Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Aug 1.
Published in final edited form as: Br J Pharmacol. 2023 Apr 13;180(16):2140–2155. doi: 10.1111/bph.16071

RGS6 negatively regulates inhibitory G protein signaling in VTA dopamine neurons and positively regulates binge-like alcohol consumption in mice

Margot C DeBaker 1, Eric H Mitten 1, Timothy R Rose 2, Ezequiel Marron Fernandez de Velasco 2, Runbo Gao 2, Anna M Lee 2, Kevin Wickman 2,*
PMCID: PMC10504421  NIHMSID: NIHMS1913689  PMID: 36929333

Abstract

Background and Purpose.

Drugs of abuse, including alcohol, increase dopamine (DA) in the mesocorticolimbic system via actions on DA neurons in the ventral tegmental area (VTA). Increased DA transmission can activate inhibitory G protein signaling pathways in VTA DA neurons, including those controlled by GABAB (GABABR) and D2 DA (D2R) receptors. Members of the R7 subfamily of Regulator of G protein Signaling (RGS) proteins can regulate inhibitory G protein signaling, but their influence in VTA DA neurons is unclear. Here, we investigated the influence of RGS6, an R7 RGS family member that has been implicated in the regulation of alcohol consumption in mice, on inhibitory G protein signaling VTA DA neurons.

Experimental Approach.

We used molecular, electrophysiological, and genetic approaches to probe the impact of RGS6 on inhibitory G protein signaling in VTA DA neurons, and on binge-like alcohol consumption, in mice.

Key Results.

RGS6 is expressed in adult mouse VTA DA neurons and it modulates inhibitory G protein signaling in a receptor-dependent manner, tempering D2R-induced somatodendritic currents and accelerating deactivation of synaptically evoked GABABR-dependent responses. RGS6–/– mice exhibit diminished binge-like alcohol consumption, a phenotype recapitulated in female (but not male) mice lacking RGS6 selectively in VTA DA neurons.

Conclusions & Implications.

RGS6 negatively regulates GABABR- and D2R-dependent inhibitory G protein signaling pathways in mouse VTA DA neurons and exerts a sex-dependent positive influence on binge-like alcohol consumption in adult mice. As such, RGS6 may represent a new diagnostic and/or therapeutic target for alcohol use disorder.

INTRODUCTION

The mesocorticolimbic circuitry mediates responses to natural rewards and drugs of abuse (Koob & Volkow, 2016; Uhl, Koob et al., 2019). This circuitry includes the ventral tegmental area (VTA), which projects to limbic and cortical regions that regulate distinct facets of reward processing. VTA neurons release dopamine (DA), γ-aminobutyric acid (GABA), glutamate, or combinations of neurotransmitters (Morales & Margolis, 2017). Drugs of abuse, including alcohol, enhance VTA DA neurotransmission via actions at various molecular targets (Uhl, Koob et al., 2019; You, Vandegrift et al., 2018).

VTA DA neurotransmission is negatively regulated by inhibitory G protein signaling pathways controlled by D2 dopamine (D2R) and GABAB (GABABR) receptors (Hearing, Zink et al., 2012). For example, cocaine stimulates GABABR- and D2R-dependent signaling in VTA DA neurons, tempering their excitability (Brodie & Dunwiddie, 1990; Einhorn, Johansen et al., 1988) and limiting associated drug-induced behaviors (DeBaker, Marron Fernandez de Velasco et al., 2021; Steketee & Kalivas, 1991). These pathways also shape alcohol-related behaviors (Ng & George, 1994; Vlachou & Markou, 2010). For example, mice lacking D2R exhibit altered alcohol reward and consumption (Cunningham, Howard et al., 2000; Phillips, Brown et al., 1998), and repeated alcohol exposure enhances D2R-dependent inhibition of VTA DA neurons (Perra, Clements et al., 2011). Furthermore, intra-VTA administration of the GABABR agonist baclofen reduced alcohol consumption in rodents (Maccioni, Lorrai et al., 2018; Moore & Boehm, 2009).

Regulator of G protein Signaling (RGS) proteins negatively regulate G protein signaling by enhancing the catalytic activity of Gα subunits (Stewart & Fisher, 2015). R7 RGS proteins (RGS6, RGS7, RGS9, and RGS11) contain a structural module analogous to the G protein Gγ subunit that promotes association with the atypical member of the G protein Gβ family, Gβ5 (Cheever, Snyder et al., 2008); this interaction is critical to the stability and function of R7 RGS proteins (Chen, Eversole-Cire et al., 2003). R7 RGS/Gβ5 complexes negatively regulate inhibitory G protein signaling in neurons (Anderson, Posokhova et al., 2009; Gerber, Squires et al., 2016) and cardiomyocytes (Posokhova, Wydeven et al., 2010; Yang, Huang et al., 2010). For example, RGS7/Gβ5 sharpens the kinetics and dampens the sensitivity of GABABR-dependent coupling to G protein-gated inwardly rectifying K+ (GIRK) channels in hippocampal neurons (Ostrovskaya, Xie et al., 2014; Xie, Allen et al., 2010).

RGS6 also regulates inhibitory G protein signaling in neurons (Garzon, Lopez-Fando et al., 2003; Maity, Stewart et al., 2012; Stewart, Maity et al., 2014). Interestingly, RGS6–/– mice exhibited decreased alcohol consumption and reward, phenotypes partially restored by systemic administration of GABABR or D2R antagonists (Stewart, Maity et al., 2015). While the anatomic basis for the influence of RGS6 on alcohol consumption is unclear, voluntary ethanol consumption increased RGS6 expression in the VTA (Stewart, Maity et al., 2015). Moreover, RGS6 expression has been detected in VTA DA neurons in both newborn and adult mice (Bifsha, Yang et al., 2014; Stewart, Maity et al., 2015). The goal of this study was to address whether inhibitory G protein signaling pathways in VTA DA neurons are regulated by RGS6 and, if so, whether this influence impacts alcohol consumption. Our findings reveal that RGS6 modulates discrete aspects of GABABR- and D2R-dependent signaling in VTA DA neurons, and that loss of RGS6 in VTA DA neurons suppresses binge alcohol consumption in female but not male mice.

METHODS

Animals.

Reporting related to the animal studies in this manuscript conforms with ARRIVE guidelines (Kilkenny, Browne et al., 2010). All studies were approved by the Institutional Animal Care and Use Committee at the University of Minnesota (Protocol ID 2012–38714A). RGS6–/– mice were generated and characterized previously (Posokhova, Wydeven et al., 2010), and kindly provided by Dr. Kirill Martemyanov. C57BL/6J mice, bred on site or purchased from The Jackson Laboratory, were used as wild-type (WT) controls for some studies. B6.SJL-Slc6a3tm1.1(cre)Bkmn/J mice (stock #006660, The Jackson Laboratory; Bar Harbor, ME), hereafter referred to as DATCre(+) mice, were used in viral overexpression experiments. DATCre(+) mice were also crossed with a Cre-dependent Cas9GFP knock-in line (B6;129-Gt(ROSA)26Sortm1(CAG-cas9*,-EGFP)Fezh/J, The Jackson Laboratory, stock #026179), to generate DATCre(+) subjects homozygous for the Cas9GFP(+) mutation; these mice are referred to throughout as DATCre(+):Cas9GFP(+) mice and were used in all viral CRISPR/Cas9 ablation studies, as described (DeBaker, Marron Fernandez de Velasco et al., 2021). Genotypes of all mutant mice were determined using validated PCR-based protocols. All mice were group-housed; subjects involved in drinking studies were individually housed prior to assessments to monitor drinking. Mice were maintained on a 14:10 h light/dark cycle and were provided ad libitum access to food and water.

Reagents.

Baclofen, quinpirole, sulpiride, kynurenic acid, and picrotoxin were purchased from Sigma (St. Louis, MO), and CGP54626 was purchased from Tocris (Bristol, UK). Adeno-associated viruses (AAVs) used in this study were packaged in AAV8 serotype unless otherwise noted; the University of Minnesota Viral Vector and Cloning Core provided all but one vector used in this study, at titers ranging from 0.7–4 × 1013 genocopies/mL. AAV9-CaMKIIα-hChR2(H134R)-mCherry was a gift from Dr. Karl Deisseroth (Addgene viral prep # 26975-AAV9), for use in ex vivo optogenetic experiments. Packaging plasmids (pRC8 and pHelper) were obtained from the University of Pennsylvania Vector Core. For CRISPR/Cas9 experiments, the pAAV-U6-gRNA-hSyn-NLSmCherry was generated using the backbone of the plasmid pAAV-U6-gRNA-hSyn-Cre-2A-EGFP-KASH (Platt et al., 2014) (Addgene plasmid #60231) that was a gift from Dr. Feng Zhang. Guide RNA (gRNA) sequences targeting RGS6, G⍺o, and LacZ were as follows: RGS6 – TGTAGCCCTGGGCGGCAATA, G⍺o – GTCGCCCCAGAGTCGCATCA, LacZ – TGCGAATACGCCCACGCGAT. AAV8-hSyn-DIO-RGS6-IRES-GFP was used to overexpress RGS6 in a Cre-dependent manner, and AAV8-hSyn-DIO-hSyn-GFP served as control vector for these studies.

In situ hybridization.

Adult (8–10 wk) C57BL/6J mice were killed by rapid decapitation following isoflurane anesthesia (induction chamber with 1 mL isoflurane); brains were removed, snap frozen in isopentane, and sectioned by cryostat (16 μm). Sections were adhered to Superfrost® Plus slides, kept at −20° C for 60 min to dry, and stored at −80° C until use. Sections were fixed with 4% paraformaldehyde for 1 h and processed for multichannel fluorescent in situ hybridization (RNAScope) according to manufacturer instructions (Advanced Cell Diagnostics/ACD; Newark, CA). Sections were counterstained with DAPI for 20 s at room temperature, cover-slipped with Prolong Gold Antifade (ThermoFisher Scientific), and stored at 4° C. Probes for detection of DAT (NM_010020.3; target region 1486–2525), Gβ5 (NM_010313.2; target region 359–1273), and RGS6 (NM_001310478.2; target region 587–1628) were purchased from ACD, and fluorescent Opal dyes (Opal 520, 620, 690) for detection of specific probes were purchased from Akoya Biosciences (Marlborough, MA). Sections containing the VTA were imaged with a BZ-X810 epifluorescent microscope (Keyence; Itasca, IL). Images for each channel were obtained from multiple focus planes and stitched using Keyence BZ-X800 analysis software; all images were acquired and processed in the same manner. Multichannel images, including DAPI, were overlaid.

Multiple (3–4) mice per group per sex were analyzed, with 2–4 images analyzed independently from each mouse. For each image, the region of interest (ROI) was selected using the Computer Vision Toolbox in MATLAB (MathWorks; Natick, MA). ROIs consisted of a consistent-sized rectangle capturing the medial and lateral VTA. ROI images were exported from MATLAB to CellProfiler 4.0 (www.cellprofiler.org) (Stirling, Swain-Bowden et al., 2021). Background fluorescence was subtracted, intensity information was removed, and images were converted to grayscale. CellProfiler was used to identify the cell area and the probe puncta within the cell. The background probe expression in areas defined as non-cell was calculated and compared with probe expression within each defined cell using MATLAB. Cells were considered positive for that probe if the puncta expression was statistically different from background expression using a binomial distribution test with a Bonferroni correction for the number of cells. The percentage of DAT-positive cells in the ROI that lacked (−) or showed (+) expression of the target of interest was determined for each independent image, and an average across images from a single animal was calculated.

Electrophysiology.

Behaviorally naïve mice (35–93 d) were killed by rapid decapitation following isoflurane anesthesia (induction chamber with 1 mL isoflurane), and acutely isolated slices (225 μm) containing the VTA were prepared as described (DeBaker, Marron Fernandez de Velasco et al., 2021; McCall, Kotecki et al., 2017). Neurons in the lateral VTA were targeted for electrophysiological analysis as this sub-region of the VTA is enriched in neurons expressing traditional molecular (DAT) and functional (Ih and D2R-dependent inhibition) markers of DA neurons (Lammel, Lim et al., 2014; Lammel, Steinberg et al., 2015; Morales & Margolis, 2017), and because these neurons exhibit prominent GABABR-dependent inhibitory feedback (Edwards, Tejeda et al., 2017). In studies involving RGS6–/– or control mice, putative DA neurons were selected based on size (apparent capacitance >40 pF), presence of an Ih current (>80 pA), and low-to-moderate rates (<5 Hz) of spontaneous activity. All command potentials factored in a junction potential of −15 mV predicted using JPCalc software (Molecular Devices, LLC).

Whole-cell data were acquired using a Multiclamp 700A amplifier and pCLAMPv.9.2 software (Molecular Devices, LLC; San Jose, CA). Input/membrane resistance (RM) and apparent capacitance (CM) were measured using a 5 mV/10 ms voltage-step, with current responses filtered at 5 Hz. Immediately after establishing whole-cell access, Ih was measured using a 200-ms voltage step to −120 mV; the difference in current from beginning to end of the voltage step was taken as Ih amplitude. Subsequently, spontaneous activity was measured in current-clamp mode (I=0) for 1 min. Neurons exhibiting no spontaneous activity were not evaluated further. For rheobase assessments, cells were held in current-clamp mode at −80 pA to prevent spontaneous activity, and then given 1-s current pulses, beginning at −100 pA and increasing in 20 pA increments. Rheobase was defined as the minimum current step that evoked one or more action potentials. Somatodendritic currents evoked by baclofen or quinpirole, applied via bath perfusion, were measured at −60 mV. Concentrations of baclofen and quinpirole evoking maximal and half-maximal current responses in VTA DA neurons, as well as concentrations of GABABR (CGP54626) and D2R (sulpiride) antagonists were chosen based on prior published studies (DeBaker, Marron Fernandez de Velasco et al., 2021; McCall, Kotecki et al., 2017; McCall, Marron Fernandez de Velasco et al., 2019). Series and input resistances were tracked throughout each experiment. If series resistance was unstable or exceeded 20 MOhm, the experiment was excluded from analysis.

For optogenetic experiments, the bath solution contained kynurenic acid (2 mM) and picrotoxin (100 μM) to block responses mediated by glutamate and GABAA receptors, respectively. Optical stimulation was provided via a 200 μm fiber aimed above the entire slice through a 4x objective; responses were obtained with a 1-s stimulation protocol containing 20 pulses of 473 nm wavelength light (2–5 mW, 3 ms pulse width), a protocol was shown to evoke GABABR-dependent inhibitory postsynaptic currents (IPSCs) in VTA DA neurons (Edwards, Tejeda et al., 2017). The GABABR antagonist CGP54626 (2 μM) was applied to verify the GABABR-dependence of optically evoked responses. Separate single-term exponential fits were assigned to the activation and deactivation phases of the optically evoked IPSCs in ClampFit (Molecular Devices, LLC; San Jose, CA).

Intracranial manipulations.

Mice (≥45 d) were weighed, anesthetized with a mixture of oxygen (0.5 mL/min) and isoflurane (2%) delivered via nose cone, and then placed in a stereotaxic frame using a bite bar (David Kopf Instruments; Tujunga, CA). Heads were shaved, eyes were fully covered with Artificial Tears ointment (Akorn; Gurnee, IL) applied using a sterile cotton swab, carprofen (5 mg/Kg) and gentamycin (5 mg/Kg) were administered via subcutaneous injection, and a betadine swab was used to clean the head prior to making an incision, centering and leveling the mouse skull, and drilling burr holes in the skull. Microinjectors were made by affixing a 33-gauge stainless steel hypodermic tube within a shorter 26-gauge stainless steel hypodermic tube; injectors were attached to polyethylene-20 tubing affixed to 10 μL Hamilton syringes, and were lowered through burr holes in the skull to the VTA (from bregma: −2.75 mm A/P, ±0.55 mm M/L, −5 mm D/V); 400 nL of virus per side was injected at a rate of 100 nL/min. Optimized coordinates and viral load were employed to maximize coverage of the VTA along anterior/posterior and rostral-caudal axes, with minimal spread into the adjacent substantia nigra pars compacta (McCall, Kotecki et al., 2017). For neuron-specific RGS6 over-expression and ablation studies involving DATCre(+) or DATCre(+):Cas9GFP(+) mice, respectively, subjects were randomly assigned to viral treatment groups. For optogenetic slice electrophysiological experiments, microinjectors were lowered to the NAc (from bregma: +1.7 mm A/P, ± 1.7 M/L, −4.65 mm D/V); 400 nL of virus per side was injected at a rate of 100 nL/min. Microinjectors were left in place for 10 min following infusion to reduce solution backflow along the infusion track.

Following viral infusion, incisions were closed with sutures (3–5) and Gluture (World Precision Instruments, LLC; Sarasota, FL). Mice were removed from the stereotaxic frame and placed in a recovery cage seated on a heating pad until recovery. Ibuprofen (150 mg/500 mL) was administered via drinking water for 2 d post-surgery. Slice electrophysiology and behavioral experiments were performed 5–6 wk after viral infusion for CRISPR/Cas9 ablation experiments, and 3–4 wk after viral infusion for all other studies. Following behavioral testing, mice were killed by rapid decapitation following isoflurane anesthesia (induction chamber with 1 mL isoflurane). The scope and accuracy of viral targeting was assessed by fluorescence microscopy; 225 μm horizontal slices of the midbrain were used for analysis of viral targeting. Only data from animals with bilateral viral-driven fluorescence, where the majority of fluorescence was confined to VTA (with minimal spread to the adjacent substantia nigra), were included in the final analysis.

Behavior.

Mice (≥53 d) were weighed and singly housed before the start of the drinking-in-the-dark (DID) procedure to facilitate measurement of individual intake. Unsweetened alcohol (ethanol) (Decon Labs, King of Prussia, PA) was mixed with tap water to 20% (v/v) for each experiment. The water bottle was replaced with an alcohol bottle for 2 h on Days 1 to 3, and 4 h on Day 4, beginning 2 h after the start of the dark cycle. Mice had free access to water at all other times. Ethanol consumption was measured by bottle weights before and after each drinking session. To account for bottle drippage and/or evaporation, sentinel bottles were placed in an empty mouse cage in the testing room and were weighed before and after each session. The change in sentinel bottle weight was subtracted from mouse consumption values during the session. Intake values were then calculated as amount of ethanol consumed (g) divided by mouse bodyweight (Kg).

Data and analysis.

This publication complies with all journal recommendations and requirements related to experimental design and analysis (Curtis, Alexander et al., 2018). Data are presented throughout as the mean±SEM. All studies were designed to yield groups of approximately equal size, balanced by sex. Statistical analysis was only undertaken for those studies where group size was at least 5. Declared group sizes for multiplex in situ hybridization and behavioral data represent the number of independent values. For slice electrophysiological studies, the number of animals (N) and individual experiments (n) are provided; experiment (n) was the experimental unit used for analysis purposes. All data analysis was conducted in blind fashion, using Prism v.9 (GraphPad Software, La Jolla, CA); specific tests employed and statistical outputs are included in Table 1 and Figure Legends. All datasets presented in this study satisfied assumptions related to the use of parametric statistics, as assessed using the D’Agostino-Pearson test. Data points that fell outside the range of 2 standard deviations from the mean were excluded from analysis. Data were analyzed first for sex effects. Electrophysiological parameters were evaluated by 2-way ANOVA with sex and either viral treatment or genotype as factors. If a main effect of sex or an interaction between sex and viral treatment or genotype was not detected, within treatment or genotype data for male and female subjects were pooled and the combined data were analyzed by unpaired Student’s t test or unpaired t test with Welch’s correction if the groups had unequal variances. If a significant interaction between sex and either genotype or viral treatment was detected, and there was no significant variance in homogeneity, multiple comparisons were conducted with Sidak’s post hoc test. Alcohol consumption during days 1–3 of the DID procedure was evaluated using 3-way ANOVA with repeated measures, with sex, genotype or viral treatment, and day as factors. Alcohol consumption during the day 4 binge session was evaluated using 2-way ANOVA, with sex and either genotype or viral treatment as factors. Differences were considered significant if P < 0.05.

Table 1.

Electrophysiological properties of VTA DA neurons

Groups N/n CM (pF) RM (MΩ) Ih (pA) Activity (Hz) Rheobase (pA)
LacZ gRNA 7/14 62 ± 2 213 ± 25 316 ± 49 1.6 ± 0.2 −19 ± 4
Gαo gRNA 7/13 70 ± 4 177 ± 13 382 ± 56 1.6 ± 0.3 −11 ± 4
F(sex) 2.42 (P=0.13) 0.84 (P=0.37) 1.22 (P=0.28) 1.53 (P=0.23) 0.02 (P=0.88)
F(interaction) 0.71 (P=0.41) 2.84 (P=0.11) 1.67 (P=0.21) 1.65 (P=0.21) 0.35 (P=0.56)
unpaired t test t19.59=1.78 t19.69=1.28 t24.23=0.89 t18.21=0.029 t25=1.26
P=0.090 P=0.22 P=0.38 P=0.98 P=0.22
wild-type 12/24 72 ± 3 200 ± 19 413 ± 38 1.7 ± 0.2 −24 ± 3
Rgs6 –/– 11/25 65 ± 3 216 ± 17 433 ± 52 1.9 ± 0.2 −22 ± 4
F(sex) 1.55 (P=0.22) 0.02 (P=0.90) 1.02 (P=0.32) 0.13 (P=0.72) 0.09 (P=0.77)
F(interaction) 0.65 (P=0.42) 0.02 (P=0.89) 0.07 (P=0.79) 0.08 (P=0.78) 1.81 (P=0.19)
unpaired t test t47=1.85 t45.93=0.64 t43.36=0.32 t45.2=0.67 t46.69=0.37
P=0.071 P=0.53 P=0.75 P=0.51 P=0.71
LacZ gRNA 19/26 65 ± 3 192 ± 11 343 ± 29 1.3 ± 0.1 −12 ± 3
RGS6 gRNA 16/22 68 ± 2 184 ± 11 297 ± 28 1.5 ± 0.2 −19 ± 3
F(sex) 1.92 (P=0.17) 3.21 (P=0.08) 0.007 (P=0.93) 0.32 (P=0.58) 0.06 (P=0.80)
F(interaction) 1.93 (P=0.17) 1.99 (P=0.17) 1.85 (P=0.18) 1.01 (P=0.32) 0.06 (P=0.80)
unpaired t test t45.94=0.68 t45.16=0.51 t45.97=1.13 t39.73=0.65 t45.24=1.59
P=0.49 P=0.62 P=0.27 P=0.52 P=0.12
GFP 6/12 63 ± 3 205 ± 23 301 ± 47 1.3 ± 0.2 −15 ± 4
RGS6(GFP) 9/14 61 ± 3 200 ± 15 292 ± 43 1.6 ± 0.2 −17 ± 5
F(sex) 0.08 (P=0.79) 0.49 (P=0.49) 2.29 (P=0.14) 0.13 (P=0.72) 1.56 (P=0.23)
F(interaction) 0.74 (P=0.40) 0.48 (P=0.49) 0.62 (P=0.44) 0.83 (P=0.37) 0.12 (P=0.74)
unpaired t test t23.46=0.55 t19.48=0.18 t23.27=0.13 t23.91=1.21 t21.39=0.31
P=0.59 P=0.86 P=0.90 P=0.24 P=0.76
Open in a new tab

Electrophysiological parameters extracted from whole-cell recordings of VTA DA neurons from DATCre(+):Cas9GFP(+) mice treated with intra-VTA control (LacZ) or Gαo gRNAs (Fig. 1); wild-type or constitutive RGS6–/– mice (Fig. 2); DATCre(+):Cas9GFP(+) mice treated with intra-VTA LacZ (control) or RGS6 gRNA vectors (Fig. 3); and DATCre(+) mice treated with intra-VTA control (GFP) or RGS6(GFP) overexpression vectors (Fig. 4). All data were analyzed first by two-way ANOVA with sex and either genotype or viral treatment as factors; results of those analyses are included in the table. No main effects of sex or interactions involving sex were detected in these analyses and thus, data from male and female subjects were pooled and re-analyzed by unpaired t test (with and without Welch’s correction, as appropriate). Abbreviations: N/n - number of mice/total number of experiments; CM – apparent cell capacitance; RM – input/membrane resistance; Ih – hyperpolarization-activated current; activity – spontaneous firing rate during the 1-min following establishment of whole-cell access.

RESULTS

Expression of RGS6 in adult mouse VTA DA neurons

We used multiplex in situ hybridization to determine whether RGS6 and its binding partner Gβ5 are expressed in VTA DA neurons of the adult C57BL/6J mouse brain. DA neurons were identified based on expression of the dopamine transporter (DAT) (Morales & Margolis, 2017). Analysis of sections from adult male and female C57BL/6J mice revealed that Gβ5 and RGS6 were expressed throughout the VTA, in both DAT-positive and DAT-negative cells (Fig. 1A,B). Consistent with prior reports (Bifsha, Yang et al., 2014; Stewart, Maity et al., 2015), Gβ5 and RGS6 transcripts were detected in the vast majority (>90%) of DAT-positive cells in the adult mouse VTA (Fig. 1B).

Figure 1. RGS6 and Gβ5 are expressed in VTA DA neurons of the adult C57BL/6J mouse.

Figure 1.

Open in a new tab

A. Representative images from multiplex in situ hybridization experiments showing expression of Gβ5 (red; left panel) or RGS6 (red; right panel) in cells of the adult C57BL/6J mouse VTA. DAT expression is indicated in green and DAPI labeling is shown in blue. Scale bar: 20 μm.

B. Summary of coded analysis of images from the multiplex in situ hybridization experiments. Expression of each target in the VTA was evaluated in 3–4 mice per sex. The percentage of DAT-positive cells that lacked (−) or showed (+) expression of the target of interest was determined for each subject; squares and circles denote datapoints from male and female subjects, respectively. Approximately 99% of DAT-positive cells express Gβ5 and 90% of DAT-positive cells express RGS6.

Gαo ablation and somatodendritic inhibitory G protein signaling in VTA DA neurons

R7 RGS proteins like RGS6 exhibit a strong substrate preference for Gαo over Gαi (Hooks, Waldo et al., 2003; Masuho, Balaji et al., 2020), and as such, signaling pathways that rely on Gαo are strong candidates for regulation by RGS6. To determine whether GABABR- and D2R-dependent signaling pathways in VTA DA neurons are potential targets of regulation by RGS6, we ablated Gαo in VTA DA neurons using a DA neuron-specific viral CRISPR/Cas9 ablation approach (DeBaker, Marron Fernandez de Velasco et al., 2021). DATCre(+):Cas9GFP(+) mice received intra-VTA infusions of AAV vectors harboring Gαo-specific or control (LacZ) guide RNA (gRNA) (Fig. 2A). Subsequently (5–6 wk later), we measured baseline neuronal excitability (spontaneous activity and rheobase), as well as D2R- and GABABR-dependent somatodendritic currents, in VTA DA neurons (defined by GFP and mCherry fluorescence) from acutely isolated midbrain slices.

Figure 2. Gαo mediates D2R- and GABABR-dependent signaling in VTA DA neurons.

Figure 2.

Open in a new tab

A. Viral targeting in a DATCre(+):Cas9GFP(+) mouse. GFP fluorescence shows the Cre-dependent expression of Cas9GFP in DA neurons of the VTA and substantia nigra pars compacta (green, left panel), and nucleus-localized mCherry fluorescence (red, middle panel) reveals the scope of viral targeting; the right panel shows the GFP/mCherry overlay. Abbreviations: MT – medial terminal nucleus of the accessory optic tract; PBP – parabrachial pigmented nucleus of the VTA; SNC – substantia nigra pars compacta; SNR – substantia nigra pars reticulata; VTAR – rostral part of the VTA. Scale: 400 μm.

B. Somatodendritic currents (Vhold= −60 mV) evoked by bath application of quinpirole (quin, 20 μM) and then baclofen (bac, 200 μM) in VTA DA neurons from DATCre(+):Cas9GFP(+) mice treated with vectors harboring LacZ control (upper trace) or Gαo-specific (lower trace) gRNAs. Quinpirole-induced currents were reversed by the D2/3R antagonist sulpiride (sulp, 5 μM) and baclofen-induced currents were reversed by the GABABR antagonist CGP54626 (CGP, 2 μM).

C. Peak currents evoked by quinpirole in VTA DA neurons from DATCre(+):Cas9GFP(+) mice treated with LacZ or Gαo gRNA-containing vector. Data points from male and female subjects are indicated in this and all following figures by squares and circles, respectively. Two-way ANOVA did not reveal a main effect of sex (F1,23=0.04; P=0.84) or interaction between sex and viral treatment (F1,23=0.09; P=0.76), so within-treatment data from male and female subjects were pooled and re-analyzed by unpaired t test with Welch’s correction (t19.61=3.01; **P=0.0070; N=7 mice/viral treatment and n=13–14 recordings/viral treatment).

D. Peak currents evoked by baclofen (after quinpirole) in VTA DA neurons from DATCre(+):Cas9GFP(+) mice treated with LacZ or Gαo gRNA-containing vectors. Two-way ANOVA did not reveal a main effect of sex (F1,23=1.40; P=0.25) or interaction between sex and viral treatment (F1,23=1.27; P=0.27), so within-treatment data from male and female subjects were pooled and re-analyzed by unpaired t test with Welch’s correction (t20.22=6.85; ****P<0.0001).

VTA DA neurons from Gαo gRNA-treated or LacZ gRNA-treated control mice did not differ in terms of spontaneous activity or rheobase, nor were differences detected in other physiological properties including apparent capacitance, input resistance, or Ih current amplitude (Table 1). In VTA DA neurons from mice treated with Gαo gRNA, however, peak somatodendritic currents evoked by the D2/3R agonist quinpirole were ~40% smaller than those measured in controls (Fig. 2B,C). Similarly, peak currents evoked by the GABABR agonist baclofen were ~50% lower in VTA DA neurons from Gαo gRNA-treated mice relative to controls (Fig. 2B,D). We detected no main effect of sex, or interaction between sex and viral treatment, in any measured outcome. Thus, Gαo mediates a substantial fraction of somatodendritic D2R- and GABABR-dependent signaling in VTA DA neurons from adult male and female mice.

D2R- and GABABR-dependent signaling dynamics in VTA DA neurons from RGS6–/– mice

We next examined the impact of RGS6 ablation on D2R- and GABABR-dependent somatodendritic currents in putative VTA DA neurons, using slices from RGS6–/– and wild-type mice. As we observed with Gαo ablation in VTA DA neurons, spontaneous activity and rheobase did not differ in VTA DA neurons from RGS6–/– and wild-type mice, suggesting that neither Gαo nor RGS6 regulates the baseline excitability of these neurons (Table 1). Furthermore, we observed no difference in sensitivity to baclofen (Fig. 3A,B) or in maximal baclofen-induced current amplitude (Fig. 3C) in putative VTA DA neurons from RGS6–/– and control mice. While there was also no difference in the sensitivity of putative VTA DA neurons from RGS6–/– and WT mice to quinpirole (Fig. 3D,E), two-way ANOVA of maximal quinpirole-induced currents revealed main effects of both sex and genotype (Fig. 3F); there was no interaction between sex and genotype. Loss of RGS6 correlated with larger maximal quinpirole currents in putative VTA DA neurons from both sexes and, consistent with our previous report (DeBaker, Marron Fernandez de Velasco et al., 2021), maximal quinpirole-induced currents in putative VTA DA neurons from females were larger than those in males, irrespective of genotype. Collectively, these data show that RGS6 suppresses the amplitude of D2R-dependent (but not GABABR-dependent) somatodendritic currents in VTA DA neurons, but it does not impact sensitivity of VTA DA neurons to activation of either inhibitory G protein signaling pathway.

Figure 3. GABABR- and D2R-dependent currents in VTA DA neurons from wild-type and RGS6–/– mice.

Figure 3.

Open in a new tab

A. Somatodendritic currents (Vhold =−60 mV) evoked by EC50 (bac(50); 10 μM) and maximal (bac(max); 200 μM) doses of baclofen, measured in putative VTA DA neurons from wild-type (upper) and RGS6–/– (lower) mice. Currents were reversed by the GABABR antagonist CGP54626 (CGP, 2 μM).

B. Baclofen sensitivity (ratio of current evoked by EC50 and maximal baclofen doses; bac(50)/bac(max), expressed as a percentage) of putative DA neurons from wild-type (WT) and RGS6–/– mice. Two-way ANOVA did not reveal a main effect of sex (F1,20=0.0003; P=0.99) or interaction between sex and genotype (F1,20=0.49; P=0.49), so within-genotype data from male and female subjects were pooled and re-analyzed by unpaired t test with Welch’s correction (t21.99=0.25, P=0.80; N= 5–6 mice/genotype and n=12–13 experiments/genotype).

C. Maximal currents evoked by baclofen (200 μM) in putative DA neurons from WT and RGS6–/– mice). Two-way ANOVA did not reveal a main effect of sex (F1,20=0.62; P=0.44) or interaction between sex and genotype (F1,20=0.03; P=0.87), so within-genotype data from male and female subjects were pooled and re-analyzed by unpaired t test with Welch’s correction (t20.28=0.15; P=0.88).

D. Somatodendritic currents (Vhold =−60 mV) evoked by EC50 (quin(50); 60 nM) and maximal (quin(max); 20 μM) doses of quinpirole, measured in putative VTA DA neurons from wild-type (upper) and RGS6–/– (lower) mice. Currents were reversed by the D2/3R-selective antagonist sulpiride (sulp, 5 μM).

E. Quinpirole sensitivity (ratio of currents evoked by EC50 and maximal quinpirole doses; quin(50)/quin(max), expressed as a percentage) of putative DA neurons in from wild-type (WT) and RGS6–/– mice. Two-way ANOVA did not reveal a main effect of sex (F1,21=3.60; P=0.07) or interaction between sex and genotype (F1,21=0.97; P=0.34), so within-genotype data from male and female subjects were pooled and re-analyzed by unpaired t test with Welch’s correction (t20.12=1.90, P=0.072; N=6 mice/genotype and n=11–13 experiments/genotype).

F. Maximal currents evoked by quinpirole in putative DA neurons from WT and RGS6–/– mice Two-way ANOVA revealed main effects of sex (F1,21=5.10, *P=0.035) and genotype (F1,21=8.85, **P=0.0072) but no interaction between sex and genotype (F1,21=0.10, P=0.75; N=3 mice/sex and genotype and n=6–7 experiments/sex and genotype).

Given the dependence of GABABR-dependent somatodendritic currents on Gαo (Fig. 2), the lack of impact of RGS6 ablation on either baclofen-induced current sensitivity (Fig. 3B) or maximal baclofen-induced current amplitude (Fig. 3C) in VTA DA neurons was surprising. R7 RGS proteins can also accelerate the kinetics of GABABR-dependent signaling (Maity, Stewart et al., 2012; Ostrovskaya, Xie et al., 2014; Xie, Allen et al., 2010). To test whether RGS6 influences the kinetics of GABABR-dependent responses in VTA DA neurons, we used an optogenetic approach with better temporal resolution to measure synaptically evoked GABABR-dependent inhibitory postsynaptic currents (IPSCs) in VTA DA neurons, as described (Edwards, Tejeda et al., 2017). Synaptic IPSCs were reliably evoked by optogenetic stimulation of channelrhodopsin-expressing (hChR2(H134R)) NAc terminals in the VTA (Fig. 4A,B), and these currents were blocked by the GABABR-selective antagonist CGP54626 (2 μM; not shown). While the activation rate of optically evoked GABABR-dependent IPSCs in putative VTA DA neurons from RGS6–/– mice did not differ from controls (Fig. 4C), two-way ANOVA of deactivation rate revealed an interaction between sex and genotype. The deactivation rate of optically evoked IPSCs was significantly longer in VTA DA neurons from male and female RGS6–/– mice, relative to wild-type counterparts. Thus, while RGS6 does not regulate the sensitivity or amplitude of GABABR-dependent somatodendritic currents in VTA DA neurons, it does negatively regulate the kinetics of synaptically evoked GABABR-dependent currents.

Figure 4. Optically evoked GABABR-dependent IPSCs in VTA DA neurons from wild-type and RGS6–/– mice.

Figure 4.

Open in a new tab

A. mCherry fluorescence in the nucleus accumbens (NAc) of an RGS6–/– mouse treated with AAV8-CaMKIIα-hChR2(H134R)-mCherry vector. Abbreviations: AC – anterior commissure. Scale: 250 μm.

B. GABABR-dependent inhibitory postsynaptic currents (Vhold= −60 mV) measured in putative VTA DA neurons from RGS6–/– (red) mice and wild-type controls (gray), evoked by optical stimulation (blue bar) of hChR2-expressing NAc terminals in the VTA; the lower traces show that evoked responses were blocked by bath perfusion of the GABABR-selective antagonist CGP54626 (2 μM, lower trace). Scale bars: 20 pA/500 ms.

C. Activation rate (tau) of light-evoked IPSCs in putative VTA DA neurons from wild-type (WT) and RGS6–/– mice. Two-way ANOVA did not reveal a main effect of sex (F1,23=0.37; P=0.55) or interaction between sex and genotype (F1,23=0.47; P=0.50), so within-genotype data from male and female subjects were pooled and re-analyzed by unpaired t test with Welch’s correction (t22.18=1.36, P=0.19; N=5–6 mice/genotype and n=12–13 experiments/genotype).

D. Deactivation rate (tau) of light-evoked IPSCs in putative VTA DA neurons from WT and RGS6–/– mice. Two-way ANOVA did not reveal a main effect of sex (F1,20= 0.91, P=0.35), but did detect main effect of genotype (F1, 20=41.42, P<0.0001) and an interaction between sex and genotype (F1,20=10.29, P=0.0044). Sidak’s multiple comparisons test revealed significant genotype differences in deactivation rate in putative VTA DA neurons from both male (*P=0.042) and female (****P<0.0001) mice (N=2–3 mice/sex and genotype and n=5–7 experiments/sex and genotype).

Bi-directional influence of RGS6 on D2R-dependent signaling in VTA DA neurons

As constitutive RGS6 ablation may provoke developmental adaptations that could impact or obscure roles for RGS6 in VTA DA neurons, we used the viral CRISPR/Cas9 approach to ablate RGS6 in adult VTA DA neurons. To validate the efficacy of this manipulation, we measured quinpirole sensitivity and maximal quinpirole-induced somatodendritic currents in VTA DA neurons from mice treated with control (LacZ) or RGS6 gRNA, 5–6 wk after viral treatment. We observed no difference in spontaneous activity, rheobase, or other electrophysiological parameters in VTA DA neurons from control- and RGS6 gRNA-treated mice (Table 1). Consistent with observations in VTA DA neurons from constitutive RGS6–/– mice, RGS6 gRNA treatment did not impact quinpirole sensitivity in VTA DA neurons (Fig. 5A,B), but it did correlate with modestly larger maximal quinpirole-induced somatodendritic currents (Fig. 5C); no main effect of sex or interaction between sex and viral treatment was detected in this study.

Figure 5. Impact of RGS6 ablation and overexpression on D2R-dependent somatodendritic currents in VTA DA neurons.

Figure 5.

Open in a new tab

A. Somatodendritic currents (Vhold =−60 mV) evoked by EC50 (quin(50); 60 nM) and maximal (quin(max); 20 μM) doses of quinpirole, measured in VTA DA neurons from DATCre(+):Cas9GFP(+) mice treated with AAV8-U6-gLacZ-hSyn-NLSmCherry (LacZ) control or AAV8-U6-gRGS6-hSyn-NLSmCherry (RGS6) vector. Currents were reversed by sulpiride (sulp, 5 μM).

B. Quinpirole sensitivity (ratio of currents evoked by EC50 and maximal quinpirole doses; quin(50)/quin(max), expressed as a percentage) of VTA DA neurons from DATCre(+):Cas9GFP(+) mice treated with LacZ control or RGS6 gRNA vector. Two-way ANOVA did not reveal a main effect of sex (F1,44=0.97; P=0.33) or interaction between sex and viral treatment (F1,44=1.41; P=0.24), so within-viral treatment data from male and female subjects were pooled and re-analyzed by unpaired t test with Welch’s correction (t46.00=1.29; P=0.20; N=16–19 mice/viral treatment and n=22–26 experiments/viral treatment).

C. Maximal currents evoked by quinpirole in VTA DA neurons from DATCre(+):Cas9GFP(+) mice treated with LacZ control or RGS6 gRNA vector. Two-way ANOVA did not reveal a main effect of sex (F1,44=0.0016; P=0.97) or interaction between sex and viral treatment (F1,45=0.009; P=0.92), so within-viral treatment data from male and female subjects were pooled and re-analyzed by unpaired t test with Welch’s correction (t40.93=2.17; *P=0.036; N=16–19 mice/viral treatment and n=22–26 experiments/viral treatment). Three data points from male subjects, 1 from the LacZ gRNA and 2 from the RGS6 gRNA treatment group, were identified as outliers and excluded from final analysis.

D. Somatodendritic currents (Vhold =−60 mV) evoked by EC50 (quin(50), 60 nM) and maximal (quin(max), 20 μM) doses of quinpirole, measured in VTA DA neurons from DATCre(+) mice treated with AAV8-DIO-hSyn-GFP (control) or AAV8-DIO-hSyn-RGS6-IRES-GFP (RGS) vector. Currents were reversed by sulpiride (Sulp, 5 μM).

E. Quinpirole sensitivity (ratio of currents evoked by EC50 and maximal quinpirole doses; quin(50)/quin(max), expressed as a percentage) of VTA DA neurons from DATCre(+) mice treated with Cre-dependent control or RGS6 expression vector. Two-way ANOVA did not reveal a main effect of sex (F1,22=2.75; P=0.11) or interaction between sex and viral treatment (F1,22=2.82; P=0.11), so within-viral treatment data from male and female subjects were pooled and re-analyzed by unpaired t test with Welch’s correction (t21.46=0.90, P=0.38; N=6–9 mice/viral treatment and n=12–14 experiments/viral treatment).

F. Maximal currents evoked by quinpirole in VTA DA neurons from DATCre(+) mice treated with control or RGS6 expression vector. Two-way ANOVA revealed main effects of viral treatment (F1,22=8.10, **P=0.0095) and sex (F1,22=7.19, *P=0.014), but no interaction between sex and viral treatment (F1,22=0.6404, P=0.4321; N=3–6 mice/sex and genotype and n=6–7 experiments/sex and genotype).

We also used DATCre(+) mice and a Cre-dependent RGS6 expression vector to ask whether RGS6 overexpression in VTA DA neurons could suppress D2R-dependent somatodendritic currents. Overexpression of RGS6 did not impact spontaneous activity, rheobase, or other measured parameters in VTA DA neurons from DATCre(+) mice (Table 1). Quinpirole sensitivity was comparable in VTA DA neurons from mice treated with RGS6 overexpression or control vector (Fig. 5D,E). However, two-way ANOVA analysis of maximal quinpirole-induced current amplitudes revealed main effects of sex and viral treatment, but no interaction between sex and viral treatment (Fig. 5F). These data suggest that the amplitude of D2R-dependent somatodendritic currents in VTA DA neurons negatively correlates with the level of RGS6 expression in these neurons.

Impact of constitutive and neuron-specific RGS6 ablation on alcohol consumption

Constitutive Rgs6–/– mice consumed less alcohol than wild-type counterparts in a 4-wk, 24-h access alcohol consumption paradigm (Stewart, Maity et al., 2015). To assess if RGS6 ablation also impacts acute binge-like alcohol consumption, we utilized a well-established “drinking-in-the-dark” (DID) model (Rhodes, Best et al., 2005; Thiele, Crabbe et al., 2014). This model mimics human binge drinking, as mice can achieve blood ethanol concentrations of 0.08 g% or higher (Crabbe, Ozburn et al., 2017), a level considered to be intoxicating for humans. Ethanol consumption was measured during drinking sessions over 4 consecutive days, with day 4 considered as the “binge” day.

We analyzed drinking in RGS6–/– and wild-type counterparts across the first 3 days of testing using 3-way ANOVA with repeated measures. As a main effect of sex was detected (F1,42=7.62, P=0.0085), we analyzed data from male and female subjects separately using 2-way ANOVA with repeated measures. Male RGS6–/– mice drank significantly less than wild-type male counterparts; main effects of day and genotype were observed (Fig. 6A), but there was no interaction between day and genotype. Analysis of female data revealed a main effect of day, but neither a main effect of genotype nor an interaction between day and genotype was observed (Fig. 6B). Two-way ANOVA analysis of alcohol consumption during the day 4 binge session also revealed main effects of sex and genotype, but no interaction between sex and genotype (Fig. 6C). RGS6–/– mice drank significantly less than wild-type counterparts, and females drank moderately more than males during this session, irrespective of genotype.

Figure 6. Impact of RGS6 ablation on binge alcohol consumption.

Figure 6.

Open in a new tab

A. Two-way repeated measures ANOVA of alcohol consumption for male WT and RGS6–/– mice across the first 3 d of the DID test. Main effects of day (F1.839, 38.63=9.66, P<0.001) and genotype (F1,21=4.53, *P=0.045) were observed, but there was no interaction between day and genotype (F2,42=0.52, P=0.60; N=11–12 mice/genotype).

B. Two-way repeated measures ANOVA of alcohol consumption for female WT and RGS6–/– mice across the first 3 days of the DID test. A main effect of day was detected (F1.969,41.34=18.32, P<0.0001; N=11–12 mice/genotype), but we did not detect a main effect of genotype (F1,21=0.34, P=0.57) or an interaction between day and genotype (F2,42=0.028, P=0.97).

C. Alcohol consumption for wild-type (WT) and RGS6–/– mice during the 4-h binge session (day 4). Two-way ANOVA revealed main effects of sex (F1,43=5.841, *P=0.020) and genotype (F1,43=12.79, ***P=0.0009), but no interaction between sex and genotype (F1,43= 0.2097, P=0.6493; N=11–12 mice per sex and genotype).

D. Two-way repeated measures ANOVA of alcohol consumption for male DATCre(+):Cas9GFP(+) mice treated with LacZ control or gRGS6 vector, as measured across the first 3 days of the DID test. Main effects of day (F1.872,41.19=1.60, P=0.21; N=11–13 mice/viral treatment) or viral treatment (F1,22=0.089, P=0.77) were not observed, nor was an interaction between day and viral treatment (F2,44=0.060, P=0.94).

E. Two-way repeated measures ANOVA of alcohol consumption for female DATCre(+):Cas9GFP(+) mice treated with LacZ control or gRGS6 vectors, as measured across the first 3 days of the DID test. Main effects of day (F1.962,43.16=2.75, P=0.076; N=11–13 mice/viral treatment) or viral treatment (F1,22=0.35, P=0.56) were not observed, nor was an interaction between day and viral treatment (F2,44=1.23, P=0.3017).

F. Alcohol consumption for DATCre(+):Cas9GFP(+) mice treated with AAV8-U6-gLacZ-hSyn-NLSmCherry (LacZ) control or AAV8-U6-gRGS6-hSyn-NLSmCherry (RGS6) vector, as measured during the day 4 binge session. Two-way ANOVA revealed main effects of viral treatment (F1,44=5.10, P=0.029; N=11–13 mice/sex and viral treatment) and sex (F1,44=38.52, P<0.0001), as well as a significant interaction between viral treatment and sex (F1,44=4.238, P=0.0455). Sidak’s multiple comparisons test revealed a significant difference in binge consumption between female control and RGS6 gRNA-treated mice (**P=0.0077); only within-sex comparisons are denoted in the interest of clarity.

We next used the viral CRISPR/Cas9 ablation approach to examine the impact of VTA DA neuron-specific ablation of RGS6 on binge-like alcohol consumption in mice. Analysis by 3-way ANOVA with repeated measures revealed a main effect of sex (F1,44=7.54, P=0.0087), and as such, we analyzed these data separately by sex. Two-way ANOVA with repeated measures failed to detect main effects of viral treatment during the 3 days leading up to the binge session for either males (Fig. 6D) or females (Fig. 6E). During the day 4 binge session (Fig. 6F), two-way ANOVA revealed an interaction between sex and viral treatment. While viral treatment did not impact male binge consumption, female mice treated with the RGS6 gRNA consumed significantly less alcohol than their controls. Thus, while both male and female constitutive RGS6–/– mice exhibited reduced binge-like alcohol consumption, selective ablation of RGS6 in VTA DA neurons correlated with reduced binge-like alcohol consumption in female mice only.

DISCUSSION & CONCLUSIONS

Fisher and colleagues showed previously that RGS6–/– mice exhibit diminished voluntary alcohol consumption and that systemic administration of GABABR or D2R antagonists partially rescued this deficit (Stewart, Maity et al., 2015). While the pharmacologic rescue suggests that enhancement of GABABR- and D2R-dependent signaling contributes to the reduced alcohol consumption, the anatomic and cellular basis of these findings are unclear. Here, we show that RGS6 is expressed in VTA DA neurons of the adult mouse and that it negatively regulates discrete aspects of D2R and GABABR-dependent somatodendritic signaling pathways. Furthermore, we report that binge-like alcohol consumption is also suppressed in constitutive RGS6–/– mice, and this deficit is recapitulated in female mice following selective ablation of RGS6 in VTA DA neurons.

R7 RGS proteins exhibit a strong substrate specificity for Gαo relative to Gαi (Hooks, Waldo et al., 2003; Masuho, Balaji et al., 2020), and this prompted our interest in Gαo and its potential contribution to inhibitory G protein signaling in VTA DA neurons. While signaling preferences for discrete Gα isoforms have not been defined systematically for GABABR, D2R can signal effectively through Gαo, Gαi and Gαz isoforms, with the greatest responses elicited via Gαo (Hauser, Avet et al., 2022; Masuho, Ostrovskaya et al., 2015; Von Moo, Harpsoe et al., 2022). Our efforts show that Gαo is a prominent mediator of somatodendritic GABABR- and D2R-dependent signaling in VTA DA neurons of the adult mouse. Indeed, the amplitude of currents evoked by activation of either receptor was reduced by 40–50% in VTA DA neurons from adult mice treated with the Gαo gRNA. The residual D2R- and GABABR-dependent currents seen following Gαo ablation might indicate that a significant proportion of inhibitory signaling regulator by these receptors is mediated by Gαi and thus not subject to strong modulation by R7 RGS proteins. It is also possible that under normal conditions these receptors preferentially engage Gαo, but that in the absence of Gαo they compensate by recruiting one or more Gαi isoforms.

Constitutive ablation of RGS6 correlated with increased amplitude of D2R-dependent somatodendritic currents, an effect recapitulated with VTA DA neuron-specific RGS6 ablation. Moreover, RGS6 overexpression suppressed the amplitude of D2R-dependent currents in VTA DA neurons, showing that the amplitude of D2R-dependent somatodendritic currents in VTA DA neurons can be bi-directionally regulated by RGS6. In contrast, RGS6 ablation had no impact on the amplitude of GABABR-dependent somatodendritic currents. Instead, RGS6 ablation prolonged the deactivation rate of evoked GABABR-dependent IPSCs in VTA DA neurons. These outcomes are reminiscent of findings from our recent study in sinoatrial nodal (SAN) cells (Anderson, Masuho et al., 2020); the amplitude of A1 adenosine receptor-induced currents was greater in SAN cells from RGS6–/– mice as compared to wild-type controls, while only the deactivation rate of M2 muscarinic receptor-mediated currents was impacted by RGS6 ablation. Thus, RGS6 can negatively regulate inhibitory G protein signaling in neurons and cardiomyocytes, but the nature of the regulation is dependent upon the GPCR.

The GPCR-dependent influence of RGS6 on inhibitory signaling could reflect differences in the relative stoichiometries of key signaling elements found within a particular cell type. For example, GABABR-dependent signaling in VTA DA neurons may be limited by effector availability, whereas D2R-dependent signaling may be limited by receptor availability. While the inhibitory effect of D2R and GABABR activation in VTA DA neurons is mediated by multiple somatodendritic effectors (Labouebe, Lomazzi et al., 2007; Philippart & Khaliq, 2018), most (>80%) of the current measured under the conditions employed in this study reflect the activation of G protein-gated inwardly rectifying K+ (GIRK/Kir3) channels formed by GIRK2 and GIRK3 (Cruz, Ivanova et al., 2004; Labouebe, Lomazzi et al., 2007). Loss of RGS6 (and its catalytic influence on GTP hydrolysis) should increase the pool of activated G proteins following receptor stimulation. If the strength of D2R-dependent signaling in VTA DA neurons is limited by D2R availability, increasing the pool of activated G proteins should yield larger D2R-induced currents. In contrast, if the strength of GABABR-dependent signaling in VTA DA neurons is limited by the effector (GIRK channel), then increasing the pool of activated G proteins should not impact the amplitude of the GABABR-induced current but it should prolong the deactivation kinetics. Consistent with this overall premise, viral over-expression of GIRK2 in VTA DA neurons increased the maximal amplitude of GABABR-dependent somatodendritic currents but did not significantly increase the amplitude of D2R-dependent currents (McCall, Marron Fernandez de Velasco et al., 2019).

Consistent with our previous report (DeBaker, Marron Fernandez de Velasco et al., 2021), we observed moderately larger D2R-induced somatodendritic current amplitudes in VTA DA neurons from female mice as compared to males (Fig. 3F). This relatively modest sex difference was evident in our analysis of maximal quinpirole-induced currents in VTA DA neurons from RGS6–/– mice and wild-type controls, and in our RGS6 over-expression study involving DATCre(+) mice (Fig. 5F), but it was not seen in our study involving DATCre(+):Cas9GFP(+) mice and the CRISPR/Cas9-mediated ablation of RGS6 (Fig. 5C). This discrepancy could reflect subtle changes in genetic background across the various strains used in this project. The substantial cell-to-cell variability in D2R expression levels across the heterogeneous population of VTA DA neurons in the mouse (Morales & Margolis, 2017), combined with the relatively unguided process for selecting cells for slice electrophysiological analysis, could also collaborate to mask a small but significant sex effect such as this.

Intra-VTA infusions of baclofen decreased binge alcohol consumption in mice (Moore & Boehm, 2009), and systemic injections of the D2R agonist quinpirole decreased alcohol sensitivity (Cohen, Perrault et al., 1997). While these studies lack cellular and/or anatomic specificity, a growing body of evidence suggests that inhibitory G protein signaling in VTA DA neurons shapes behavioral responses to drugs of abuse in rodents. For example, chemogenetic (hM4Di) inhibition of VTA DA neurons suppressed the motor stimulatory effect of cocaine and morphine in mice (DeBaker, Marron Fernandez de Velasco et al., 2021). Chemogenetic inhibition of VTA DA neurons has also been shown to reduce conditioned stimulus-induced alcohol seeking behavior (Valyear, Glovaci et al., 2020), and suppressed relapse to alcohol-seeking behavior (Liu, Jean-Richard-Dit-Bressel et al., 2020). Our results suggest that loss of RGS6, and the corresponding enhancement of VTA DA neuron D2R- and/or GABABR-dependent signaling, contributes to the decrease in alcohol consumption seen in both chronic and binge voluntary consumption models, at least in female mice.

Male and female RGS6–/– mice showed decreased binge alcohol consumption. We also observed a main effect of sex, consistent with previous reports that female rodents consume more alcohol than males (Cunningham & Shields, 2018; Li & Lumeng, 1984; Yoneyama, Crabbe et al., 2008). The deficit in binge alcohol consumption seen in constitutive RGS6–/– mice was recapitulated in female (but not male) mice lacking RGS6 in VTA DA neurons. This finding could suggest that the binge drinking deficit noted in constitutive male RGS6–/– mice is unrelated to the influence of RGS6 on inhibitory G protein signaling in VTA DA neurons. The differential behavioral impact of RGS6 ablation in male and female mice could be linked to the higher proportion of VTA DA neurons seen in female rodents as compared to males (McArthur, McHale et al., 2007). All else being equal in this case, manipulations of VTA DA neurons would be expected to exert a greater influence on behavior in female mice as compared to males. Finally, RGS6 may exert a stronger influence on key aspects of inhibitory G protein signaling in VTA DA neurons from female mice as compared to males. In support of this contention, VTA DA neurons from female mice lacking RGS6 showed a more prolonged deactivation of optically evoked GABABR-dependent IPSCs as compared to neurons from male mice lacking RGS6 (Fig. 4D).

In sum, we report here that loss of RGS6 in VTA DA neurons enhances inhibitory G protein signaling and decreases alcohol consumption, the latter in a sex-dependent manner. These data shed new light on the cellular and molecular mechanisms that regulate alcohol consumption and reward. The knowledge gained about RGS6 involvement in alcohol consumption may guide the identification of potential risk factors associated with AUD, as a quantitative trait single nucleotide polymorphism in RGS6 was significantly associated with alcohol dependence symptom count in a human Genome Wide Association Study (Chen, Zhang et al., 2017). In addition, insights from these studies could inform investigations into new or improved therapeutic strategies for more targeted treatment of AUD.

BULLET POINT SUMMARY.

What is already known

  • D2R and GABABR signaling pathways regulate VTA DA neuron excitability and alcohol-related behaviors

  • R7 RGS proteins like RGS6 negatively regulate inhibitory G protein signaling

What this study adds

  • RGS6 negatively regulates GABABR and D2R-dependent signaling in VTA DA neurons in discrete manners

  • RGS6 ablation in VTA DA neurons promotes increased binge-like alcohol consumption in female mice

Clinical significance

  • RGS6 may represent a new diagnostic and/or therapeutic target for alcohol use disorder

ACKNOWLEDGEMENTS

The authors would like to thank Courtney Wright, Fayzeh El Banna, and Shaydel Engel for exceptional care of the mouse colony, and Dr. Kirill Martemyanov for providing helpful comments on the manuscript. This work was supported by NIH grants to MCD (AA028726), EHM and TRR (DA007234), AML (AA026598), and KW (DA034696, AA027544).

Declaration

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in BJP guidelines for Design and Analysis and Animal Experimentation, and as recommended by funding agencies, publishers and other organizations engaged with supporting research.

Non-standard abbreviations

AAV

adeno-associated virus

D2R

D2 dopamine receptor

DA

dopamine

DAT

dopamine transporter

DID

drinking-in-the-dark

GABA

gamma aminobutyric acid

GABABR

GABAB receptor

GIRK channel

G protein-gated inwardly rectifying K+ channel

NAc

nucleus accumbens

RGS

Regulator of G protein Signaling

VTA

ventral tegmental area

Footnotes

Competing Interest Statement The authors declare no competing interests.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Anderson A, Masuho I, Marron Fernandez de Velasco E, Nakano A, Birnbaumer L, Martemyanov KA, & Wickman K (2020). GPCR-dependent biasing of GIRK channel signaling dynamics by RGS6 in mouse sinoatrial nodal cells. Proc Natl Acad Sci U S A 117: 14522–14531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anderson GR, Posokhova E, & Martemyanov KA (2009). The R7 RGS protein family: multi-subunit regulators of neuronal G protein signaling. Cell Biochem Biophys 54: 33–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bifsha P, Yang J, Fisher RA, & Drouin J (2014). Rgs6 is required for adult maintenance of dopaminergic neurons in the ventral substantia nigra. PLoS Genet 10: e1004863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brodie MS, & Dunwiddie TV (1990). Cocaine effects in the ventral tegmental area: evidence for an indirect dopaminergic mechanism of action. Naunyn Schmiedebergs Arch Pharmacol 342: 660–665. [DOI] [PubMed] [Google Scholar]
  5. Cheever ML, Snyder JT, Gershburg S, Siderovski DP, Harden TK, & Sondek J (2008). Crystal structure of the multifunctional Gbeta5-RGS9 complex. Nat Struct Mol Biol 15: 155–162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen CK, Eversole-Cire P, Zhang H, Mancino V, Chen YJ, He W, Wensel TG, & Simon MI (2003). Instability of GGL domain-containing RGS proteins in mice lacking the G protein beta-subunit Gbeta5. Proc Natl Acad Sci U S A 100: 6604–6609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen G, Zhang F, Xue W, Wu R, Xu H, Wang K, & Zhu J (2017). An association study revealed substantial effects of dominance, epistasis and substance dependence co-morbidity on alcohol dependence symptom count. Addict Biol 22: 1475–1485. [DOI] [PubMed] [Google Scholar]
  8. Cohen C, Perrault G, & Sanger DJ (1997). Evidence for the involvement of dopamine receptors in ethanol-induced hyperactivity in mice. Neuropharmacology 36: 1099–1108. [DOI] [PubMed] [Google Scholar]
  9. Crabbe JC, Ozburn AR, Metten P, Barkley-Levenson A, Schlumbohm JP, Spence SE, Hack WR, & Huang LC (2017). High Drinking in the Dark (HDID) mice are sensitive to the effects of some clinically relevant drugs to reduce binge-like drinking. Pharmacol Biochem Behav 160: 55–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cruz HG, Ivanova T, Lunn ML, Stoffel M, Slesinger PA, & Lüscher C (2004). Bi-directional effects of GABA(B) receptor agonists on the mesolimbic dopamine system. Nat Neurosci 7: 153–159. [DOI] [PubMed] [Google Scholar]
  11. Cunningham CL, Howard MA, Gill SJ, Rubinstein M, Low MJ, & Grandy DK (2000). Ethanol-conditioned place preference is reduced in dopamine D2 receptor-deficient mice. Pharmacol Biochem Behav 67: 693–699. [DOI] [PubMed] [Google Scholar]
  12. Cunningham CL, & Shields CN (2018). Effects of sex on ethanol conditioned place preference, activity and variability in C57BL/6J and DBA/2J mice. Pharmacol Biochem Behav 173: 84–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Curtis MJ, Alexander S, Cirino G, Docherty JR, George CH, Giembycz MA, Hoyer D, Insel PA, Izzo AA, Ji Y, MacEwan DJ, Sobey CG, Stanford SC, Teixeira MM, Wonnacott S, & Ahluwalia A (2018). Experimental design and analysis and their reporting II: updated and simplified guidance for authors and peer reviewers. Br J Pharmacol 175: 987–993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. DeBaker MC, Marron Fernandez de Velasco E, McCall NM, Lee AM, & Wickman K (2021). Differential Impact of Inhibitory G-Protein Signaling Pathways in Ventral Tegmental Area Dopamine Neurons on Behavioral Sensitivity to Cocaine and Morphine. Eneuro 8:ENEURO.0081–21.2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Edwards NJ, Tejeda HA, Pignatelli M, Zhang S, McDevitt RA, Wu J, Bass CE, Bettler B, Morales M, & Bonci A (2017). Circuit specificity in the inhibitory architecture of the VTA regulates cocaine-induced behavior. Nat Neurosci 20: 438–448. [DOI] [PubMed] [Google Scholar]
  16. Einhorn LC, Johansen PA, & White FJ (1988). Electrophysiological effects of cocaine in the mesoaccumbens dopamine system: studies in the ventral tegmental area. J Neurosci 8: 100–112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Garzon J, Lopez-Fando A, & Sanchez-Blazquez P (2003). The R7 subfamily of RGS proteins assists tachyphylaxis and acute tolerance at mu-opioid receptors. Neuropsychopharmacology 28: 1983–1990. [DOI] [PubMed] [Google Scholar]
  18. Gerber KJ, Squires KE, & Hepler JR (2016). Roles for Regulator of G Protein Signaling Proteins in Synaptic Signaling and Plasticity. Mol Pharmacol 89: 273–286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hauser AS, Avet C, Normand C, Mancini A, Inoue A, Bouvier M, & Gloriam DE (2022). Common coupling map advances GPCR-G protein selectivity. Elife 11:e74107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hearing MC, Zink AN, & Wickman K (2012). Cocaine-induced adaptations in metabotropic inhibitory signaling in the mesocorticolimbic system. Rev Neurosci 23: 325–351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hooks SB, Waldo GL, Corbitt J, Bodor ET, Krumins AM, & Harden TK (2003). RGS6, RGS7, RGS9, and RGS11 stimulate GTPase activity of Gi family G-proteins with differential selectivity and maximal activity. J Biol Chem 278: 10087–10093. [DOI] [PubMed] [Google Scholar]
  22. Kilkenny C, Browne W, Cuthill IC, Emerson M, Altman DG, & GroupN. C. R. R. G. W. (2010). Animal research: reporting in vivo experiments: the ARRIVE guidelines. Br J Pharmacol 160: 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Koob GF, & Volkow ND (2016). Neurobiology of addiction: a neurocircuitry analysis. Lancet Psychiatry 3: 760–773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Labouebe G, Lomazzi M, Cruz HG, Creton C, Lujan R, Li M, Yanagawa Y, Obata K, Watanabe M, Wickman K, Boyer SB, Slesinger PA, & Luscher C (2007). RGS2 modulates coupling between GABAB receptors and GIRK channels in dopamine neurons of the ventral tegmental area. Nat Neurosci 10: 1559–1568. [DOI] [PubMed] [Google Scholar]
  25. Lammel S, Lim BK, & Malenka RC (2014). Reward and aversion in a heterogeneous midbrain dopamine system. Neuropharmacology 76: 351–359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lammel S, Steinberg EE, Foldy C, Wall NR, Beier K, Luo L, & Malenka RC (2015). Diversity of transgenic mouse models for selective targeting of midbrain dopamine neurons. Neuron 85: 429–438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li TK, & Lumeng L (1984). Alcohol preference and voluntary alcohol intakes of inbred rat strains and the National Institutes of Health heterogeneous stock of rats. Alcohol Clin Exp Res 8: 485–486. [DOI] [PubMed] [Google Scholar]
  28. Liu Y, Jean-Richard-Dit-Bressel P, Yau JO, Willing A, Prasad AA, Power JM, Killcross S, Clifford CWG, & McNally GP (2020). The Mesolimbic Dopamine Activity Signatures of Relapse to Alcohol-Seeking. J Neurosci 40: 6409–6427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Maccioni P, Lorrai I, Contini A, Leite-Morris K, & Colombo G (2018). Microinjection of baclofen and CGP7930 into the ventral tegmental area suppresses alcohol self-administration in alcohol-preferring rats. Neuropharmacology 136: 146–158. [DOI] [PubMed] [Google Scholar]
  30. Maity B, Stewart A, Yang J, Loo L, Sheff D, Shepherd AJ, Mohapatra DP, & Fisher RA (2012). Regulator of G protein signaling 6 (RGS6) protein ensures coordination of motor movement by modulating GABAB receptor signaling. J Biol Chem 287: 4972–4981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Masuho I, Balaji S, Muntean BS, Skamangas NK, Chavali S, Tesmer JJG, Babu MM, & Martemyanov KA (2020). A Global Map of G Protein Signaling Regulation by RGS Proteins. Cell 183: 503–521 e519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Masuho I, Ostrovskaya O, Kramer GM, Jones CD, Xie K, & Martemyanov KA (2015). Distinct profiles of functional discrimination among G proteins determine the actions of G protein-coupled receptors. Sci Signal 8: ra123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. McArthur S, McHale E, & Gillies GE (2007). The size and distribution of midbrain dopaminergic populations are permanently altered by perinatal glucocorticoid exposure in a sex- region- and time-specific manner. Neuropsychopharmacology 32: 1462–1476. [DOI] [PubMed] [Google Scholar]
  34. McCall NM, Kotecki L, Dominguez-Lopez S, Marron Fernandez de Velasco E, Carlblom N, Sharpe AL, Beckstead MJ, & Wickman K (2017). Selective Ablation of GIRK Channels in Dopamine Neurons Alters Behavioral Effects of Cocaine in Mice. Neuropsychopharmacology 42: 707–715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. McCall NM, Marron Fernandez de Velasco E, & Wickman K (2019). GIRK Channel Activity in Dopamine Neurons of the Ventral Tegmental Area Bidirectionally Regulates Behavioral Sensitivity to Cocaine. J Neurosci 39: 3600–3610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Moore EM, & Boehm SL 2nd, (2009). Site-specific microinjection of baclofen into the anterior ventral tegmental area reduces binge-like ethanol intake in male C57BL/6J mice. Behav Neurosci 123: 555–563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Morales M, & Margolis EB (2017). Ventral tegmental area: cellular heterogeneity, connectivity and behaviour. Nat Rev Neurosci 18: 73–85. [DOI] [PubMed] [Google Scholar]
  38. Ng GY, & George SR (1994). Dopamine receptor agonist reduces ethanol self-administration in the ethanol-preferring C57BL/6J inbred mouse. Eur J Pharmacol 269: 365–374. [DOI] [PubMed] [Google Scholar]
  39. Ostrovskaya O, Xie K, Masuho I, Fajardo-Serrano A, Lujan R, Wickman K, & Martemyanov KA (2014). RGS7/Gbeta5/R7BP complex regulates synaptic plasticity and memory by modulating hippocampal GABABR-GIRK signaling. Elife 3: e02053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Perra S, Clements MA, Bernier BE, & Morikawa H (2011). In Vivo Ethanol Experience Increases D(2) Autoinhibition in the Ventral Tegmental Area. Neuropsychopharmacology 36: 993–1002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Philippart F, & Khaliq ZM (2018). Gi/o protein-coupled receptors in dopamine neurons inhibit the sodium leak channel NALCN. Elife 7:e40984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Phillips TJ, Brown KJ, Burkhart-Kasch S, Wenger CD, Kelly MA, Rubinstein M, Grandy DK, & Low MJ (1998). Alcohol preference and sensitivity are markedly reduced in mice lacking dopamine D2 receptors. Nat Neurosci 1: 610–615. [DOI] [PubMed] [Google Scholar]
  43. Posokhova E, Wydeven N, Allen KL, Wickman K, & Martemyanov KA (2010). RGS6/Gbeta5 complex accelerates IKACh gating kinetics in atrial myocytes and modulates parasympathetic regulation of heart rate. Circ Res 107: 1350–1354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rhodes JS, Best K, Belknap JK, Finn DA, & Crabbe JC (2005). Evaluation of a simple model of ethanol drinking to intoxication in C57BL/6J mice. Physiol Behav 84: 53–63. [DOI] [PubMed] [Google Scholar]
  45. Steketee JD, & Kalivas PW (1991). Sensitization to psychostimulants and stress after injection of pertussis toxin into the A10 dopamine region. J Pharmacol Exp Ther 259: 916–924. [PubMed] [Google Scholar]
  46. Stewart A, & Fisher RA (2015). Introduction: G Protein-coupled Receptors and RGS Proteins. Prog Mol Biol Transl Sci 133: 1–11. [DOI] [PubMed] [Google Scholar]
  47. Stewart A, Maity B, Anderegg SP, Allamargot C, Yang J, & Fisher RA (2015). Regulator of G protein signaling 6 is a critical mediator of both reward-related behavioral and pathological responses to alcohol. Proc Natl Acad Sci U S A 112: E786–795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Stewart A, Maity B, Wunsch AM, Meng F, Wu Q, Wemmie JA, & Fisher RA (2014). Regulator of G-protein signaling 6 (RGS6) promotes anxiety and depression by attenuating serotonin-mediated activation of the 5-HT(1A) receptor-adenylyl cyclase axis. FASEB J 28: 1735–1744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Stirling DR, Swain-Bowden MJ, Lucas AM, Carpenter AE, Cimini BA, & Goodman A (2021). CellProfiler 4: improvements in speed, utility and usability. BMC Bioinformatics 22: 433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Thiele TE, Crabbe JC, & Boehm SL 2nd, (2014). “Drinking in the Dark” (DID): a simple mouse model of binge-like alcohol intake. Curr Protoc Neurosci 68: 9 49 41–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Uhl GR, Koob GF, & Cable J (2019). The neurobiology of addiction. Ann N Y Acad Sci 1451: 5–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Valyear MD, Glovaci I, Zaari A, Lahlou S, Trujillo-Pisanty I, Andrew Chapman C, & Chaudhri N (2020). Dissociable mesolimbic dopamine circuits control responding triggered by alcohol-predictive discrete cues and contexts. Nat Commun 11: 3764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Vlachou S, & Markou A (2010). GABAB receptors in reward processes. Adv Pharmacol 58: 315–371. [DOI] [PubMed] [Google Scholar]
  54. Von Moo E, Harpsoe K, Hauser AS, Masuho I, Brauner-Osborne H, Gloriam DE, & Martemyanov KA (2022). Ligand-directed bias of G protein signaling at the dopamine D2 receptor. Cell Chem Biol 29: 226–238 e224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Xie K, Allen KL, Kourrich S, Colon-Saez J, Thomas MJ, Wickman K, & Martemyanov KA (2010). Gbeta5 recruits R7 RGS proteins to GIRK channels to regulate the timing of neuronal inhibitory signaling. Nat Neurosci 13: 661–663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yang J, Huang J, Maity B, Gao Z, Lorca RA, Gudmundsson H, Li J, Stewart A, Swaminathan PD, Ibeawuchi SR, Shepherd A, Chen CK, Kutschke W, Mohler PJ, Mohapatra DP, Anderson ME, & Fisher RA (2010). RGS6, a modulator of parasympathetic activation in heart. Circ Research 107: 1345–1349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yoneyama N, Crabbe JC, Ford MM, Murillo A, & Finn DA (2008). Voluntary ethanol consumption in 22 inbred mouse strains. Alcohol 42: 149–160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. You C, Vandegrift B, & Brodie MS (2018). Ethanol actions on the ventral tegmental area: novel potential targets on reward pathway neurons. Psychopharmacology (Berl) 235: 1711–1726. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

RESOURCES