Asmah Saida Merad, Dr. Mohamed El‐Hadi Cherifi, and the staff at the Department of Urology for their valuable assistance in conducting this research.
Mouhoub‐Terrab, R. , Chibane, A. A. , & Khelil, M. (2023). No association between MTHFR gene C677T/A1298C polymorphisms, serum folate, vitamin B12, homocysteine levels, and prostate cancer in an Algerian population. Molecular Genetics & Genomic Medicine, 11, e2194. 10.1002/mgg3.2194
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available from the corresponding author upon reasonable request.
REFERENCES
- Abedinzadeh, M. , Zare‐Shehneh, M. , Neamatzadeh, H. , & Karami, H. (2015). Association between MTHFR C677T polymorphism and risk of prostate cancer: Evidence from 22 studies with 10,832 cases and 11,993 controls. Asian Pacific Journal of Cancer Prevention, 16(11), 4525–4530. [DOI] [PubMed] [Google Scholar]
- Beilby, J. , Ambrosini, G. , Rossi, E. , De Klerk, N. , & Musk, A. (2010). Serum levels of folate, lycopene, β‐carotene, retinol and vitamin E and prostate cancer risk. European Journal of Clinical Nutrition, 64(10), 1235–1238. [DOI] [PubMed] [Google Scholar]
- Benabdelkrim, M. , Djeffal, O. , & Berredjem, H. (2018). GSTM1 and GSTT1 polymorphisms and susceptibility to prostate cancer: A case‐control study of the Algerian population. Asian Pacific Journal of Cancer Prevention, 19(10), 2853. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Berroukche, A. , Bendahmane, M. , & Kandouci, B. (2012). Association of diet with the risk of prostate cancer in Western Algeria. Oncologie, 14(2), 674–678. [Google Scholar]
- Bistulfi, G. , VanDette, E. , Matsui, S. , & Smiraglia, D. J. (2010). Mild folate deficiency induces genetic and epigenetic instability and phenotype changes in prostate cancer cells. BMC Biology, 8(1), 6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cerhan, R. , Parker, A. S. , Putnam, S. D. , Chiu, B. C. , Lynch, C. F. , Cohen, M. B. , & Cantor, K. P. (1999). Family history and prostate cancer risk in a population‐based cohort of Iowa men. Cancer Epidemiology and Prevention Biomarkers, 8(1), 53–60. [PubMed] [Google Scholar]
- Chen, P. , Li, W. , Wang, J. , Jiang, Y. , Wu, P. , Chen, T. , & Zheng, S. (2015). Association between MTHFR gene polymorphisms (C677T, A1298C) and genetic susceptibility to prostate cancer: A meta‐analysis. Genetics and Molecular Research, 14(4), 19191–19202. [DOI] [PubMed] [Google Scholar]
- Cicek, M. S. , Nock, N. L. , Li, L. , Conti, D. V. , Casey, G. , & Witte, J. S. (2004). Relationship between methylenetetrahydrofolate reductase C677T and A1298C genotypes and haplotypes and prostate cancer risk and aggressiveness. Cancer Epidemiology and Prevention Biomarkers, 13(8), 1331–1336. [PubMed] [Google Scholar]
- Collin, S. M. (2013). Folate and B12 in prostate cancer. Advances in Clinical Chemistry, 60, 1–63. [DOI] [PubMed] [Google Scholar]
- Collin, S. M. , Metcalfe, C. , Refsum, H. , Lewis, S. J. , Zuccolo, L. , Smith, G. D. , & Marsden, G. (2010). Circulating folate, vitamin B12, homocysteine, vitamin B12 transport proteins, and risk of prostate cancer: A case‐control study, systematic review, and meta‐analysis. Cancer Epidemiology and Prevention Biomarkers, 19(6), 1632–1642. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Collin, S. M. , Metcalfe, C. , Zuccolo, L. , Lewis, S. J. , Chen, L. , Cox, A. , & Smith, G. D. (2009). Association of folate‐pathway gene polymorphisms with the risk of prostate cancer: A population‐based nested case‐control study, systematic review, and meta‐analysis. Cancer Epidemiology and Prevention Biomarkers, 18(9), 2528–2539. [DOI] [PubMed] [Google Scholar]
- Crawford, E. D. (2003). Epidemiology of prostate cancer. Urology, 62(6), 3–12. [DOI] [PubMed] [Google Scholar]
- Fontham, E. T. , Thun, M. J. , Ward, E. , Balch, A. J. , Delancey, J. O. , & Samet, J. M. (2009). American Cancer Society perspectives on environmental factors and cancer. CA: A Cancer Journal for Clinicians, 59(6), 343–351. [DOI] [PubMed] [Google Scholar]
- Frankel, S. , Smith, G. D. , Donovan, J. , & Neal, D. (2003). Screening for prostate cancer. The Lancet, 361(9363), 1122–1128. [DOI] [PubMed] [Google Scholar]
- Friso, S. , & Choi, S. W. (2005). Gene‐nutrient interactions in one‐carbon metabolism. Current Drug Metabolism, 6(1), 37–46. [DOI] [PubMed] [Google Scholar]
- Frosst, P. , Blom, H. , Milos, R. , Goyette, P. , Sheppard, C. A. , Matthews, R. , & Van Den Heuve, L. (1995). A candidate genetic risk factor for vascular disease: A common mutation in methylenetetrahydrofolate reductase. Nature Genetic, 10(1), 111–113. [DOI] [PubMed] [Google Scholar]
- Guo, S. , Jiang, X. , Chen, X. , Chen, L. , Li, X. , & Jia, Y. (2015). The protective effect of methylenetetrahydrofolate reductase C677T polymorphism against prostate cancer risk: Evidence from 23 case–control studies. Gene, 565(1), 90–95. [DOI] [PubMed] [Google Scholar]
- Hecht, S. S. (2006). Cigarette smoking: Cancer risks, carcinogens, and mechanisms. Langenbeck's Archives of Surgery, 391(6), 603–613. [DOI] [PubMed] [Google Scholar]
- Hosseini, M. , SeyedALInaghi, S. A. , Mahmoudi, M. , & McFarland, W. (2010). A case‐control study of risk factors of prostate cancer in Iran. Acta Medica Iranica, 48(1), 61–66. [PubMed] [Google Scholar]
- Jackson, M. D. , Tulloch‐Reid, M. K. , McFarlane‐Anderson, N. , Watson, A. , Seers, V. , Bennett, F. I. , & Ragin, C. (2013). Complex interaction between serum folate levels and genetic polymorphisms in folate pathway genes: Biomarkers of prostate cancer aggressiveness. Genes & Nutrition, 8(2), 199–207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jones, P. A. , & Baylin, S. B. (2002). The fundamental role of epigenetic events in cancer. Nature Reviews Genetics, 3(6), 415–428. [DOI] [PubMed] [Google Scholar]
- Lassed, S. , Deus, C. M. , Lourenço, N. , Dahdouh, A. , Rizvanov, A. A. , Oliveira, P. J. , & Zama, D. (2016). Diet, lifestyles, family history, and prostate cancer incidence in an East Algerian patient group. BioMed Research International, 2016(5730569), 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, X. , & Xu, J. H. (2012). MTHFR polymorphism and the risk of prostate cancer: A meta‐analysis of case–control studies. Prostate Cancer and Prostatic Diseases, 15(3), 244–249. [DOI] [PubMed] [Google Scholar]
- Lichtenstein, P. , Holm, N. V. , Verkasalo, P. K. , Iliadou, A. , Kaprio, J. , Koskenvuo, M. , & Hemminki, K. (2000). Environmental and heritable factors in the causation of cancer—Analyses of cohorts of twins from Sweden, Denmark, and Finland. New England Journal of Medicine, 343(2), 78–85. [DOI] [PubMed] [Google Scholar]
- López‐Cortés, A. , Jaramillo‐Koupermann, G. , Muñoz, M. J. , Cabrera, A. , Echeverría, C. , Paz‐y‐Miño, C. , & Vivar, N. (2013). Genetic polymorphisms in MTHFR (C677T, A1298C), MTR (A2756G) and MTRR (A66G) genes associated with pathological characteristics of prostate cancer in the Ecuadorian population. The American Journal of the Medical Sciences, 346(6), 447–454. [DOI] [PubMed] [Google Scholar]
- Miller, S. , Dykes, D. , & Polesky, H. (1988). A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research, 16(3), 1215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Muller, R. L. , Faria, E. F. , Carvalhal, G. F. , Reis, R. B. , Mauad, E. C. , Carvalho, A. L. , & Freedland, S. J. (2013). Association between family history of prostate cancer and positive biopsies in a Brazilian screening program. World Journal of Urology, 31(5), 1273–1278. [DOI] [PubMed] [Google Scholar]
- Pacheco, S. O. S. , Pacheco, F. J. , Zapata, G. M. J. , Garcia, J. M. E. , Previal, C. A. , Cura, H. E. , & Craig, W. J. (2016). Food habits, lifestyle factors and risk of prostate cancer in central Argentina: A case control study involving self‐motivated health behavior modifications after diagnosis. Nutrients, 8(7), 419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pourmand, G. , Salem, S. , Mehrsai, A. , Lotfi, M. , Zargar, M. A. A. , Mazdak, H. , Roshani, A. , Kheiroallahi, A. , Kalantar, E. , Baradaran, N. , Saboury, B. , Allameh, F. , Karami, A. , Ahmadi, H. , & Jahani, Y. (2007). The risk factors of prostate cancer: A multicentric case‐control study in Iran. Asian Pacific Journal of Cancer Prevention, 8(3), 422–428. [PubMed] [Google Scholar]
- Rohrmann, S. , Linseisen, J. , & Allen, N. (2013). Smoking and the risk of prostate cancer in the European prospective investigation into cancer and nutrition. British Journal of Cancer, 108, 708–714. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saeedi, S. , Owji, A. A. , Ansari, M. , Ghafarpour, M. , Ebrahimi, A. , & Fallah, M. S. (2015). MTHFR gene polymorphisms and susceptibility to migraine attacks. Archives of Medical Laboratory Sciences, 1(2), 61–66. [Google Scholar]
- Safarinejad, M. R. , Shafiei, N. , & Safarinejad, S. (2010). Relationship between three polymorphisms of methylenetetrahydrofolate reductase (MTHFR C677T, A1298C, and G1793A) gene and risk of prostate cancer: A case–control study. The Prostate, 70(15), 1645–1657. [DOI] [PubMed] [Google Scholar]
- Selhub, J. (2002). Folate, vitamin B12 and vitamin B6 and one carbon metabolism. The Journal of Nutrition, Health & Aging, 6(1), 39–42. [PubMed] [Google Scholar]
- Shiels, M. S. , Rohrmann, S. , Menke, A. , Selvin, E. , Crespo, C. J. , Rifai, N. , & Platz, E. A. (2009). Association of cigarette smoking, alcohol consumption, and physical activity with sex steroid hormone levels in US men. Cancer Causes & Control, 20(6), 877–886. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sung, H. , Ferlay, J. , Siegel, R. L. , Laversanne, M. , Soerjomataram, I. , Jemal, A. , & Bray, F. (2021). Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. A Cancer Journal for Clinicians, 71(3), 209–249. [DOI] [PubMed] [Google Scholar]
- Van den Broeck, T. , Joniau, S. , Clinckemalie, L. , Helsen, C. , Prekovic, S. , Spans, L. , & Claessens, F. (2014). The role of single nucleotide polymorphisms in predicting prostate cancer risk and therapeutic decision making. BioMed Research International, 2014(627510), 1–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Watkins Bruner, D. , Moore, D. , Parlanti, A. , Dorgan, J. , & Engstrom, P. (2003). Relative risk of prostate cancer for men with affected relatives: Systematic review and meta‐analysis. International Journal of Cancer, 107(5), 797–803. [DOI] [PubMed] [Google Scholar]
- Weinstein, S. J. , Hartman, T. J. , Stolzenberg‐Solomon, R. , Pietinen, P. , Barrett, M. J. , Taylor, P. R. , & Albanes, D. (2003). Null association between prostate cancer and serum folate, vitamin B6, vitamin B12, and homocysteine. Cancer Epidemiology and Prevention Biomarkers, 12(11), 1271–1272. [PubMed] [Google Scholar]
- Yadav, U. , Kumar, P. , & Rai, V. (2016). Role of MTHFR A1298C gene polymorphism in the etiology of prostate cancer: A systematic review and updated meta‐analysis. Egyptian Journal of Medical Human Genetics, 17(2), 141–148. [Google Scholar]
- Zhang, D. , Wen, X. , Wu, W. , Guo, Y. , & Cui, W. (2015). Elevated homocysteine level and folate deficiency associated with increased overall risk of carcinogenesis: Meta‐analysis of 83 case‐control studies involving 35,758 individuals. PLoS One, 10(5), 123. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.