Rotavirus and bacterial diarrhoea among children in Ile-Ife, Nigeria: Burden, risk factors and seasonality

Temiloluwa Ifeoluwa Omotade; Toluwani Ebun Babalola; Chineme Henry Anyabolu; Margaret Oluwatoyin Japhet

doi:10.1371/journal.pone.0291123

. 2023 Sep 12;18(9):e0291123. doi: 10.1371/journal.pone.0291123

Rotavirus and bacterial diarrhoea among children in Ile-Ife, Nigeria: Burden, risk factors and seasonality

Temiloluwa Ifeoluwa Omotade ¹, Toluwani Ebun Babalola ², Chineme Henry Anyabolu ², Margaret Oluwatoyin Japhet ^1,^*

Editor: Tacilta Nhampossa³

PMCID: PMC10497142 PMID: 37699036

Abstract

Background

Diarrhoea is a leading cause of death among under-five children globally, with sub-Saharan Africa alone accounting for 1/3 episodes yearly. Viruses, bacteria and parasites may cause diarrhoea. Rotavirus is the most common viral aetiology of diarrhoea in children less than five years globally. In Nigeria, there is scarce data on the prevalence/importance, burden, clinical/risk factors and seasonality of rotavirus and bacteria and this study aims to determine the role of rotavirus and bacteria on diarrhoea cases in children less than five years in Ile-Ife, Nigeria.

Methods

Socio-demographic data, environmental/risk factors and diarrhoiec stool samples were collected from children less than five years presenting with acute diarrhoea. Rotavirus was identified using ELISA. Bacteria pathogens were detected using cultural technique and typed using PCR. Diarrhoeagenic E. coli (DEC) isolates were subjected to antimicrobial susceptibility testing. Pathogen positive and negative samples were compared in terms of gender, age-group, seasonal distribution, and clinical/risk factors using chi-square with two-tailed significance. SPSS version 20.0.1 for Windows was used for statistical analysis.

Results

At least one pathogen was detected from 63 (60.6%) children having gastroenteritis while 28 (44.4%) had multiple infections. Rotavirus was the most detected pathogen. Prevalence of rotavirus mono-infection was 22%, multiple infection with bacteria was 45%. Mono-infection prevalence of DEC, Shigella spp., and Salmonella spp. were 5.8% (6/104), 5.8% (6/104), and 2.9% (3/104) and co-infection with RVA were 23.1% (24/104), 21.2% (22/104) and 10.6% (11/104) respectively. All rotaviral infections were observed in the dry season. The pathotypes of DEC detected were STEC and EAEC. Parent earnings and mid-upper arm circumference measurement have statistical correlation with diarrhoea (p = 0.034; 0.035 respectively).

Conclusion

In this study, rotavirus was more prevalent than bacteria and occurred only in the dry season. Among bacteria aetiologies, DEC was the most common detected. Differences in seasonal peaks of rotavirus and DEC could be employed in diarrhoea management in Nigeria and other tropical countries to ensure optimal limited resources usage in preventing diarrhoea transmission and reducing indiscriminate use of antibiotics.

1. Introduction

The World Health Organization (WHO) reported 1.7 billion cases of childhood diarrhoeal disease globally in 2017, with about 370,000 deaths among children [1,2]. The United Nations International Children’s Emergency Fund (UNICEF) in its annual report estimated that diarrhoea kills about 2,195 children daily, globally; this is higher than the combined mortality cases of AIDS, malaria, and measles [3].

One-third of the global annual diarrhoea episodes is associated with Sub-Saharan African countries [4]. The high prevalence of diarrhoea in the region has been attributed largely to the lack of safe water for drinking, indecorous means of human fecal waste disposal, concentrated crowding of basic houses, and poor overall hygiene standards [5]. Given that children’s immune system is not fully developed, substandard living conditions increases the vulnerability of children younger than 5 years to diarrhoea when exposed to diarrhoea pathogens [6].

Microorganisms causing diarrhoea are transmitted through contaminated water, and food [7,8]. Three major groups of microorganisms have been implicated as causal agents of diarrhoea. They include viruses (rotaviruses, caliciviruses, astroviruses and adenoviruses), bacteria (Diarrhoegenic E. coli, Shigella species, Salmonella species, Campylobacter jejuni), and parasites (Entamoeba histolytica, Giardia lambia) [9–11]. Viral agents are the major aetiological agents of diarrhoea in Africa [12]. Rotavirus A (RVA) has been reported as the common cause of severe diarrhoea in infants and young children worldwide [1,10,13], associated with >50% of gastroenteritis in this age group [14].

Although there has been a consistent decline in childhood mortality rate caused by diarrhoea over the years, diarrhoea still remains a great burden in Nigeria, putting the country as one of the countries with high under-five diarrhoea mortality rate [15,16]. To reduce diarrhoea related infant morbidity and mortality in countries with high incidence, epidemiological surveys of childhood diarrhoea, in addition to diarrhoea aetiology information is useful in planning, implementation of control strategies and treatment [17]. In Nigeria, there is dearth of single-study data on importance of rotavirus and bacteria as diarrhoea aetiology in children, the associated burden, environmental/risk factors and the seasonality. We therefore investigated the role of rotavirus and bacteria in diarrhoea disease, the associated risk/environmental factors, the seasonal distribution of pathogens as well as the antibiotic sensitivity pattern of the bacteria isolates among children less than 5 years in Ile-Ife, Osun state, south-western Nigeria. This will serve as baseline data for diarrhoea pathogens. It will also inform appropriate policies for diarrhoea prevention and reduce indiscriminate antibiotics use, hence improving diarrhoea management in children.

2. Materials and methods

2.1 Study design

This prospective observational study was designed for one year sample collection, between April 2019 and March 2020, however, samples could not be collected throughout December and part of March due to Lassa fever outbreak and COVID-19 respectively. Four health centres were used as study sites namely: Children emergency ward and the children outpatient/diarrhoea unit Obafemi Awolowo University Complex Teaching Hospital, Oke-Ogbo state Hospital, Urban Comprehensive Health Center Eleyele and Enuowa primary health Centre Ile-Ife, all in southwest Nigeria. Children less than 5 years with acute diarrhoea episodes (diarrhoea is defined as three or more watery stool over a 24-hour period, with or without other symptoms such as fever, vomiting or dehydration) and whose parents give written informed consent were included in the study. Exclusion criteria were children who do not have diarrhoea, diarrhoeic children older than 5 years old, and those whose parent/guardian do not give formal consent to enroll their children in the study. Sociodemographic data (age, sex, monthly income, family size, etc.), clinical and risk factors (symptoms, source of drinking water, six months exclusive breast feeding, stool description, knowledge about RVA etc.) were collected using structured questionnaire completed by the parent or guardian of the children.

2.2 Ethics approval

Ethical approval (ERC/2018/02/14) was obtained from the Obafemi Awolowo University Complex Teaching Hospital (OAUTHC) Research Ethics Committee (OAUTHC REC) of the Obafemi Awolowo University Ile-Ife, Nigeria.

2.3 Detection and identification of bacteria

Faecal samples were inoculated onto Eosin Methylene Blue (EMB) agar for isolation of Escherichia coli as well as Salmonella-Shigella agar (SSA) plates for the isolation of Salmonella and Shigella species. The plates were incubated for 24 hours aerobically at 37°C. Distinct colonies were picked and identified by standard biochemical tests. Cultures with no growth after 24 hours of incubation were recorded as negative for bacteria growth.

2.4 DNA extraction

The DNA of the E. coli isolates were extracted using boiling method. Briefly, distinct colonies of each bacteria isolate were suspended in 100μl distilled water in a clean Eppendorf tube until emulsification was achieved; the resulting mixture was boiled at 100℃ for 15 minutes and finally centrifuged at 10,000 revolutions per minutes for five minutes in a microcentrifuge.

The supernatant containing the DNA was separated into a different sterile Eppendorf tube and stored at -20°C till further analysis.

2.5 Molecular identification of isolates by amplification of E. coli 16S rRNA gene

The isolated organisms suspected to be E. coli by their cultural and biochemical characteristics were confirmed by polymerase chain reaction (PCR) using published primers specific to E. coli 16S rRNA gene (Table 1), adopting the procedure described by Odetoyin et al. [18].

Table 1. Polymerase chain reaction primers for diarrhoeagenic Escherichia coli.

Type	Primer Designation	Primers (5 to 3)	Target gene	Amplicon or probe size (bp)	Reference
ECO	ECO-1	`GACCTCGGTTTAGTTCACAGA`	16srRNA	585	19
ECO	ECO-2	`CACACGCTGACGCTGACCA`	16srRNA	585	19
EPEC	eae 1	`CTGAACGGCGATTACGCGAA`	Eae	917	19
	eae 2	`CCAGACGATACGATCCAG`			19
	bfp 1	`AATGGGCTTGCGCTTCCAG`	bfpA	326	19
	bfp 2	`GCCGCTTTATCCAACCTGGTA`			19
EAEC	EAEC1	`CTGGCGAAAGACTGTATCAT`	CVD432	630	19
EAEC	EAEC2	`CAATGTATAGAAATCCGCTGTT`			19
ETEC	LTf	`GGCGACAGATTATACCGTGC`	LT	450	19
	LTr	`CAATGTATAGAAATCCGCTGTT`			19
	STf	`ATTTTTMTTTCTGTATTRTCTT`	ST	190	19
	STr	`CACCCGGTACARGCAGGATT`			19
EIEC	IpaH1	`GTTCCTTGACCGCCTTTCCGATACCGTC`	ipaH	600	19
EIEC	IpaH2	`GCCGGTCAGCCACCCTCTGAGAGTAC`			19
EHEC	Stx1f	`ATAAATCGCCATTCGTTGACTAC`	Stx1	180	19
	Stx1r	`AGAACGCCCACTGAGATCATCC`			19
	Stx2f	`GGCACTGTCTGAAACTGCTCC`	Stx2	255	19
	Stx2r	`TCGCCAGTTATCTGACATTCTG`			19

Open in a new tab

EPEC- Enteropathogenic E. coli EHEC- Enterohemorrhagic E. coli.

EAEC-Enteroaggregative E. coli ETEC- Enterotoxigenic E. coli EIEC–Enteroinvasive E. coli.

2.6 Screening for diarrhoeagenic E. coli

All E. coli isolates were screened for virulence genes (Table 1) of five different pathotypes of diarrhoeagenic E. coli, including enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), enteroaggregative E. coli (EAEC), and enterohaemorrhagic E. coli (EHEC) as previously described by Aranda et al., [19].

2.7 Antimicrobial susceptibility testing

Antibiotic susceptibility testing of DEC isolates was done using the disc diffusion method. Commonly used and available antibiotics (Oxoid Ltd, UK) impregnated discs of known concentration including; Cephalosporin [cefoxitin (30μg), cefuroxime sodium (30μg)], Sulfonamide [sulphamethoxazole/Trimethoprim (25μg)], Chloramphenicol [chloramphenicol (30μg)], Fluoroquinolones [Ciprofloxacin (5μg), Ofloxacin (5μg)], Tetracycline [Doxycycline (30μg)], and Carbapenem [imipenem (10μg)] were tested on all the DEC isolate. Antibiotic susceptibility or multidrug resistance (resistance of an organism to 3 or more different classes of antibiotics) in isolates was determined by interpreting the zones of inhibition into susceptible or resistance using the clinical and laboratory standards institute guide [CLSI 2019].

2.8 Rotavirus screening

Only 91 of the stool samples collected had enough quantity for bacteria and rotavirus analysis. The 13 samples with low quantity of samples were excluded from the rotavirus screening. Rotavirus antigen detection was carried out by ELISA, using Human Rotavirus Antigen (RV-Ag) ELISA KIT (EKHU-1933, Melsin Medical Co., Ltd-Changchun, China), following the manufacturer’s guide (www.melsin.com/index.php?p=products_show&id=4308&lanmu=).

2.9 Statistical analysis

Data was analyzed using IBM Statistical Package for Social Science (SPSS) version 21.0. Results were summarized using frequency tables, percentages, mean and standard deviation. Pathogen positive and negative samples were compared in terms of gender, age-group, seasonal distribution, and clinical/risk factors using Chi-square with two-tailed significance. A p-value of 0.05 was considered statistically significant.

3. Results

3.1 Socio-demographic characteristics

Table 2 shows the socio-demographic characteristics of children having diarrhoea and that of the parent/guardian. Among 104 children recruited for this study, 67 (64.4%) were in the age group 0–11 months, 23 in age group 12–23, 9 and 4 in age group 24–35 and 48–60 respectively while only one child (0.96%) belong to age group 36–47 months. From the data collected, 61 (55.7%) were males and 43 (41.3%) of the enrolled children were females. Majority (62; 59.2%) of the parents/guardian have a family size of less than four, 41 (39.4%) use tap water as their source of drinking water and 42 (40.4%) of the parents/guardian had an average monthly income in the range of 10,000 ($22) and 30,000 naira ($65).

Table 2. Socio-demographic characteristics of respondents.

Socio-demographic	Frequency (n = 104)	Percentage (%)
Age of Child
0–11 months	67	64.4
12–23	23	22.1
24–35	9	8.7
36–47 48–60	1 4	1.0 3.8
Sex of Child
Male	61	55.7
Female	43	41.3
Admission status
Admitted	26	25.0
Outpatient	79	75.0
Family Size
Less than 4	62	59.6
4–6	37	35.6
7–10	4	3.8
11–15	1	1.0
Source of Drinking Water
Stream	2	1.9
Well	20	19.2
Tap	41	39.4
Borehole	16	15.4
Sachet water	18	17.3
Bottled water	7	6.7
Facility to Defecate
Open ground	3	2.9
Pit toilet	18	17.3
Water system	83	79.8
Washing of hand before feeding
Yes	89	85.6
No	4	3.8
Sometimes	11	10.6
Period of Breast Feeding
3 months exclusive breast feeding	32	30.8
6 months exclusive breast feeding	61	58.7
Exclusive bottle feeding	2	1.9
Breast and bottle feeding	9	8.7
Knowledge about RVA vaccine
Yes	19	18.3
No	85	81.7
Caregiver Level of Income in Naira
Less than 10 thousand	15	14.4
10–29 thousand	42	40.4
30–49 thousand	18	17.3
50–100 thousand	9	8.7
Above 100 thousand	2	1.9
No stable Income	18	17.3

Open in a new tab

3.2 Prevalence of Rotavirus and bacterial single or multiple infection

At least one pathogen was detected from 63 (60.6%) out of the 104 children having gastroenteritis enrolled in the study. In multiple pathogen infection, the prevalence of RVA, DEC, Shigella spp., and Salmonella spp. was 45% (41/91), 23.1% (24/104), 21.2% (22/104) and 10.6% (11/104) respectively (Fig 1) while single infection prevalence was 22% (20/91), 5.8% (6/104), 5.8% (6/104), and 2.9% (3/104) respectively. There were 28 (44.4%) mixed infections among the diarrhoeic children. Specifically, double infection was detected in 22 (78.6%) children, triple infection in 4 (14.3%) and 2 (7.1%) of the children were infected with the four pathogens detected in the study (Table 3).

Table 3. Distribution of single and multiple infections according to age in months.

Single (mono) infection Age Group
Pathogen RVA DEC Shigella Salmonella Total	0–11 13 4 5 1 23	12–23 5 1 1 1 7	24–35 2 1 0 1 4	36–47 0 0 0 0 0	48–60 0 0 0 1 1	Total 20 6 6 3 35
Coinfection (multiple)
RVA + DEC RVA + Shigella RVA + Salmonella DEC+ Shigella DEC + Salmonella Shigella + Salmonella RVA + DEC + Shigella RVA + DEC + Shigella + Salmonella Total	5 3 1 2 1 1 1 2 16	1 3 1 0 1 0 2 0 8	1 0 0 1 1 0 0 0 3	0 0 0 0 0 0 0 0 0	0 1 0 0 0 0 0 0 1	7 7 2 3 3 1 3 2 28

Open in a new tab

3.3 Highest pathogen prevalence observed in children less than 1 year

Of note is the fact that all the microbial aetiology of diarrhoea screened for in this study had their highest prevalence in children less than 1 year (Table 3), however there were no statistical relationship between age and pathogen detection (P = 0.233, 0.426, 0.880 and 0.634 for RVA, E. coli, Shigella, and Salmonella respectively).

Among the 61 males included in the study, 23 (37.7%), 15 (24.6%), 14 (23.0%), and 6 (9.8%) were positive for RVA, E.coli, Shigella, and Salmonella respectively, while 18 (41.9%), 9 (21.0%), 8 (18.6%), and 5 (11.6%) were detected among the 43 females. Notably, acute gastroenteritis (AGE) infection in our study was not sex-related (P> 0.05).

3.4 Diarrhoeagenic Escherichia coli detected were mostly Shiga Toxin E. coli (STEC)

Twenty-four DEC belonging to different E. coli pathotypes were detected in the study. Of the 24 DEC detected, majority of the isolates belong to the Shiga Toxin E. coli (STEC) while some were found to have cross bands of pathogenic genes. Nineteen (79.2%) of the isolates were STEC, one isolate (4.2%) was found to be an EAEC while 4 (16,7%) isolates had a cross band of genes (stx1/stx2 and CVD342) belonging to STEC and EAEC as shown in Table 4.

Table 4. Distribution of diarrhoeagenic virulence genes in Faecal Escherichia coli from children.

Pathotypes	Number of subjects	Percentage (%)
STEC	19	79.2
EAEC	1	4.2
EAEC + STEC	4	16.7
ETEC	0	0.0
EPEC	0	0.0
EIEC	0	0.0
Total	24	100
Virulence Genes
stx1 only	16	66.7
stx2 only	0	0.0
both stx1 and stx2	3	12.5
CVD342 only	1	4.2
CVD342 + stx1	3	12.5
CVD342 + stx2	0	0.0
CVD342 + stx1 + stx2	1	4.2

Open in a new tab

3.5 Multidrug resistance observed in the DEC isolates

High multidrug resistance was observed in the DEC isolates recovered from our study. Diarrhoegenic E. coli isolates showed 100% resistance to the Cephalosporin (cefoxitin, cefuroxime sodium) and 95.8% resistance to the Sulfonamide (sulphamethoxazole/Trimethoprim). The highest percentage isolate susceptibility to antibiotics was associated with the Carbapenem class of antibiotics (Imipenem; 100%) followed by the Fluoroquinolones (Ciprofloxacin, 95.8%; Ofloxacin, 91.7%), Chloramphenicol (Chloramphenicol, 87.5%), and the least was found in Tetracycline (Doxycycline, 33.3%). Fig 2 represents the susceptibility and resistance pattern of the isolates.

3.6 Clinical and environmental factors associated with rotaviral diarrhoea

Clinical and environmental factors associated with rotavirus were considered in the children screened for rotavirus (Table 5). Knowledge about RVA as the cause of paediatric diarrhoea was high among the parent/guardian. Specifically, 75.8% (69/91) of the parents have knowledge about the virus. The data shows that RVA positive stools were not bloody (0%; n = 0/4) but could be watery (52.4%; n = 22/42), loose (32.1%; n = 9/28), or mucoid (58.8%; n = 10/17).

Table 5. Clinical and environmental factors associated with Rotavirus infection.

Variables	Rotavirus infection		χ²	df	P value
	Rotavirus +ve (41) (%)	Rotavirus–ve (50) (%)
Anthropometric measurement
Less than 115mm	8 (7.1)	6 (42.9)	13.556	6	0.035
Between 115 and 124mm	7 (46.7)	8 (53.3)
Between 125 and 134mm	6 (27.3)	16 (72.7)
Greater than or equal to 135mm Total	20 (50.0)	20 (50.0)
Level of Income
High	9 (32.1)	19 (62.9)	5.585	5	0.034
Low Total	32 (50.8)	31 (49.2)
Knowledge about RVA
Yes	35 (50.7)	34 (49.3)	3.706	1	0.054
No Total	6 (27.3)	16 (72.7)
Source of Drinking Water
Stream	1 (50.0)	1 (50.0)
Well	8 (47.1)	9 (52.9)
Tap	16 (43.2)	21 (56.8)	1.141	5	0.950
Borehole	7 (50.0)	7 (50.0)
Sachet water	5 (35.7)	9 (64.3)
Bottled water	4 (57.1)	3 (42.9)
Hand washing Practice Always Sometimes Rarely	36 (47.4) 3 (27.3) 2 (50.0)	40 (52.6) 8 (72.7) 2 (50.0)	0.907	2	0.636
Toilet facility
Open ground	1 (50.0)	1 (50.0)
Pit toilet	6 (40.0)	9 (60.0)	0.198	2	0.906
Water system	34 (45.9)	40(54.1)
Admission Status
Admitted	9 (36.0)	16 (64.0)	1.142	1	0.285
Outpatient	32 (48.5)	34 (51.5)
6 months exclusive breastfeeding
Yes	30 (49.2)	31 (50.8)	3.306	3	0.347
No	11 (36.7)	19 (63.3)
Stool Description
Watery	22 (52.4)	20 (47.6)
Loose	9 (32.1)	19 (67.9)	2.724	1	0.099
Mucus	10 (58.8)	7 (41.2)
Bloody	0 (0.0)	4 (100)
Duration of Stooling
Less than 1 day	10 (62.5)	6 (37.5)
1–3 days	20 (37.0)	34 (63.0)	0.668	3	0.881
4 days and above	11 (52.4)	10 (47.6)
Associated Fever
Yes	28 (50.0)	28 (50.0)	1.438	1	0.230
No	13 (37.1)	22 (62.9)
Associated Dehydration
Yes	21 (51.2)	20 (48.8)	1.145	1	0.284
No	20 (40.0)	30 (60.0)
Skin Characteristics
Sunken eyes	6 (50.0)	6 (50.0)
Loss of skin turgor	2 (40.0)	3 (60.0)	0.668	3	0.881
Both	4 (57.1)	3 (42.9)
None	29 (43.3)	38 (56.7)

Open in a new tab

Rotavirus A positive samples were common in children whose parents have low level of income (78.0%; n = 32/41). In our study, RVA infection was statistically associated with level of income of the parent and child Anthropometric measurement (mid-upper arm circumference measurement), indicative of low nutritional status (malnutrition) in the children (P = 0.034 and 0.035 respectively). There was no statistical relationship (P> 0.05) between RVA incidence and the environmental factors considered in this study (Table 5).

3.7 Rotavirus infection occurred only in the dry season

In this study, the two distinct seasonal peaks in Nigeria were characterized with different microbial aetiology of diarrhoea. A consistent rise in rotavirus infection was observed towards the dry season, with sharp increase in January and February (Fig 3). About 75% of RVA infection recorded in this study was from samples collected in January and February. The causative organism from bacteria origin was more prominent during the rainy season which falls within April and September.

4. Discussion

This study reports a high prevalence of microbial gastroenteritis among children less than 5 years in Ile-Ife, Osun State, Nigeria. To the best of our knowledge, there is no recent single study report on bacterial and viral aetiology of diarrhoea among children in Nigeria. The only available study is the study by Ogunsanya et al., [20] about two decades ago with a prevalence of 74.9% microbial aetiology of diarrhoea in children. This shows that diarrhoea is still a major problem in the country with a prevalence of 60.6% in our study.

Although, there are no recent studies carried out in Nigeria with reports of the prevalence of viral and bacterial diarrhoea in a single study population with which to compare the result of this study, the findings of this study is consistent with recent reports from other developing countries like Niger, Burkina Faso, Nicaragua, India, and Turkey where viral and bacterial gastroenteritis prevalence of 70%, 64%, 61.1%, 60%, and 59.2% were reported respectively [21–24]. The high prevalence of diarrhoea from the microbial origin in children associated with this region might be a result of low-middle income-earning and a high number of children per household, making the provision of safe drinking water, good sanitation facilities, and balanced diet difficult.

Children living in poor households have been reported to be more vulnerable to diarrhoea than their wealthy counterparts [25]. Our study is in line with this study, showing that children from high income parents are less likely to have RVA diarrhoea compared to their counterparts from low income parents who make up 78% of the RVA positive children with malnutrition.

Rotavirus infection in this study was observed to have the highest prevalence among the different microbial aetiology of childhood diarrhoea screened for. This result supports previous findings [4,21,26,27] with high rotaviral infection compared to other microbial aetiology of diarrhoea among children <5 years. This might not be unconnected with the fact that majority of children are not vaccinated against rotavirus infection and the spread of the virus is aided by environmental factors in their community. Till date, rotavirus vaccine is yet to be introduced into the free Nigeria national immunization program but is still being paid for by parents who can afford it. Low prevalence of RVA has been reported by countries where RVA vaccine is fully introduced into their national immunization scheme [22,28–32]. As suggested by Japhet et al., [33], Nigeria needs to consider including rotavirus vaccine into the free immunization given to children.

Of the different DEC identified in this study, Shiga toxin-producing E. coli (STEC) was the most common sub-pathotype of DEC detected, corroborating the report of Odetoyin et al., [18] that STEC is the prevalent pathotype of DEC in children but deviates from Onanuga et al., [34] and Scholar et al., [35] who reported EAEC as the most common DEC pathotype in children. The difference in result could be as a result of the different geographical study locations. Interestingly, our study and that of Odetoyin [18] were carried out in the South-Western part of Nigeria while the studies of Onanuga [34] and Scholar [35] with similar results but expectedly different from ours, were carried out in the Northcentral part of the country. The prevalence of STEC in the environment poses a risk of having hemolytic uremic syndrome and hemorrhagic colitis which are known to be severe STEC community disease [18].

Rotavirus and bacteria coinfection was reported among diarrhoeic children in this study, with rotavirus and DEC coinfection being the most observed, rotavirus with Shigella coinfection was the next bacteria coinfection between Shigella and Salmonella was observed as the least co-infection in the study. Since there is no recent study in the country that has investigated the aetiology of diarrhoea from viral and bacterial origin to compare the result with, this result is similar to previous findings in developing countries where the combined infection between viral and bacterial etiologies of diarrhoea has been reported [21,22,24,36]. However, co-infection had no statistical significant on the severity of diarrhoea (P = 0.523).

Of the diarrhoeic children with at least one pathogen, a higher prevalence of diarrhoea infection was associated with children less than 1 year. This finding corroborates previous studies carried out in Nigeria and neighbouring developing countries [27,33,37], in which majority of the diarrhoea infection was reported in children less than one year. This might most likely be due to the low level of immunity in the 0 to 11 months age group [5].

In this study, viral and bacterial gastroenteritis were more prevalent among males than females for all the pathogen tested, although viruses and bacteria detection were not sex related. Previous studies in Nigeria were either on bacteria or viruses singly, hence, there is no baseline data for comparison of these agents with sex. However, studies on viral AGE infection in Nigeria and elsewhere have reported that no statistical significance exist between detection of enteric viruses and the sex of a child [27,38,39].

Diarrhoea is classified as mild, moderate, and severe based on the presence or absence of dehydration, sunken eyes, and loss of skin turgor [40]. In this study, different environmental and risk factors were observed to contribute to diarrhoea prevalence in the children. Malnutrition has been said to be directly related to diarrhoea [41]. In agreement with this report, findings from this study shows that diarrhoea was more severe in children that are malnourished (i.e children with low anthropometric measurement) compared to their other counterpart (P = 0.035). Reduced burden of diarrhoea in children under the age of 5 years can result from addressing malnutrition or improving children’s nutritional status [42].

With regards to seasonal distribution of pathogen, gastroenteritis caused by rotavirus began from September, with a significant seasonal peak between January and February. In Southwestern Nigeria where this study was carried out, these months correspond to the dry, cold season of the year [43]. As reported by Abebe [44], Nigeria has two main seasons in a year, namely wet (rainy) and dry (dry cool months between September to February) which tallies with that of many other tropical countries [45]. The finding in this study was similar to a recent report from Nigeria [27] where the peak for rotavirus gastroenteritis was observed between December and March.

Since most diarrhoea in children is associated with rotavirus infection especially in the dry cool months, childhood diarrhoea can or should be easily managed without the intervention of antibiotics. Therapy using the antimicrobial drug should only be recommended when diarrhoea is invasive or persistent which most likely might be as a result of coinfection between viral and bacterial aetiology [18,46,47].

In this study, multidrug resistance was observed in the DEC isolates recovered from our study, corroborating reports of high percentage resistance of DEC isolates to various classes of antibiotics from Nigeria and neighbouring countries [18,37,48]. All strains of DEC isolates in our study showed 100% resistance to the cephalosporin (cefoxitin, cefuroxime sodium) class of antibiotics while all (100%) were susceptible to the Carbapenem class of antibiotics (Imipenem). The high sensitivity of isolates to imipenem observed in this study agrees with the 100% susceptibility reported by Oladipo [49]. This could be linked with less abuse of this drug, as it is mostly administered intravenously, restricting the prescription to medical practitioners, thereby limiting self-medication. We therefore suggest imipenem and ciprofloxacin as good option of antibiotics to combact persistent and invasive diarrhoea within our locality.

The limitations of this study was the inability to collect samples in some parts of December 2019 and March 2020 due to the outbreak of the Lassa fever virus in Nigeria and the outbreak of the global coronavirus pandemic which brought about restrictions in gaining access to the hospital and made parents to avoid coming to the hospital. Also, we were unable to carryout RVA molecular analysis of the stool samples, however, previous studies have reported correlation between ELISA and real time PCR results [50–54] and low Ct-values (high viral load) is being related to more severe disease, hence the study is not in any way impaired.

5. Conclusion

This study reports the burden of rotavirus and bacterial as aetiology diarrhoea and the associated risk factors in Nigeria after two decades of lack of report, showing a high microbial acute gastroenteritis among children 0–5 years with RVA as the most prevalent pathogen in children less than one year. Other findings include rotavirus seasonal peaks, and high multidrug resistance. There is a need to concentrate on viral gastroenteritis research, reduce indiscriminate use of antibiotics and include free rotavirus vaccine into the Nigerian National immunization scheme to reduce diarrhoea burden in Nigeria and elsewhere.

Supporting information

S1 File

(DOCX)

Click here for additional data file.^{(12.3KB, docx)}

Acknowledgments

We are very grateful with sincere appreciation to all parents and children who participated in the study.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

The author(s) received no specific funding for this work.

References

1.WHO. 2017. Diarrhoeal disease Available from: http://www.who.int/news-room/fact-sheets/detail/diarrhoeal-disease. 2017.
2.WHO. 2019. Diarrhoea. [cited 2022 Apr 11]. Available from: https://www.who.int/health-topics/diarrhoea.
3.CDC. 2018. Diarrhoea: Common illness, Global Killer. globaldiarrhea_asia_508c.pdf (cdc.gov).
4.Global Burden of Diarrhoea Diseases Collaborators (GBDDC). Estimates of global, regional, and national morbidity, mortality, and aetiologies of diarrhoeal diseases: a systematic analysis for the Global Burden of Disease Study 2015. Lancet Infect Dis. 2017;17(9):909–48. doi: 10.1016/S1473-3099(17)30276-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Omona S, Malinga GM, Opoke R, Openy G, Opiro R. Prevalence of diarrhoea and associated risk factors among children under five years old in Pader District, northern Uganda. BMC Infect Dis. 2020;20(1):1–9. doi: 10.1186/s12879-020-4770-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Kapwata T, Mathee A, Le Roux WJ, Wright CY. Diarrhoeal disease in relation to possible household risk factors in South African villages. Int J Environ Res Public Health. 2018;15(8). [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Podewils LJ, Mintz ED, Nataro JP, Parashar UD. Acute, infectious diarrhea among children in developing countries. Semin Pediatr Infect Dis. 2004;15(3):155–68. doi: 10.1053/j.spid.2004.05.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Songe MM, Hang’ombe BM, Knight-Jones TJD, Grace D. Antimicrobial resistant enteropathogenic escherichia coli and salmonella spp. In houseflies infesting fish in food markets in Zambia. Int J Environ Res Public Health. 2017;14(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Hamer DH, Simon J, Thea D, Keusch GT, Hernandez-Avila M, Lazcano-Ponce E. Childhood diarrhea in sub-Saharan Africa. Child Heal Res Proj Spec Rep. 1998;2(1):32. [Google Scholar]
10.Luchs A, Timenetsky M do CST . Group A rotavirus gastroenteritis: post-vaccine era, genotypes and zoonotic transmission. Einstein (Sao Paulo). 2016;14(2):278–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Altinier V, Martín G. Diarrhea caused by shiga-toxigenic Escherichia coli, other pathogens and HUS. Effects of bismuth hydroxide gel. 2017;6(1):4–7. [Google Scholar]
12.Crawford SE, Ramani S, Tate JE, Parashar UD, Svensson L, Hagbom M, et al. Rotavirus infection. Nat Rev Dis Prim. 2017;3. doi: 10.1038/nrdp.2017.83 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Tate JE, Burton AH, Boschi-Pinto C, Parashar UD, Agocs M, Serhan F, et al. Global, Regional, and National Estimates of Rotavirus Mortality in Children <5 Years of Age, 2000–2013. Clin Infect Dis. 2016;62(Suppl 2):S96–105. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Santos FS, Sousa Junior EC, Guerra SFS, Lobo PS, Penha Junior ET, Lima ABF, et al. G1P[8] Rotavirus in children with severe diarrhea in the post-vaccine introduction era in Brazil: Evidence of reassortments and structural modifications of the antigenic VP7 and VP4 regions . Infect Genet Evol. 2019;69(February):255–66. doi: 10.1016/j.meegid.2019.02.009 [DOI] [PubMed] [Google Scholar]
15.Kehinde Peter A, Umar U. Combating diarrhoea in Nigeria: the way forward. J Microbiol Exp. 2018;6(4). [Google Scholar]
16.Jiwok JC, Adebowale AS, Wilson I, Kancherla V, Umeokonkwo CD. Patterns of diarrhoeal disease among under-five children in Plateau State, Nigeria, 2013–2017. BMC Public Health. 2021;21(1):1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Tambe A, Nzefa L, Nicoline N. Childhood Diarrhea Determinants in Sub-Saharan Africa: A Cross Sectional Study of Tiko-Cameroon. Challenges. 2015;6(2):229–43. [Google Scholar]
18.Odetoyin BW, Hofmann J, Aboderin AO, Okeke IN. Diarrhoeagenic Escherichia coli in mother-child Pairs in Ile-Ife, South Western Nigeria. BMC Infect Dis [Internet]. 2016;16(1):1–9. Available from: doi: 10.1186/s12879-016-1365-x [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Aranda KRS, Fagundes-Neto U, Scaletsky ICA. Evaluation of multiplex PCRs for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp. J Clin Microbiol. 2004;42(12):5849–53. doi: 10.1128/JCM.42.12.5849-5853.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Ogunsanya TI, Rotimi VO, Adenuga A. A study of the aetiological agents of childhood diarrhoea in Lagos, Nigeria. J Med Microbiol. 1994;40(1):10–4. doi: 10.1099/00222615-40-1-10 [DOI] [PubMed] [Google Scholar]
21.Bonkoungou IJO, Haukka K, Österblad M, Hakanen AJ, Traoré AS, Barro N, et al. Bacterial and viral etiology of childhood diarrhea in Ouagadougou, Burkina Faso. BMC Pediatr. 2013;13(1):2–7. doi: 10.1186/1471-2431-13-36 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Becker-Dreps S, Bucardo F, Vilchez S, Zambrana LE, Liu L, Weber DJ, et al. Etiology of childhood diarrhea after rotavirus vaccine introduction: A prospective, population-based study in Nicaragua. Pediatr Infect Dis J. 2014;33(11):1156–63. doi: 10.1097/INF.0000000000000427 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Langendorf C, Le Hello S, Moumouni A, Gouali M, Mamaty AA, Grais RF, et al. Enteric bacterial pathogens in children with diarrhea in niger: Diversity and antimicrobial resistance. PLoS One. 2015;10(3):1–18. doi: 10.1371/journal.pone.0120275 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Shrivastava AK, Kumar S, Mohakud NK, Suar M, Sahu PS. Multiple etiologies of infectious diarrhea and concurrent infections in a pediatric outpatient-based screening study in Odisha, India. Gut Pathog. 2017;9(1):1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Tandukar S, Sherchand J, Karki S, Malla B, Ghaju Shrestha R, Bhandari D, et al. Co-Infection by Waterborne Enteric Viruses in Children with Gastroenteritis in Nepal. Healthcare. 2019;7(1):9. doi: 10.3390/healthcare7010009 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Platts-Mills JA, Liu J, Rogawski ET, Kabir F, Lertsethtakarn P, Siguas M, et al. Use of quantitative molecular diagnostic methods to assess the aetiology, burden, and clinical characteristics of diarrhoea in children in low-resource settings: a reanalysis of the MAL-ED cohort study. Lancet Glob Heal. 2018;6(12):e1309–18. doi: 10.1016/S2214-109X(18)30349-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Tagbo BN, Chukwubike CM, Ezeugwu RI, Ani EO. Adenovirus and Rotavirus Associated Diarrhoea in under 5 Children from Enugu Rural Communities, South East Nigeria. World J Vaccines. 2019;09(03):71–83. [Google Scholar]
28.Tate JE, Mutuc JD, Panozzo CA, Payne DC, Cortese MM, Cortes JE, et al. Sustained decline in rotavirus detections in the United States following the introduction of rotavirus vaccine in 2006. Pediatr Infect Dis J. 2011;30(SUPPL. 1):30–4. doi: 10.1097/INF.0b013e3181ffe3eb [DOI] [PubMed] [Google Scholar]
29.Patel MM, Glass R, Desai R, Tate JE, Parashar UD. Fulfilling the promise of rotavirus vaccines: How far have we come since licensure? Lancet Infect Dis [Internet]. 2012;12(7):561–70. Available from: doi: 10.1016/S1473-3099(12)70029-4 [DOI] [PubMed] [Google Scholar]
30.Tate JE, Parashar UD. Rotavirus vaccines in routine use. Clin Infect Dis. 2014;59(9):1291–301. doi: 10.1093/cid/ciu564 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Sánchez-uribe E, Esparza-aguilar M, Parashar UD, Richardson V. Sustained Reduction of Childhood Diarrhea-Related Mortality and Hospitalizations in Mexico After Rotavirus Vaccine Universalization. 2016;62(Suppl 2):133–9. doi: 10.1093/cid/civ1205 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Burnett E, Yen C, Tate JE, Parashar UD. perspectives. 2017;11(10):699–708. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Japhet MO, Famurewa O, Iturriza-Gomara M, Adesina OA, Opaleye OO, Niendorf S, et al. Group A rotaviruses circulating prior to a national immunization programme in Nigeria: Clinical manifestations, high G12P[8] frequency, intra-genotypic divergence of VP4 and VP7. J Med Virol. 2018;90(2):239–49. doi: 10.1002/jmv.24949 [DOI] [PubMed] [Google Scholar]
34.Onanuga A, Igbeneghu O, Lamikanra A. A study of the prevalence of diarrhoeagenic Escherichia coli in children from Gwagwalada, Federal Capital Territory, Nigeria. Pan Afr Med J. 2014;17:1–8. doi: 10.11604/pamj.2014.17.146.3369 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Scholar A. Prevalence of Escherichia Coli Strains Isolated from Diarrhoiec Stool of Children (0–5) Years Attending Selected Hospitals in Niger State Nigeria. 2020;17(2):37–60. [Google Scholar]
36.Gosselin KB, Aboud S, McDonald CM, Moyo S, Khavari N, Manji K, et al. Etiology of diarrhea, nutritional outcomes, and novel intestinal biomarkers in Tanzanian infants. J Pediatr Gastroenterol Nutr. 2017;64(1):104–8. doi: 10.1097/MPG.0000000000001323 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Moharana SS, Panda RK, Dash M, Chayani N, Bokade P, Pati S, et al. Etiology of childhood diarrhoea among under five children and molecular analysis of antibiotic resistance in isolated enteric bacterial pathogens from a tertiary care hospital, eastern odisha, india. BMC Infect Dis. 2019;19(1):1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Ayolabi CI. Genetic diversity of rotavirus strains in children with diarrhea in Lagos, Nigeria. Asian Pacific J Trop Dis. 2016;6(7):517–20. [Google Scholar]
39.Lekana-Douki SE, Kombila-Koumavor C, Nkoghe D, Drosten C, Drexler JF, Leroy EM. Molecular epidemiology of enteric viruses and genotyping of rotavirus A, adenovirus and astrovirus among children under 5 years old in Gabon. Int J Infect Dis. 2015;34:90–5. doi: 10.1016/j.ijid.2015.03.009 [DOI] [PubMed] [Google Scholar]
40.Samson AO, Alimi MA, Shuaibu GA, Fatima AL. Epidemiological and demographic factors associated with diarrhoea in Makurdi, Benue State, Nigeria. J Public Heal Epidemiol. 2020;12(2):98–105. [Google Scholar]
41.Troeger C, Forouzanfar M, Rao PC, Khalil I, Brown A, Reiner RC, et al. Estimates of global, regional, and national morbidity, mortality, and aetiologies of diarrhoeal diseases: a systematic analysis for the Global Burden of Disease Study 2015. Lancet Infect Dis. 2017;17(9):909–48. doi: 10.1016/S1473-3099(17)30276-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Charyeva Z, Cannon M, Oguntunde O, Garba AM, Sambisa W, Bassi AP, et al. Reducing the burden of diarrhea among children under five years old: Lessons learned from oral rehydration therapy corner program implementation in Northern Nigeria. J Heal Popul Nutr [Internet]. 2015;34(1):1–8. Available from:???. doi: 10.1186/s41043-015-0005-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Japhet MO, Adesina OA, Famurewa O, Svensson L, Nordgren J. Molecular epidemiology of rotavirus and norovirus in Ile-Ife, Nigeria: high prevalence of G12P[8] rotavirus strains and detection of a rare norovirus genotype. J Virol. 2012;84:1489–96. [DOI] [PubMed] [Google Scholar]
44.Abebe A, Teka T, Kassa T, Seheri M, Beyene B, Teshome B, et al. Hospital-based surveillance for rotavirus gastroenteritis in children younger than 5 years of age in Ethiopia: 2007–2012. Pediatr Infect Dis J. 2014;33(SUPPL. 1):2007–12. doi: 10.1097/INF.0000000000000048 [DOI] [PubMed] [Google Scholar]
45.Azage M, Kumie A, Worku A, Bagtzoglou AC, Anagnostou E. Effect of climatic variability on childhood diarrhea and its high risk periods in northwestern parts of Ethiopia. PLoS One. 2017;12(10):1–18. doi: 10.1371/journal.pone.0186933 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.MC U, GI E, CP E, U O, SO E. Antibiotic Susceptibility Profile of Escherichia coli and Salmonella Causing Childhood Diarrhoea in Awka Municipality, South-eastern Nigeria. Clin Microbiol Open Access. 2017;06(02). [Google Scholar]
47.Efunshile AM, Ezeanosike O, Onyekachi ONI, Ugwu MI, König B, Robertson LJ. Apparent absence of Giardia infections among children under 5-years of age with acute watery diarrhoea in Abakaliki, Nigeria. Epidemiol Infect. 2019;147:4–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Albrechtova K, Papousek I, De Nys H, Pauly M, Anoh E, Mossoun A, et al. Low rates of antimicrobial-resistant enterobacteriaceae in wildlife in Taï National Park, Côte d’Ivoire, surrounded by villages with high prevalence of multiresistant ESBL-producing escherichia coli in people and domestic animals. PLoS One. 2014;9(12):1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Oladipo EK, Ajibade OA, Adeosun IJ, Awoyelu EH, Akinade SB, Alabi OA, et al. Antimicrobial resistance pattern of clinical isolates of Pseudomonas aeruginosa and Escherichia coli on carbapenems. African J Clin Exp Microbiol. 2018;19(3):159–64. [Google Scholar]
50.Phillips G, Lopman B, Tam CC, Iturriza-Gomara M, Brown D, Gray J. Diagnosing rotavirus A associated IID: Using ELISA to identify a cut-off for real time RT-PCR. J Clin Virol. 2009;44(3):242–5. doi: 10.1016/j.jcv.2008.12.001 [DOI] [PubMed] [Google Scholar]
51.Dung TTN, Phat VV, Nga TVT, My PVT, Duy PT, Campbell JI, et al. The validation and utility of a quantitative one-step multiplex RT real-time PCR targeting Rotavirus A and Norovirus. J Virol Methods [Internet]. 2013;187(1):138–43. Available from: doi: 10.1016/j.jviromet.2012.09.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Tate JE, Mijatovic-Rustempasic S, Tam KI, Lyde FC, Payne DC, Szilagyi P, et al. Comparison of 2 assays for diagnosing rotavirus and evaluating vaccine effectiveness in children with gastroenteritis. Emerg Infect Dis. 2013;19(8):1245–52. doi: 10.3201/eid1908.130461 [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Corcoran MS, van Well GTJ, van Loo IHM. Diagnosis of viral gastroenteritis in children: interpretation of real-time PCR results and relation to clinical symptoms. Eur J Clin Microbiol Infect Dis. 2014;33(10):1663–73. doi: 10.1007/s10096-014-2135-6 [DOI] [PubMed] [Google Scholar]
54.Fumian TM, Leite JPG, Rocha MS, de Andrade JSR, Fioretti JM, de Assis RMS, et al. Performance of a one-step quantitative duplex RT-PCR for detection of rotavirus A and noroviruses GII during two periods of high viral circulation. J Virol Methods [Internet]. 2016;228:123–9. Available from: doi: 10.1016/j.jviromet.2015.11.008 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0291123.r001

Decision Letter 0

Tacilta Nhampossa

5 Oct 2022

PONE-D-22-22211Rotavirus and bacterial diarrhoea among children in Ile-Ife, Nigeria: burden, clinical/environmental factors and seasonality.PLOS ONE

Dear Dr. Japhet,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Nov 19 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Tacilta Nhampossa

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://aje.com/go/plos) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services. If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

● The name of the colleague or the details of the professional service that edited your manuscript

● A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

● A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

3. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

"Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

4. We note you have included a table to which you do not refer in the text of your manuscript. Please ensure that you refer to Table 2 in your text; if accepted, production will need this reference to link the reader to the Table.

Additional Editor Comments:

This is a very interesting study. However, there are several issues in the manuscript that require further elaboration or at least clarification. To ensure the Editor and Reviewers will be able to recommend that your revised manuscript is accepted, please pay careful attention to each of their comments. This way we can avoid future rounds of clarifications and revisions, moving swiftly to a decision.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript is well written and easy to read. Since Nigeria recently introduced rotavirus vaccination in the national immunisation program, the information in this manuscript contributes to information regarding rotavirus frequencies befor the introduction (even through Rotarix has been available for some time). Although seasonal variations of rotavirus and to some extent of bacterial infections are already known, this information may be useful to clinicians in Nigeria. I assume that there are limited resources for diagnostics and therefore the seasonal variation can be informative as analyses can be prioritised depending on season.

Material and methods:

1.Minor Comment: Diarrhoea is spelled wrong on line two in chapter 2.1.

2. Unfortunately the instructions for the Rota virus Ag ELISA couldn't be found on the webb of Melsin Medical. Do you know the specificity and sensitivity of the test, compared to other diagnostic tests, like PCR, for rotavirus? I completely understad that you have used what is available but I suspect that you would have found even more cases with a more sensitive method.

Result:

1.Table 1, at first sign, it is difficult to adress that the numbers (in line of pathogens) belongs to age groups. it will be easier to read if the age-groups are more marked, maybe on line up.

2. You have showed that there are different pathogens circulating during different seasons, which makes it difficult to relate to the information in Table 2. Many of the presented cases in the rotavirus negative group have another pathogen, in another season, that likely affects their health. To really show whether there are differences in, for example, dehydration, healthy controls should be included, alternatively the comparison should be made with negative cases within the same season. It would have been interesting to see the same table divided in seasons. Dry and rain maybe.

Discussion: In this manuscript the co-infections are pointed out int result and tables. I miss a comment in the discussion about their effect. Will a co-infection give more symptoms or is it one pathogen that causes disease?

Reviewer #2: Dear Academic Editor, PLOS ONE

Thank you for your invitation to review the manuscript “Rotavirus and bacterial diarrhoea among children in Ile-Ife, Nigeria: burden, clinical/environmental factors and seasonality”. The manuscript describes a basic hospital investigational of diarrhoea. There are several issues in the manuscript that require further elaboration or at least clarification. Please the comments attached.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: reviewer letter_01OCT2022.docx

Click here for additional data file.^{(22.5KB, docx)}

PLoS One. 2023 Sep 12;18(9):e0291123. doi: 10.1371/journal.pone.0291123.r002

Author response to Decision Letter 0

9 Dec 2022

REVIEWER 1

1.Minor Comment: Diarrhoea is spelled wrong on line two in chapter 2.1

Response: We appreciate the reviewer for the observation of this spelling error. Diarrhoea has been spelt correctly.

Response: We greatly appreciate the reviewer for this observation, Melsin have been contacted and they have updated their website to include the instruction for the Rotavirus antigen ELISA kit. Although, the specificity and sensivity of the kit is not included on their website, our result is broadly in line with other rotavirus ELISA studies from the region using different ELISA kit which recorded similar prevalent value (30.7% to 47.6%) suggesting that there was no significant bias. Japhet et al., 2018; Tagbo et al., 2019

Result:

3. Table 1, at first sign, it is difficult to adress that the numbers (in line of pathogens) belongs to age groups. it will be easier to read if the age-groups are more marked, maybe on line up.

Response: Thank you very much for this observation. The age groups have been marked for easy read.

4. You have showed that there are different pathogens circulating during different seasons, which makes it difficult to relate to the information in Table 2. Many of the presented cases in the rotavirus negative group have another pathogen, in another season, that likely affects their health. To really show whether there are differences in, for example, dehydration, healthy controls should be included, alternatively the comparison should be made with negative cases within the same season. It would have been interesting to see the same table divided in seasons. Dry and rain maybe.

Response: The table refered to above is now table 5 due to the addition of some other tables. Most of the rotavirus negative group included in the analysis for table 5 do not have another pathogen in another season. Figure 3 showed the trend of the pathogen accross the sampling period.

5. Discussion: In this manuscript the co-infections are pointed out int result and tables. I miss a comment in the discussion about their effect. Will a co-infection give more symptoms or is it one pathogen that causes disease?

Response: There was no significant statistical relationship between the severity of diarrhoea and coinfection. This has been stated in the discussion (P= 0.523).

REVIEWER 2

1. Title

Consider to review the manuscript title, because it does not reflect what has been done as methodology and main findings, to be more concise and suggestive.

Response: Thank you for the suggestion, however, we think it necessary to retain the title but we adjusted the methodology and main findings to align with the title.

2. Abstract

The abstract is too long, needs to be shorten and synthetized. Additionally, seems to be missing the justification for conducting the study. There are many statements, which needs to be reviewed:

“Pathogens were detected using ELISA, conventional cultural technique and PCR. Escherichia coli (E. coli) isolates were pathotyped”: Was the pathotyping method different from PCR? Please, specify which pathogen was detected by which technique.

“etiology”: Please standardize, sometimes it appears aetiology.

“E. coli. was the most common bacteria etiology with high multidrug resistance in the DEC isolates”: Needs to be corrected. Considering that E. coli can also be commensal, the authors should only consider the frequency of DEC and classification by each pathotype rather the overall frequency of E. coli isolation.

“Variation in seasonal peaks of viral and bacterial etiology of diarrheoa”: This should be interpreted with caution because the figure of seasonality (Fig. 3) only describes rotavirus and E.coli.

“The E. coli pathotypes detected were Shiga Toxin E. coli (STEC), enterohaemorrhagic E. coli (EHEC) and enteroaggregative E. coli (EAEC)”. Why the author considered STEC and EHEC as distinct pathotypes. What is the difference between both? Your consideration for the papers below regarding the classification for this pathotype.

Delannoy, S., Beutin, L., and Fach, P. (2013). Discrimination of Enterohemorrhagic Escherichia coli (EHEC) from Non-EHEC Strains Based on Detection of Various Combinations of Type III Effector Genes. J. Clin. Microbiol. 51, 3257–3262. doi: 10.1128/JCM.01471-13.

Orth, D., and Wurzner, R. (2006). What Makes an Enterohemorrhagic Escherichia coli? Clin. Infect. Dis. 43, 1168–1169. doi: 10.1086/508207.

Response: The length of the abstract has been reduced to 300 words without watering down the content. The justification for the study is included in the 300 words.

The statement “Pathogens were detected using ELISA, conventional cultural technique and PCR. Escherichia coli (E. coli) isolates were pathotyped” has been re-written, with pathogen specific technique(s) specified. “Aetiology” has been replaced with “etiology throughout the manuscript.

“E. coli. was the most common bacteria etiology with high multidrug resistance in the DEC isolates”. We were reporting for only DEC isolates, but we have reconstructed the statement for clarity.

Response: We thank the reviewer for the contribution and the suggested publications for consideration. Since STEC is a subgroup of EHEC, we agree with the reviewer, hence STEC has been expunged.

3. Introduction

The global burden of diarrhoea should be updated with recent data, the authors present data from 5 years ago ((WHO 2017; UNICEF 2018).

Response: We appreciate the reviewer for the observation, more recent data from WHO has been included.

Statements:

“Considering the immaturity of children’s immune system, these poor living conditions increase the vulnerability of children younger than 5 years to diarrhoea when exposed to pathogens that cause diarrhoea”: Please review the sentence. “(rotaviruses, caliciviruses, noroviruses, and sapoviruses)”: Noroviruses and sapoviruses are Caliciviruses.

Response: This was an oversight and has been corrected appropriately.

“or having contact pathogen carriers”: Please clarify what does this statement means.

Response: Thank you for the observation. The statement has been removed because of its redundancy and lack of further meaning to the sentence.

“Western states due to the level of enlightenment”: What does enlightenment means and relation to pathogens?

Response: We are appreciative of your logical question; the level of enlightenment has been replaced with a level of heightened hygiene as the level of enlightenment did not properly convey what we intended.

“Nigeria being a tropical country has two main seasons: the dry season which lasts from October until around April (or March in some parts of the country), determined by high temperatures and low humidity and the wet or rainy season which is for the remaining months of the year”: What is the relevance to bring Nigeria season in the introduction? It should be moved to methodology.

Response: We appreciate the reviewer for this comment, Nigeria season has been removed from introduction to discussion

The authors should consider mentioning in the justification that there is lack of data regarding diarrhoea aetiology in Nigeria and that the study is bringing some data to fill this gap

“Escherichia coli (ETEC), enteropathogenic Escherichia coli (EPEC), Shigella species, Samonella species, Campylobacter jejuni), and protozoa or parasites (Entamoeba histolytica, Giardia lambia)”. Correct the taxonomy for Salmonella spp.

Response: We have included the justification of this study and the taxonomy of Salmonella spp. has been corrected as pointed out by the reviewer.

4. Materials and Methods

In general authors should review profoundly the study design, there is some key information missing, like description of inclusion criteria, definition of acute gastroenteritis, sample collection and storage.

Specifically, in:

2.1. Study design: “Informed consent was taken from the caregivers of all the study participants, and children who have taken antibiotics within 10 days of presentation were excluded from the study. Why did the authors considered excluding children who took antibiotics in just 10 days and not more? How did the authors ensure that the caregiver recognized whether the child received an antibiotic or other unrelated medication?

Response: The statement has been rewritten, and the definition of acute gastroenteritis has been included. The inclusion criteria have also been clearly stated.

2.2 Ethics”

Ethics Approval: “Written informed consent was taken from caregivers. A semi-structured interviewer administered questionnaire was administered to caregivers of study participants, detailing relevant sociodemographic information, clinical and environmental factors”: This should not be part of the ethical section.

Response: The statement has been removed.

Why did the authors not perform AST for Salmonella and Shigella?

Response: This is due to lack of funding, research in Nigeria is mostly self-funded.

DNA Extraction: “The DNA of the bacteria”: Should not be E.coli colonies? As PCR was only performed for its pathotypes.

Response: The sentence has been changed to E. coli colonies. PCR was not only done for the pathotyping, confirmation of E. coli isolates was also carried out by PCR.

“The plates were incubated for 24 hrs. aerobically at 37 °C. Distinct colonies were picked

and identified by standard biochemical tests.” What was the procedure for those cultures with no growth within 24 hrs, the plates were reincubated?

Response: Culture with no growth was recorded as negative after 24 hours of incubation. It was an oversight not to have included the procedure for cultures with no growth. This information has been added to the manuscript.

“The isolated organisms suspected to be E. coli by their cultural and biochemical characteristics

were confirmed as E. coli by polymerase chain reaction (PCR) using primers specific to E. coli

16S rRNA gene, adopting the procedure described by Mamun et al. (2016).” This reference is not the appropriate. Please consider to add appropriate reference. In addition, specify a little bit more about the primers and protocols used.

Response: Table 1 showing details of the primers and protocol used for E.coli confirmation in this study has been included in the manuscript and appropriate reference cited .

“All the E. coli isolates were screened for virulence genes of five different pathotypes of diarrhoeagenic E. coli, including enterotoxigenic E. coli (ETEC) and enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), enteroaggregative E. coli (EAEC), and enterohaemorrhagic E. coli (EHEC) as previously described by Aranda et al. (2004) with slight modifications.” Mention the targets used for DEC detection. Which modifications were made? Describe more.

Response: The targets for DEC detection and the virulence genes screened for have been included. We have removed with slight modifications since these where only in volumes and do not affect concentrations or method

“The disc diffusion method was used for the antibiotic susceptibility testing of DEC isolates on

Mueller Hinton agar. Commonly used and available antibiotics (Oxoid Ltd, UK) impregnated…….” Which antibiotics were used for AST. Are they common used in Nigeria? Why the authors only tested for 6 antibiotics?

Response: All the antibiotics tested (chloramphenicol (30µg), ciprofloxacin (5µg), ofloxacin (5µg), cefuroxime (30µg), imipenem (10µg), cefoxitin (30µg), doxycycline (30µg), and sulphamethoxazole/ Trimethroprem (25µg)) have been included. We tested 8 different commonly used antibiotics in Nigeria from six different classes of antibiotics (Cephalosporin, Sulphonamide, Carbapenem, Fluoroquinolones, Chloramphenicol, and Tetracycline).

“After incubation, the plate was well aspirated and washed 5 times using the wash….”The washing was manual or automatized?

Response: The washing was done manually.

“Finally, 50 μl of stop solution was added to all the wells and the result read on ELISA plate reader at 450”. Provide the equipment description.

Rotavirus Screening: Please if ELISA steps are described in the manufacture'r protocol, please resume.

Response: Because of this comment, we have reviewed rotavirus screening procedure in the manuscript to just a brief description, directing readers to manufacturer’s protocol. We thank the reviewer for this important counsel.

Statistical Analysis: Please review the meaning of the statistical package (SPSS).

“Student T-test and Chi-square”: P value is used to compare and test the significance of your hypothesis and not to draw conclusions but to suggest what may be the factors.

Response: There was a typographical error in the meaning of SPSS which has been corrected.

5. Results

In general, the authors should consider bringing a table describing the general characteristics of the population before presenting specific analysis, also adding information related to the virulence factors. Additionally, all the subtitles should be reviewed, authors describe them as if they were giving a conclusion or the main finding, ignoring the whole data in the section. All the figure quality should be improved with programs with better resolution. In all the table and images should be added the place, kind of population and study period. There are many results without specifying the correspondent table/figure, please review. There are also so many redundancies.

“Rotavirus more prevalent than bacterial in mono or multiple infection”: Please review the numbers and percentages, sometimes it appears n (%) without a denominator while sometimes both. Review the terms: single co-infections, double, triple, four, which the pathogens are not specified in the section.

“Majority of the pathotyped isolates belong to the Shiga Toxin E. coli (STEC)”: Please specify or explain more what does cross bands means.

Multidrug resistance observed in the DEC isolates: Please indicate how many isolates were tested ans? Also present the resistance according to the pathotypes.

Clinical and environmental factors associated with rotavirus diarrhoea: “samples with quantities not enough for both bacterial and viral screening were excluded”: This should have been mentioned in the methods section.

Table 2: The clinical and risk factors should be presented separately. Specify if the numbers in brackets are numbers or percentages.

Rotavirus infection occurred only in the dry season: “Samples were not collected in December 2019 and March 2020 due to the outbreak of the Lassa fever virus in Nigeria and the outbreak of the global coronavirus pandemic which brought about restrictions in gaining access to the hospital and made parents to avoid coming to the hospital”: This information should have been described in the method section and authors should adjust the study period. This information would also be cited as study limitation.

“At least one pathogen was detected from 63 (60.6%) of the children having gastroenteritis from

the one hundred and four children enrolled in this study.” In the abstract the authors mentioned that only 90 children had sufficient samples for rotavirus screening. Now the author considered all the 104 children. Please check.

The AST data should be complemented with detection of resistant determinants.

“In multiple pathogen infection, the prevalence of RVA, E.coli, Shigella spp., and Salmonella spp. was 45% (41/91), 23.1% (24/104), 21.2% (22/104) and 10.6% (11/104) respectively……….”

When the authors mentioned E. coli are referring to all DECs or all E. coli isolated by conventional microbiology? The authors should only consider DECs for analysis.

“….genes. Sixteen (69.6%) of the isolates were STEC, 2 (8%) were EHEC, one isolate (4%) was……” What is the difference between STEC and EHEC?

“Multidrug resistance observed in the DEC isolates”. All this section should be rewritten, there are so many redundancies.

“Multidrug resistance (the resistance of an organism to 3 or more different classes of antibiotics)”. This sentence should be moved to methodology.

“Table 1: distribution of Single and Multiple infections according to age.”Consider to include %s.

Response: We appreciate the author for the constructive criticism and evaluation of this section. A Table which is now ‘Table 2’ that generally describes the characteristics of the population has been added. All the results have been reviewed and the corresponding figures/tables have been adequately specified. The numbers and percentages have been reviewed and the appearance is unified. Table 3 which is on the distribution of virulence genes has been included.

Only the DEC was considered for the analysis, the places that will have E. coli have been replaced with DEC accordingly.

The definition of multidrug resistance as adopted in this study has been included in the methodology as pointed out by the reviewer.

6. Discussion

Overall, the discussion is too long, the authors should summarize the text and focus on their results first, before referencing similar findings.

Minor comments:

Please give more recent publication for comparisons of diarrhoea aetiology in Nigeria, (Ogunsanya et al., 1994). The authors should even use publication referring single diarrhoea pathogens detection.

Response: We appreciate the reviewer for the point raised to contribute positively to our study. However, from our limited literature search, there are no recent similar studies in the country with which we can compare our combined prevalence with. Publication on the single prevalence of diarhhoea pathogen was used in the study which includes Scholar 2020; Tagbo et al., 2019; Japhet et al., 2018; and Odetoyin et al., 2016.

“Niger, Burkina Faso, Nicaragua, India, and Turkey where viral and bacterial gastroenteritis prevalence of 70%, 64%, 61.1%, 60%, and 59.2% were reported respectively” Did the referenced studies use the same detection method? Here the authors do not specify the proportion of viral and bacterial detection singularly.

Response: This section is for the combine prevalence and there is another section where the proportion of viral and bacterial detection were specified singly.

“Rotavirus infection was observed in this study to have the highest prevalence among the different microbial etiology of childhood diarrhoea screened for”: This sentence seems incomplete.

“This might not be unconnected with the fact that majority of children are not vaccinated against rotavirus infection and the environmental factors in which they live aids the spread of the virus”: As Nigeria vaccine was launched in August 2022, the verb mode should be reviewed. How do the authors conclude that the environmental factors would spread the virus? Which tests were performed to test this conclusion?

“In this study, a slight reduction in the prevalence of rotavirus gastroenteritis was observed (45.1%) compared to the report by Japhet et al. (2018) (47.6%) showing a 2.5% reduction: The authors describe reduction in rotavirus prevalence, which are the comparative data from the country?

Response

This has been expunged from the discussion in order to focus on our results as advised by the reviewer

“Till date, rotavirus vaccine is yet to be introduced into the free Nigeria national immunization program but is still being paid for by parents who can afford it. Low prevalence of RVA has been reported by countries where RVA vaccine is fully introduced into their national immunization scheme. As suggested by Japhet et al. (2018), Nigeria needs to consider including rotavirus vaccine into the free immunization given to children.”: Please consider to review the verb mode, as vaccine was introduced in August 2022.

Response: Thank you very much for the information on the current happenings about immunization of the rotavirus vaccine. However, we have made effort to reach out to all the healthcare centers where the participants were recruited for this study, and to date, they are yet to include free rotavirus vaccine in their scheme. The vaccine is only made available to those who can afford payment.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(28.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0291123.r003

Decision Letter 1

Tacilta Nhampossa

26 Jan 2023

PONE-D-22-22211R1Rotavirus and bacterial diarrhoea among children in Ile-Ife, Nigeria: burden, risk factors and seasonality.PLOS ONE

Dear Dr. Japhet,

Please submit your revised manuscript by Mar 12 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Tacilta Nhampossa

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: No

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: No

**********

6. Review Comments to the Author

Reviewer #1: (No Response)

Reviewer #2: Dear Editor

Please see attached the comments to the authors after a second round of revision. Overall, the manuscript still needs further improvement.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

Attachment

Submitted filename: Reviewer comment.docx

Click here for additional data file.^{(20KB, docx)}

PLoS One. 2023 Sep 12;18(9):e0291123. doi: 10.1371/journal.pone.0291123.r004

Author response to Decision Letter 1

3 Mar 2023

I have responded to all the comments.

Attachment

Submitted filename: Responses to comments by the Reviewer.docx

Click here for additional data file.^{(27.6KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0291123.r005

Decision Letter 2

Tacilta Nhampossa

26 Jul 2023

PONE-D-22-22211R2Rotavirus and bacterial diarrhoea among children in Ile-Ife, Nigeria: burden, risk factors and seasonality.PLOS ONE

Dear Dr. Japhet,

Please submit your revised manuscript by Sep 09 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Tacilta Nhampossa

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

Please respond to all reviewer 2 comments

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #2: Date: 02 April 2023

To: PLOS ONE

Subject: Review of the manuscript – PONE-D-22-22211R1

Dear Academic Editor, PLOS ONE

Thank you for your invitation to review the third version of the manuscript “Rotavirus and bacterial diarrhoea among children in Ile-Ife, Nigeria: burden, clinical/environmental factors and seasonality”. The manuscript describes a basic hospital investigational of diarrhoea. The authors have improved several issues that were pointed, however, there is still need to correct the abstract. Please see my comments attached.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

**********

Attachment

Submitted filename: PONE-D-22-22211_Reviewer letter.docx

Click here for additional data file.^{(15.4KB, docx)}

PLoS One. 2023 Sep 12;18(9):e0291123. doi: 10.1371/journal.pone.0291123.r006

Author response to Decision Letter 2

3 Aug 2023

Academic Editor’s comment

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results.

Response: The recommendation to deposit our protocol is not applicable to this study.

Response: We have carefully reviewed all our references, all the references cited in our manuscript are still available online, none is retracted.

Journal Requirements: Please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements.

Response: All our figures have been uploaded to the preflight analysis and conversion engine (PACE) as requested.

Reviewer’s comment

Again, we appreciate the invaluable suggestions of our indefatigable reviewer towards making our manuscript to be at its best. The suggestions on the abstract have been accepted and addressed below with slight modification to avoid repeated use of the word “usage” in a single paragraph.

1. Abstract

Background: Suggestion: “Diarrhea is a leading cause of death among under-five children globally, with sub-Saharan Africa alone accounting for 1/3 episodes yearly. Viruses, bacteria and parasites may cause diarrhea. Rotavirus is the most common viral etiology of diarrhoea in children less than five years globally. In Nigeria, there is scarce data on the prevalence/importance, burden, clinical/risk factors and seasonality of rotavirus and bacteria and this study aims to determine the role of rotavirus and bacteria on diarrheal cases in children less than five years in Ile-Ife, Nigeria.

Response: This has been accepted and effected.

Methods: Consider removing ..from 104 under five, because seems to be a result

Response: This has been removed. Thank you.

Conclusion: Suggestion: In this study, rotavirus was more prevalent than bacteria and occurred only in the dry season. Among bacterial etiologies, E. coli. was the most common detected. Differences in seasonal peaks of rotavirus and E.coli could be employed in diarrhoea management in Nigeria and other tropical countries for optimal usage of limited resources usage in preventing diarrhoea transmission and reducing indiscriminate antibiotics usage.

Response: To avoid repeated use of the word “usage” which appeared thrice in the reviewer’s suggestion in a single paragraph, we reconstructed the conclusion thus:

In this study, rotavirus was more prevalent than bacteria and occurred only in the dry season. Among bacteria aetiologies, DEC was the most common detected. Differences in seasonal peaks of rotavirus and DEC could be employed in diarrhoea management in Nigeria and other tropical countries to ensure optimal usage of limited resources in preventing diarrhoea transmission and reducing indiscrimate use of antibiotics.

Notice that the word indiscriminate is wrongly written in your conclusion. E. coli must be replaced by DEC.

Thank you for your observation, we have now correctly spelt ‘indiscriminate’ and E.coli has been replaced with DEC.

Attachment

Submitted filename: Response to comments by Reviewer_April 2023.docx

Click here for additional data file.^{(36.9KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0291123.r007

Decision Letter 3

Tacilta Nhampossa

23 Aug 2023

Rotavirus and bacterial diarrhoea among children in Ile-Ife, Nigeria: burden, risk factors and seasonality.

PONE-D-22-22211R3

Dear Dr. Japhet,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Tacilta Nhampossa

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

**********

PLoS One. doi: 10.1371/journal.pone.0291123.r008

Acceptance letter

Tacilta Nhampossa

4 Sep 2023

PONE-D-22-22211R3

ROTAVIRUS AND BACTERIAL DIARRHOEA AMONG CHILDREN IN ILE-IFE, NIGERIA: BURDEN, RISK FACTORS AND SEASONALITY.

Dear Dr. Japhet:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Tacilta Nhampossa

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File

(DOCX)

Click here for additional data file.^{(12.3KB, docx)}

Attachment

Submitted filename: reviewer letter_01OCT2022.docx

Click here for additional data file.^{(22.5KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(28.5KB, docx)}

Attachment

Submitted filename: Reviewer comment.docx

Click here for additional data file.^{(20KB, docx)}

Attachment

Submitted filename: Responses to comments by the Reviewer.docx

Click here for additional data file.^{(27.6KB, docx)}

Attachment

Submitted filename: PONE-D-22-22211_Reviewer letter.docx

Click here for additional data file.^{(15.4KB, docx)}

Attachment

Submitted filename: Response to comments by Reviewer_April 2023.docx

Click here for additional data file.^{(36.9KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0291123.ref001] 1.WHO. 2017. Diarrhoeal disease Available from: http://www.who.int/news-room/fact-sheets/detail/diarrhoeal-disease. 2017.

[pone.0291123.ref002] 2.WHO. 2019. Diarrhoea. [cited 2022 Apr 11]. Available from: https://www.who.int/health-topics/diarrhoea.

[pone.0291123.ref003] 3.CDC. 2018. Diarrhoea: Common illness, Global Killer. globaldiarrhea_asia_508c.pdf (cdc.gov).

[pone.0291123.ref004] 4.Global Burden of Diarrhoea Diseases Collaborators (GBDDC). Estimates of global, regional, and national morbidity, mortality, and aetiologies of diarrhoeal diseases: a systematic analysis for the Global Burden of Disease Study 2015. Lancet Infect Dis. 2017;17(9):909–48. doi: 10.1016/S1473-3099(17)30276-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref005] 5.Omona S, Malinga GM, Opoke R, Openy G, Opiro R. Prevalence of diarrhoea and associated risk factors among children under five years old in Pader District, northern Uganda. BMC Infect Dis. 2020;20(1):1–9. doi: 10.1186/s12879-020-4770-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref006] 6.Kapwata T, Mathee A, Le Roux WJ, Wright CY. Diarrhoeal disease in relation to possible household risk factors in South African villages. Int J Environ Res Public Health. 2018;15(8). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref007] 7.Podewils LJ, Mintz ED, Nataro JP, Parashar UD. Acute, infectious diarrhea among children in developing countries. Semin Pediatr Infect Dis. 2004;15(3):155–68. doi: 10.1053/j.spid.2004.05.008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref008] 8.Songe MM, Hang’ombe BM, Knight-Jones TJD, Grace D. Antimicrobial resistant enteropathogenic escherichia coli and salmonella spp. In houseflies infesting fish in food markets in Zambia. Int J Environ Res Public Health. 2017;14(1). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref009] 9.Hamer DH, Simon J, Thea D, Keusch GT, Hernandez-Avila M, Lazcano-Ponce E. Childhood diarrhea in sub-Saharan Africa. Child Heal Res Proj Spec Rep. 1998;2(1):32. [Google Scholar]

[pone.0291123.ref010] 10.Luchs A, Timenetsky M do CST . Group A rotavirus gastroenteritis: post-vaccine era, genotypes and zoonotic transmission. Einstein (Sao Paulo). 2016;14(2):278–87. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref011] 11.Altinier V, Martín G. Diarrhea caused by shiga-toxigenic Escherichia coli, other pathogens and HUS. Effects of bismuth hydroxide gel. 2017;6(1):4–7. [Google Scholar]

[pone.0291123.ref012] 12.Crawford SE, Ramani S, Tate JE, Parashar UD, Svensson L, Hagbom M, et al. Rotavirus infection. Nat Rev Dis Prim. 2017;3. doi: 10.1038/nrdp.2017.83 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref013] 13.Tate JE, Burton AH, Boschi-Pinto C, Parashar UD, Agocs M, Serhan F, et al. Global, Regional, and National Estimates of Rotavirus Mortality in Children <5 Years of Age, 2000–2013. Clin Infect Dis. 2016;62(Suppl 2):S96–105. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref014] 14.Santos FS, Sousa Junior EC, Guerra SFS, Lobo PS, Penha Junior ET, Lima ABF, et al. G1P[8] Rotavirus in children with severe diarrhea in the post-vaccine introduction era in Brazil: Evidence of reassortments and structural modifications of the antigenic VP7 and VP4 regions . Infect Genet Evol. 2019;69(February):255–66. doi: 10.1016/j.meegid.2019.02.009 [DOI] [PubMed] [Google Scholar]

[pone.0291123.ref015] 15.Kehinde Peter A, Umar U. Combating diarrhoea in Nigeria: the way forward. J Microbiol Exp. 2018;6(4). [Google Scholar]

[pone.0291123.ref016] 16.Jiwok JC, Adebowale AS, Wilson I, Kancherla V, Umeokonkwo CD. Patterns of diarrhoeal disease among under-five children in Plateau State, Nigeria, 2013–2017. BMC Public Health. 2021;21(1):1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref017] 17.Tambe A, Nzefa L, Nicoline N. Childhood Diarrhea Determinants in Sub-Saharan Africa: A Cross Sectional Study of Tiko-Cameroon. Challenges. 2015;6(2):229–43. [Google Scholar]

[pone.0291123.ref018] 18.Odetoyin BW, Hofmann J, Aboderin AO, Okeke IN. Diarrhoeagenic Escherichia coli in mother-child Pairs in Ile-Ife, South Western Nigeria. BMC Infect Dis [Internet]. 2016;16(1):1–9. Available from: doi: 10.1186/s12879-016-1365-x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref019] 19.Aranda KRS, Fagundes-Neto U, Scaletsky ICA. Evaluation of multiplex PCRs for diagnosis of infection with diarrheagenic Escherichia coli and Shigella spp. J Clin Microbiol. 2004;42(12):5849–53. doi: 10.1128/JCM.42.12.5849-5853.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref020] 20.Ogunsanya TI, Rotimi VO, Adenuga A. A study of the aetiological agents of childhood diarrhoea in Lagos, Nigeria. J Med Microbiol. 1994;40(1):10–4. doi: 10.1099/00222615-40-1-10 [DOI] [PubMed] [Google Scholar]

[pone.0291123.ref021] 21.Bonkoungou IJO, Haukka K, Österblad M, Hakanen AJ, Traoré AS, Barro N, et al. Bacterial and viral etiology of childhood diarrhea in Ouagadougou, Burkina Faso. BMC Pediatr. 2013;13(1):2–7. doi: 10.1186/1471-2431-13-36 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref022] 22.Becker-Dreps S, Bucardo F, Vilchez S, Zambrana LE, Liu L, Weber DJ, et al. Etiology of childhood diarrhea after rotavirus vaccine introduction: A prospective, population-based study in Nicaragua. Pediatr Infect Dis J. 2014;33(11):1156–63. doi: 10.1097/INF.0000000000000427 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref023] 23.Langendorf C, Le Hello S, Moumouni A, Gouali M, Mamaty AA, Grais RF, et al. Enteric bacterial pathogens in children with diarrhea in niger: Diversity and antimicrobial resistance. PLoS One. 2015;10(3):1–18. doi: 10.1371/journal.pone.0120275 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref024] 24.Shrivastava AK, Kumar S, Mohakud NK, Suar M, Sahu PS. Multiple etiologies of infectious diarrhea and concurrent infections in a pediatric outpatient-based screening study in Odisha, India. Gut Pathog. 2017;9(1):1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref025] 25.Tandukar S, Sherchand J, Karki S, Malla B, Ghaju Shrestha R, Bhandari D, et al. Co-Infection by Waterborne Enteric Viruses in Children with Gastroenteritis in Nepal. Healthcare. 2019;7(1):9. doi: 10.3390/healthcare7010009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref026] 26.Platts-Mills JA, Liu J, Rogawski ET, Kabir F, Lertsethtakarn P, Siguas M, et al. Use of quantitative molecular diagnostic methods to assess the aetiology, burden, and clinical characteristics of diarrhoea in children in low-resource settings: a reanalysis of the MAL-ED cohort study. Lancet Glob Heal. 2018;6(12):e1309–18. doi: 10.1016/S2214-109X(18)30349-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref027] 27.Tagbo BN, Chukwubike CM, Ezeugwu RI, Ani EO. Adenovirus and Rotavirus Associated Diarrhoea in under 5 Children from Enugu Rural Communities, South East Nigeria. World J Vaccines. 2019;09(03):71–83. [Google Scholar]

[pone.0291123.ref028] 28.Tate JE, Mutuc JD, Panozzo CA, Payne DC, Cortese MM, Cortes JE, et al. Sustained decline in rotavirus detections in the United States following the introduction of rotavirus vaccine in 2006. Pediatr Infect Dis J. 2011;30(SUPPL. 1):30–4. doi: 10.1097/INF.0b013e3181ffe3eb [DOI] [PubMed] [Google Scholar]

[pone.0291123.ref029] 29.Patel MM, Glass R, Desai R, Tate JE, Parashar UD. Fulfilling the promise of rotavirus vaccines: How far have we come since licensure? Lancet Infect Dis [Internet]. 2012;12(7):561–70. Available from: doi: 10.1016/S1473-3099(12)70029-4 [DOI] [PubMed] [Google Scholar]

[pone.0291123.ref030] 30.Tate JE, Parashar UD. Rotavirus vaccines in routine use. Clin Infect Dis. 2014;59(9):1291–301. doi: 10.1093/cid/ciu564 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref031] 31.Sánchez-uribe E, Esparza-aguilar M, Parashar UD, Richardson V. Sustained Reduction of Childhood Diarrhea-Related Mortality and Hospitalizations in Mexico After Rotavirus Vaccine Universalization. 2016;62(Suppl 2):133–9. doi: 10.1093/cid/civ1205 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref032] 32.Burnett E, Yen C, Tate JE, Parashar UD. perspectives. 2017;11(10):699–708. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref033] 33.Japhet MO, Famurewa O, Iturriza-Gomara M, Adesina OA, Opaleye OO, Niendorf S, et al. Group A rotaviruses circulating prior to a national immunization programme in Nigeria: Clinical manifestations, high G12P[8] frequency, intra-genotypic divergence of VP4 and VP7. J Med Virol. 2018;90(2):239–49. doi: 10.1002/jmv.24949 [DOI] [PubMed] [Google Scholar]

[pone.0291123.ref034] 34.Onanuga A, Igbeneghu O, Lamikanra A. A study of the prevalence of diarrhoeagenic Escherichia coli in children from Gwagwalada, Federal Capital Territory, Nigeria. Pan Afr Med J. 2014;17:1–8. doi: 10.11604/pamj.2014.17.146.3369 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref035] 35.Scholar A. Prevalence of Escherichia Coli Strains Isolated from Diarrhoiec Stool of Children (0–5) Years Attending Selected Hospitals in Niger State Nigeria. 2020;17(2):37–60. [Google Scholar]

[pone.0291123.ref036] 36.Gosselin KB, Aboud S, McDonald CM, Moyo S, Khavari N, Manji K, et al. Etiology of diarrhea, nutritional outcomes, and novel intestinal biomarkers in Tanzanian infants. J Pediatr Gastroenterol Nutr. 2017;64(1):104–8. doi: 10.1097/MPG.0000000000001323 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref037] 37.Moharana SS, Panda RK, Dash M, Chayani N, Bokade P, Pati S, et al. Etiology of childhood diarrhoea among under five children and molecular analysis of antibiotic resistance in isolated enteric bacterial pathogens from a tertiary care hospital, eastern odisha, india. BMC Infect Dis. 2019;19(1):1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref038] 38.Ayolabi CI. Genetic diversity of rotavirus strains in children with diarrhea in Lagos, Nigeria. Asian Pacific J Trop Dis. 2016;6(7):517–20. [Google Scholar]

[pone.0291123.ref039] 39.Lekana-Douki SE, Kombila-Koumavor C, Nkoghe D, Drosten C, Drexler JF, Leroy EM. Molecular epidemiology of enteric viruses and genotyping of rotavirus A, adenovirus and astrovirus among children under 5 years old in Gabon. Int J Infect Dis. 2015;34:90–5. doi: 10.1016/j.ijid.2015.03.009 [DOI] [PubMed] [Google Scholar]

[pone.0291123.ref040] 40.Samson AO, Alimi MA, Shuaibu GA, Fatima AL. Epidemiological and demographic factors associated with diarrhoea in Makurdi, Benue State, Nigeria. J Public Heal Epidemiol. 2020;12(2):98–105. [Google Scholar]

[pone.0291123.ref041] 41.Troeger C, Forouzanfar M, Rao PC, Khalil I, Brown A, Reiner RC, et al. Estimates of global, regional, and national morbidity, mortality, and aetiologies of diarrhoeal diseases: a systematic analysis for the Global Burden of Disease Study 2015. Lancet Infect Dis. 2017;17(9):909–48. doi: 10.1016/S1473-3099(17)30276-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref042] 42.Charyeva Z, Cannon M, Oguntunde O, Garba AM, Sambisa W, Bassi AP, et al. Reducing the burden of diarrhea among children under five years old: Lessons learned from oral rehydration therapy corner program implementation in Northern Nigeria. J Heal Popul Nutr [Internet]. 2015;34(1):1–8. Available from:???. doi: 10.1186/s41043-015-0005-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref043] 43.Japhet MO, Adesina OA, Famurewa O, Svensson L, Nordgren J. Molecular epidemiology of rotavirus and norovirus in Ile-Ife, Nigeria: high prevalence of G12P[8] rotavirus strains and detection of a rare norovirus genotype. J Virol. 2012;84:1489–96. [DOI] [PubMed] [Google Scholar]

[pone.0291123.ref044] 44.Abebe A, Teka T, Kassa T, Seheri M, Beyene B, Teshome B, et al. Hospital-based surveillance for rotavirus gastroenteritis in children younger than 5 years of age in Ethiopia: 2007–2012. Pediatr Infect Dis J. 2014;33(SUPPL. 1):2007–12. doi: 10.1097/INF.0000000000000048 [DOI] [PubMed] [Google Scholar]

[pone.0291123.ref045] 45.Azage M, Kumie A, Worku A, Bagtzoglou AC, Anagnostou E. Effect of climatic variability on childhood diarrhea and its high risk periods in northwestern parts of Ethiopia. PLoS One. 2017;12(10):1–18. doi: 10.1371/journal.pone.0186933 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref046] 46.MC U, GI E, CP E, U O, SO E. Antibiotic Susceptibility Profile of Escherichia coli and Salmonella Causing Childhood Diarrhoea in Awka Municipality, South-eastern Nigeria. Clin Microbiol Open Access. 2017;06(02). [Google Scholar]

[pone.0291123.ref047] 47.Efunshile AM, Ezeanosike O, Onyekachi ONI, Ugwu MI, König B, Robertson LJ. Apparent absence of Giardia infections among children under 5-years of age with acute watery diarrhoea in Abakaliki, Nigeria. Epidemiol Infect. 2019;147:4–8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref048] 48.Albrechtova K, Papousek I, De Nys H, Pauly M, Anoh E, Mossoun A, et al. Low rates of antimicrobial-resistant enterobacteriaceae in wildlife in Taï National Park, Côte d’Ivoire, surrounded by villages with high prevalence of multiresistant ESBL-producing escherichia coli in people and domestic animals. PLoS One. 2014;9(12):1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref049] 49.Oladipo EK, Ajibade OA, Adeosun IJ, Awoyelu EH, Akinade SB, Alabi OA, et al. Antimicrobial resistance pattern of clinical isolates of Pseudomonas aeruginosa and Escherichia coli on carbapenems. African J Clin Exp Microbiol. 2018;19(3):159–64. [Google Scholar]

[pone.0291123.ref050] 50.Phillips G, Lopman B, Tam CC, Iturriza-Gomara M, Brown D, Gray J. Diagnosing rotavirus A associated IID: Using ELISA to identify a cut-off for real time RT-PCR. J Clin Virol. 2009;44(3):242–5. doi: 10.1016/j.jcv.2008.12.001 [DOI] [PubMed] [Google Scholar]

[pone.0291123.ref051] 51.Dung TTN, Phat VV, Nga TVT, My PVT, Duy PT, Campbell JI, et al. The validation and utility of a quantitative one-step multiplex RT real-time PCR targeting Rotavirus A and Norovirus. J Virol Methods [Internet]. 2013;187(1):138–43. Available from: doi: 10.1016/j.jviromet.2012.09.021 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref052] 52.Tate JE, Mijatovic-Rustempasic S, Tam KI, Lyde FC, Payne DC, Szilagyi P, et al. Comparison of 2 assays for diagnosing rotavirus and evaluating vaccine effectiveness in children with gastroenteritis. Emerg Infect Dis. 2013;19(8):1245–52. doi: 10.3201/eid1908.130461 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0291123.ref053] 53.Corcoran MS, van Well GTJ, van Loo IHM. Diagnosis of viral gastroenteritis in children: interpretation of real-time PCR results and relation to clinical symptoms. Eur J Clin Microbiol Infect Dis. 2014;33(10):1663–73. doi: 10.1007/s10096-014-2135-6 [DOI] [PubMed] [Google Scholar]

[pone.0291123.ref054] 54.Fumian TM, Leite JPG, Rocha MS, de Andrade JSR, Fioretti JM, de Assis RMS, et al. Performance of a one-step quantitative duplex RT-PCR for detection of rotavirus A and noroviruses GII during two periods of high viral circulation. J Virol Methods [Internet]. 2016;228:123–9. Available from: doi: 10.1016/j.jviromet.2015.11.008 [DOI] [PubMed] [Google Scholar]

PERMALINK

Rotavirus and bacterial diarrhoea among children in Ile-Ife, Nigeria: Burden, risk factors and seasonality

Temiloluwa Ifeoluwa Omotade

Toluwani Ebun Babalola

Chineme Henry Anyabolu

Margaret Oluwatoyin Japhet

Roles

Abstract

Background

Methods

Results

Conclusion

1. Introduction

2. Materials and methods

2.1 Study design

2.2 Ethics approval

2.3 Detection and identification of bacteria

2.4 DNA extraction

2.5 Molecular identification of isolates by amplification of E. coli 16S rRNA gene

Table 1. Polymerase chain reaction primers for diarrhoeagenic Escherichia coli.

2.6 Screening for diarrhoeagenic E. coli

2.7 Antimicrobial susceptibility testing

2.8 Rotavirus screening

2.9 Statistical analysis

3. Results

3.1 Socio-demographic characteristics

Table 2. Socio-demographic characteristics of respondents.

3.2 Prevalence of Rotavirus and bacterial single or multiple infection

Fig 1. Prevalence of Rotavirus and bacteria aetiology of diarrhoea in children.

Table 3. Distribution of single and multiple infections according to age in months.

3.3 Highest pathogen prevalence observed in children less than 1 year

3.4 Diarrhoeagenic Escherichia coli detected were mostly Shiga Toxin E. coli (STEC)

Table 4. Distribution of diarrhoeagenic virulence genes in Faecal Escherichia coli from children.

3.5 Multidrug resistance observed in the DEC isolates

Fig 2. Antibiotics sensitivity pattern of diarrhoeagenic E. coli (DEC).

3.6 Clinical and environmental factors associated with rotaviral diarrhoea

Table 5. Clinical and environmental factors associated with Rotavirus infection.

3.7 Rotavirus infection occurred only in the dry season

Fig 3. Seasonal variation in viral and bacterial aetiology of diarrhoea.

4. Discussion

5. Conclusion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Tacilta Nhampossa

Roles

Author response to Decision Letter 0

Decision Letter 1

Tacilta Nhampossa

Roles

Author response to Decision Letter 1

Decision Letter 2

Tacilta Nhampossa

Roles

Author response to Decision Letter 2

Decision Letter 3

Tacilta Nhampossa

Roles

Acceptance letter

Tacilta Nhampossa

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases