Natural Magnolol ameliorates coccidiosis infected with Eimeria tenella by affecting antioxidant, anti-inflammatory, and gut microbiota of chicks

Abstract

Magnolol, a natural extract from magnolia officinalis, has received growing interest in its bioactive properties such as antioxidant, anti-inflammatory, and antibacterial activities. Nevertheless, there is little research on Magnolol in the treatment of parasitic infections currently. Eimeria tenella (E. tenella) infection causes damage to epithelial cells and cecal mucosa, resulting in increased intestinal permeability, which is pretty detrimental to the balance of the intestinal microenvironment. However, at present, in the treatment of chicken coccidiosis, the abuse of antibiotics is quite serious, which has brought losses and harms to the chicken farming industry that cannot be ignored. In this study, based on the excellent antioxidant and anti-inflammatory properties of Magnolol, we proved that it does have a desirable therapeutic potential on chicks infected with E. tenella. Actually, the results showed that the clinical symptoms of the chicks infected with E. tenella were relieved and their growth performance was restored by Magnolol treatment. Furthermore, Magnolol improved the antioxidant and anti-inflammatory properties of chicks. Meanwhile, the Magnolol reversed the imbalance of the intestinal microbiota of sick chicks, which recovered the diversity, promoted the potential beneficial bacteria, and inhabited the potential pathogenic bacteria. Overall, Magnolol may be an alternative to chemical drugs that are effective in treating E. tenella infections.

INTRODUCTION

Chicken coccidiosis is a universal and severe parasitic disease caused by Eimeria in the intestine, which results in significant economic losses of over $14 billion because of infectiousness in intensive poultry farming (Arendt et al., 2019; Adams et al., 2022). The intestinal injury caused by Eimeria tenella (E. tenella) infection is more serious and widespread than other Eimeria. Because E. tenella can undermine chickens’ ability to absorb nutrients and destroy the balance of intestinal microbiota (Bussière et al., 2018; Swelum et al., 2021; Lv et al., 2022) that is an important factor for intestinal health. These microbiota reside in the mucosa of the intestinal and play a crucial role in supporting the health of their host (Clavijo and Flórez, 2018; Madlala et al., 2021; Neveling and Dicks, 2021). In fact, the probiotics not only produce short-chain fatty acids that nourish intestinal cells but also exert a protective effect by preventing the proliferation of harmful microbiota and promoting the development and maturation of the immune cells that line the gut (Shi et al., 2017; Hou et al., 2022; Portincasa et al., 2022). Sadly, coccidia infection can disrupt the balance of intestinal microbiota so that have dire consequences, including a surge in harmful microbiota such as Salmonella, Escherichia coli, and Klebsiella and a decrease in beneficial microbiota such as Lactobacillus, Bifidobacterium, and Clostridium (Huang et al., 2018; Choi and Kim, 2022). However, the harmful microbiota will further promote the intestinal inflammation infected with chicken coccidiosis, which may lead to necrotizing enteritis caused by Clostridium perfringens infection and lead to the death of chickens eventually.

Chemical synthetic drugs, such as polyether ionophore antibiotics, triazine phenylacetonitrile compounds, and sulfonamides are commonly used to prevent and treat chicken coccidiosis, but their long-term use may cause drug resistance and toxic side effects (Muaz et al., 2018; Cervantes and McDougald, 2022; Flores et al., 2022). In spite of the fact that the coccidiosis vaccine is currently a hot topic, the safety of the vaccine must be considered, as the live vaccine may cause outbreaks of coccidiosis if it lacks stability (Sander et al., 2019; Zaheer et al., 2022). Based on the above, we need to find an alternative to chemical synthetic drugs to control chicken coccidiosis urgently. Phytochemicals like phenolic compounds are natural, safe, and effective so that they may be the most promising alternatives to treat infections (El-Shall et al., 2022). As a traditional Chinese herb, magnolia officinalis treats dysentery caused by disordered microbiota and functional dyspepsia caused by abdominal distension (Zhang et al., 2022). Our earlier study has shown that feeding magnolia powder to chicks infected with E. tenella can decrease the number of oocysts and alleviate intestinal damage (Yang et al., 2022). A study shows that adding Magnolol to broiler feed increased antioxidant enzyme levels (SOD, T-AOC) and reduced peroxidation products (MDA), so the chicks grow faster and better (Xie et al., 2022). The mixture of Magnolol and honokiol also can improve intestinal health and promote laying hen growth by reducing peroxidation products and increasing antioxidant enzyme, as well as restoring intestinal villus morphology (Chen et al., 2022).

Here, we proved the potential of Magnolol in the treatment of chicks infected with E. tenella. In this study, we designed 4 groups that are healthy control, the E. tenella-infected group, the E. tenella-infected group treated with Diclazuril, and the E. tenella-infected group treated with Magnolol to monitor the growth of chicks during the experiment. By parameters feed conversion rate (FCR), clinical symptoms, and pathological changes were observed during infection to evaluate the anticoccidia effect of Magnolol. We also examined the mRNA of various genes (Nrf2, Keap1, HO-1, ChTLR15, Myd88, NF-κB, NLRP3, Caspase-1, Occludin, and ZO-1) in the cecum, inflammation-related cytokines (interleukin-1β [IL-1β], interleukin-4 [IL-4], interleukin-6 [IL-6], interleukin-10 [IL-10], tumor necrosis factor-alpha [TNF-α], interferon-gamma [IFN-γ]), immunoglobulins (immunoglobulin M [IgM] and immunoglobulin G [IgG]) and antioxidant related indicators (total antioxidant capacity [T-AOC], superoxide dismutase [SOD], catalase [CAT], glutathione peroxidase [GSH-Px], and malondialdehyde [MDA]) in serum to evidence Magnolol could enhance the abilities of antioxidant and anti-inflammatory of chicks by inhibiting the inflammatory signaling pathway (ChTLR15/Myd88/NF-κB/NLRP3/Caspase-1) and activating the antioxidant signaling pathway (Nrf2/Keap1/HO-1). Finally, we used 16S rDNA sequencing technology to detect changes of gut microbiota to investigate whether Magnolol regulates these changes to alleviate the disease. In summary, Magnolol could be a good cure for sick chicks infected with E. tenella, which may be a promising approach to controlling chicks’ coccidiosis and reducing economic losses in broiler breeding industry.

MATERIALS AND METHODS

Medicines Preparation

Diclazuril (20201107), a commercial chemical anticoccidial drug, was purchased from Ruipu Biotechnology Co., Ltd. (Tianjin, China), and Magnolol (≥98%, CAS: 528-43-8) was purchased from Yuanye Biotechnology Co. Ltd. (Shanghai, China).

Animals and Parasites

One-day-old chicks were purchased from Guangxi Fufeng Agricultural and Animal Husbandry Co., Ltd. (Nanning, China). The chicks were uniformly reared in an animal experimental room without coccidia and were fed with feed that without anticoccidial drugs. The composition of the diet is presented in Table 1.

Table 1.

Basal diet.

Composition	Percentage(%)
Crude ash	≤30.0
Crude fiber	≤25.0
Crude protein	≥17.0
Water	≤13.0
Calcium	0.6–1.5
Sodium chloride	0.3–0.8
Methionine	0.2–0.7

The E. tenella strain was provided by China Agricultural University (Beijing, China) and preserved in a refrigerator at -4°C in Professor Si Hongbin's Chinese Veterinary Laboratory of Guangxi University (Nanning, China). The strain was rejuvenated every two months and performed the rejuvenation 2 wk prior to the animal experiment. The rejuvenated and purified oocysts were incubated in 2.5% potassium dichromate (K₂Cr₂O₇) solution at 28°C for 3 d, with air being pumped into the oocyst solution every 6 h.

Battery Experimental Protocol

Ninety-six 1-day-old male, yellow-feathered chicks were randomly divided into 4 group (n = 24/group): the E. tenella nonchallenged and nonintervened group (N group); the E. tenella challenged and nonintervened group (C group); the E. tenella challenged and Diclazuril intervened (0.2 mL/L in water) group (D group); the E. tenella challenged and Magnolol intervened (0.025% infeed) group (M group). And each group was divided into 3 cages equally. All chicks were orally administered with 20,000 infective oocysts at 14 d of age besides chicks in N group. Diclazuril was administered on the day of E. tenella inoculation until the end of the test (14–22 d of age), while Magnolol was administered 1 d before E. tenella inoculation until the end of test (13–22 d of age).

Growth Performance and Clinical Parameters

At 7 d postinfection (DPI), the survival number of chicks was recorded, and the survival rates are calculated. The survival rates = Number of surviving chicks/total number of chickens in each group. The body weight at 0 DPI and 7 DPI (BW, the body weight at 7 DPI) was recorded respectively. Body weight gain (BWG) = (the body weight at 7 DPI) − (the body weight at 0 DPI). The cumulative average feed intake (FI) of chicks per cage was recorded to calculate the FCR during E. tenella infection. FCR (g/g) = FI (g)/BWG (g).

Scores of cecal lesions were based on an examination of the intestine visually (Johnson and Reid, 1970). The scores ranged from 0 (normal) to 4 (severe). The total average cecal lesion scores of each group would be compared.

At 4, 5, 6, and 7 DPI, the bloody feces score was judged from 0 (normal) to 4 (severe) as follows: no bloody feces, the total bloody feces less than 25%, the total bloody feces between 26% and 50%, the total bloody feces between 51% and 75%, and over 75% bloody feces in total feces (Youn and Noh, 2001). The total average bloody feces scores of each group would be compared.

Fresh fecal samples were collected at 6.5, 7, 7.5, and 8 DPI to counting oocysts in per gram feces (OPG) according use the method of Holdsworth et al. (2004). Briefly, 1 g of fecal from each cage of mixed feces was dispersed in 10 mL water. Then an appropriate amount of solution was dripped onto the hemocytometer, and the number of oocysts was counted in 4 counting rooms of the hemocytometer (repeat the above counting operation three times for each group). Oocysts in per gram feces = ([The number of oocysts of 4 counting rooms]/4) × 10⁵. The total average OPG of each group would be compared.

Collection of Serum, Cecum, and Cecal Feces

At 7 DPI, 6 chicks were randomly chosen from each cage, the blood was collected from their jugular vein, which was left at room temperature for 2 h before being centrifuged at 3,500 revolutions per minute for 5 min to obtain the final supernatant. Then the selected chicks were euthanized via cervical dislocation to collect their cecum tissue and feces which were frozen in liquid nitrogen and stored in a −80°C refrigerator promptly. Additionally, a 2 to 3 cm section of the cecum was placed in 4% formalin solution which changed every 12 h until clarification.

Histopathological Experiment of Cecum

Firstly, the specimens underwent a series of procedures including fixation, dehydration, paraffin immersion, embedding, and sectioning. Subsequently, the sections were subjected to hematoxylin and eosin (H&E) staining. Finally, the stained sections were examined under a light microscope to assess the structural integrity of the cecum. “100×” and “400×” represent 100 times and 400 times magnification of microscope.

Enzyme-Linked Immunosorbent Assay for Bioactive Proteins

In this study, we utilized a chicken enzyme-linked immunosorbent assay (ELISA) kit (BYabscience Biotechnelogy Co., Ltd., Shanghai, China) to measure the serum levels of various biomarkers, including IL-1β, IL-4, IL-6, IL-10, TNF-α, and IFN-γ, IgM, IgG, T-AOC, SOD, CAT, GSH-Px, NO, and MDA.

Real-Time qPCR

The cecum was pulverized into powder and extracted the total RNA from cecum using TRIGene lysis buffer (GenStar, Beijing, China). The total RNA was reverse transcribed into cDNA using StarScript II RT Mix With gDNA Remover (GenStar). Then the cDNA, primers, and 2× RealStar Green Fast Mixture (GenStar) were mixed following the instructions. The reaction was subjected to predenaturation 2 min at 95°C, followed by 40 amplification cycles (denaturation 15 s at 95°C, annealing 15–30 s at 60°C, and extension 30 s at 72°C). The real-time qPCR (RT-qPCR) was performed using the Light Cycler 480 Real-Time System (Roche, CA). The differential expression levels of Nrf2, HO-1, Keap1, ChTLR15, MyD88, NF-κB, NLRP3, Caspase1, ZO-1, and Occludin were measured. The information of primers were obtained from Li et al. (2021), Zhang et al. (2022), Deng et al. (2023) compared by Blast analysis on NCBI, and synthesized by Beijing Tsingke Biotech Co., Ltd (Beijing, China). All RT-qPCR experiments were replicated 3 times, and the expression levels of all genes were calculated using the 2^−ΔΔCT method to analysis. The information of primers refers to Table 2.

Table 2.

Primer sequence of RT-qPCR.

Gene name	Primer sequence (5′-3′)	NCBI-Protein ID
β-actin	TTGTTGACAATGGCTCCGGT TCTGGGCTTCATCACCAACG	NM_205518.1
ChTLR15	GGCTGTGGTATGTGAGAATG ATCGTGCTCGCTGTATGA	NM_001398239.1
ChMyD88	CTGGCATCTTCTGAGTAGT TTCCTTATAGTTCTGGCTTCT	XM_046910878.1
ChNF-κB	TCTGAACAGCAAGTCATCCATAACG AAGGAAGTGAGGTTGAGGAGTCG	XM_046915553.1
ChNLRP3	GGTTTACCAGGGGAAATGAGG TTGTGCTTCCAGATGCCGT	XM_046918112.1
ChCaspase-1	TAAGCACTTGAGACAGCGGGACG GGATGTCCGTGGTCCCATTACTC	XM_040687588.2
Occludin	CGCAGATGTCCAGCGGTTACT CAGAGCAGGATGACGATGAGGAA	NM_205128.1
ZO-1	CCACTGCCTACACCACCATCTC CGTGTCACTGGGGTCCTTCAT	XM_015278975.1
NRF2	ATCACGAGCCCTGAAACCAA GGCTGCAAAATGCTGGAAAA	MN416129.1
KEAP1	GCCCTCAACAACTGCAT CGGGTCGTAACACTCCA	MN416132.1
HO-1	GAAAGCTGCCCTGGAGAAAG CCCAGACAGGTCTCCCAAAT	NM_205344.2

16S rDNA Sequencing

The cecum feces were collected from chicks when we were dissecting. Bacterial DNA was extracted from these feces using the bacterial histone DNA extraction kit (Omega Bio-Tek, Norcross, GA), and the purity and concentration of the extracted genomic DNA were evaluated using agarose gel electrophoresis. The library was prepared using the NEXTFLEX Rapid DNA-SEQ kit and sequenced on the Illumina Miseq PE300 platform (Meiji Biomedical Technology Co. Ltd., Shanghai, China). All data analysis operations were performed on the cloud platform (super computer platform of Majorbio Bio-Pharm Technology Co., Ltd. https://cloud.majorbio.com).

Clustering analysis was conducted using 97% sequence similarity as the operational taxonomic unit (OTU). The α diversity was assessed by the Sobs, Shannon, Simpson, ace, and chao index, and the Venn diagram was illustrated shared and unique OTU between groups. The linear discriminant analysis (LDA) and LDA effect size (LEfSe) were used to analyze the dominance of bacterial communities among the groups, and the community barplot was performed on different abundance of microbiota at the genus level between groups, and species difference analysis on genus level was indicated significant differences in microbial composition, and the spearman correlation analysis was assessed the correlation between microbiota and cytokines, etc.

Statistical Analysis

Statistical data including BW, BWG, FI, FCR, OPG, bloody feces score, and cecal lesion scores were analyzed using SPSS 20 software, which employed 1-way ANOVA and followed by post hoc analysis using Duncan's multiple-range test. As for the 16S rDNA data, it was processed and analyzed on a cloud-based platform specifically, the supercomputer platform of Majorbio Bio-Pharm Technology Co. Ltd. (https://cloud.majorbio.com), and the Kruskal–Wallis H test and the Wilcoxon rank sum test were used for α diversity analysis and species difference analysis on levels. Statistical significance and highly significance were set at P < 0.05 and P < 0.01 respectively.

RESULTS

Clinical Parameters and Growth Performance of Chicks

Chicks infected with E. tenella exhibit various clinical symptoms such as depression, disheveled feathers, reduced FI, and bloody feces. The cecum of sick chicks appeared pronounced edema which increased the thickness of the intestine. There were also a large number of bleeding spots that gave the cecum a red color. The feces almost disappeared but emerged a mixture of intestinal mucosa and blood. However, these pathological changes all improved to a large extent in M group which have intervened by Magnolol. Magnolol decreased FCR and cecal lesion scores, while increased BWG and FI (Table 3). It was worth noting that the survival rate of this group reached 100%. Oocysts in per gram feces and bloody feces scores of M group were less than C group significantly (P < 0.05) in different periods (Tables 4 and 5). These results indicated that Magnolol could ameliorate the lesions caused by E. tenella infection and restore the growth performance of sick chickens, so that they reached almost the same level as healthy chicks.

Table 3.

Growth performance, cecal lesion scores, and survival rate of chicks in different groups.

Group	BW (g)	BWG (g)	FI (g)	FCR (g/g)	Cecal lesion scores	Survival rate
N	138.25a	55.88a	116.81a	2.09b	0d	100
C	114.04c	31.11c	94.46b	3.08a	2.87a	87.5
D	136.58a	53.68a	114.32a	2.13b	0.83c	100
M	128.88b	46.94b	107.81a	2.30b	1.33b	100
SEM	3.012	3.025	2.951	0.136	0.172
P-value	< 0.0001	< 0.0001	< 0.01	< 0.01	< 0.0001

“Note: Different superscript letters differ significantly (P < 0.05). Data are presented as mean.” was revised to “Note: Different superscript letters（a-d） differ significantly (P < 0.05). Data are presented as mean.”

Table 4.

The bloody feces score in the different periods.

Group	5 DPI	5.5 DPI	6 DPI	6.5 DPI	7 DPI
N	0	0c	0d	0d	0c
C	3	4a	3.67a	3a	2a
D	1	1.33b	1.33c	1c	0.33c
M	1	1.67b	2.33b	1.67b	1b
SEM	0.329	0.446	0.423	0.336	0.241
P-value	-	P < 0.0001	P < 0.0001	P < 0.0001	P < 0.0001

“Note: Different superscript letters differ significantly (P < 0.05). Data are presented as mean.” was revised to “Note: Different superscript letters（a-d） differ significantly (P < 0.05). Data are presented as mean.”

Table 5.

Oocysts in per gram feces in the different periods.

Group	6.5 DPI OPG (×105)	7 DPI OPG (×105)	7.5 DPI OPG (×105)	8 DPI OPG (×105)
N	0c	0d	0d	0c
C	6.54a	12.29a	8.42a	7.42a
D	0.33c	0.67c	0.5c	0.38c
M	3.38b	5.38b	3.21b	2.21b
SEM	0.562	1.026	0.701	0.62
P-value	<0.0001	<0.0001	<0.0001	<0.0001

“Note: Different superscript letters differ significantly (P < 0.05). Data are presented as mean.” was revised to “Note: Different superscript letters（a-d） differ significantly (P < 0.05). Data are presented as mean.”

Pathophysiological Analysis

The morphological changes of the cecum were examined by staining pathological sections with H&E. In N group, the cecal microvillus remained intact with epithelium, lamina propria cells, and abundant intestinal glands (Figures 1A1 and 1A2). In C group, conversely, the microvillus became blurry and damaged, which detached into the intestinal lumen. The feces contained massive oocysts that were about to be expelled (Figure 1B1). At high magnification (Figure 1B2), the cecum glands were almost absent and densely occupied by oocysts, and the intrinsic cells were loosely arranged, and the intestinal tissue was infiltrated by a significant number of inflammatory cells. The M group also exhibited smaller intestinal glands and morphology than N group, but we still can see restorations to a greater extent than C. For example, there were less inflammatory cells infiltration and fewer oocysts parasitized between the intestine and glands (Figures 1D1 and 1D2).

Figure 1.

The pathological sections of cecum tissue of chicks in different groups. (A1) and (A2) represent N group “100×” and “400×” respectively; (B1) and (B2) represent C group “100×” and “400×” respectively; (C1) and (C2) represent D group “100×” and “400×” respectively; (E1) and (E2) represent M group “100×” and “400×” respectively. The red arrow points to the E. tenella, and inside the black circle are inflammatory cells.

Cytokines, Immunoglobulins, and Antioxidant Indices in Serum

In C group, it was observed that the proinflammatory cytokines like IL-1β, IL-6, TNF-α, and IFN-γ (Figures 2A, 2C, 2E, and 2F) were all upregulated significantly (P < 0.01) compared to the N group. On the contrary, Magnolol intervened resulted in a significant (P < 0.05) downregulation of these cytokines compared to the C group. Moreover, the anti-inflammatory cytokines like IL-4 and IL-10 (Figures 2B and 2D) were both upregulated (P > 0.05) in the C group compared to the N group. But in M group, IL-4, and IL-10 were significantly (P < 0.05) increased to achieve a more obvious effect of suppressing the development of inflammation. Furthermore, in the C group, the antioxidant enzymes, including T-AOC, SOD, CAT, and GSH-Px (Figures 3A, 3B, 3C, and 3D) showed a significant (P < 0.01) decrease, and the oxidative stress indices such as MDA and NO (Figures 3E and 3F) demonstrated an obvious increase (P < 0.01), and the immunoglobulins like IgG and IgM (Figures 3G and 3H) were significantly (P < 0.01) decreased compared to the N group. Anyway, Magnolol treatment could reverse these changes to alleviate the sick chicks which E. tenella has infected.

Figure 2.

The results of different enzyme-linked immunosorbent assay of chicks in different groups. (A) Interleukin-1β (IL-1β); (B) interleukin-4 (IL-4); (C) interleukin-6 (IL-6); (D) interleukin-10 (IL-10); (E) tumor necrosis factor-alpha (TNF-α); (F) interferon-gamma (IFN-γ). Different letters above column differ significantly (P < 0.05).

Figure 3.

The results of different enzyme-linked immunosorbent assay of chicks in different groups. (A) Total antioxidant capacity (T-AOC); (B) superoxide dismutase (SOD); (C) catalase (CAT); (D) glutathione peroxidase (GSH-Px); (E) malondialdehyde (MDA); (F) nitric oxide (NO); (G) immunoglobulin G (IgG); (H) immunoglobulin (M) (IgM). Different letters above column differ significantly (P < 0.05).

RT-qPCR Results

At 7 DPI, we employed RT-qPCR technique to evaluate the expression of mRNAs associated with the ChTLR15/NF-κB/NLRP3 and Nrf2/Keap1/HO-1 signaling pathway and tight junction proteins. In C group, the mRNA of ChTLR15, Myd88, NF-κB, NLRP3, and Caspase-1 (Figures 4A–4E) were significantly elevated (P < 0.01) compared to N group. After Magnolol intervened, all of the above mRNA has been decreased significantly (P < 0.01). At the same time, compared to N group, the Nrf2 and HO-1 (Figures 4F and 4H) were decreased (P < 0.01) and Keap1 (Figure 4G) was significantly (P < 0.01) increased of C group and Magnolol reversed these tendencies. Furthermore, the mRNA of tight junction proteins of Occludin and ZO-1 (Figures 4I and 4J) were reduced (P < 0.01) in C group while both of them were rebounded (P < 0.01) after treatment with Magnolol. From the above results, we could determine that Magnolol did alleviate the inflammatory response, peroxidation response, and damage of intestinal barrier in sick chicks.

Figure 4.

The results of different mRNA expression of chicks in different groups. (A) Chicken toll-like receptor 15 (ChTLR15); (B) myeloid differentiation primary response 88 (MyD88); (C) nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB); (D) NOD-like receptor family, pyrin domain containing 3 (NLRP3); (E) caspase1; (F) nuclear factor erythroid 2-related factor 2 (Nrf2); (G) Kelch-like ECH-associated protein 1 (keap1); (H) heme oxygenase-1 (HO-1); I Occludin; (J) zonula Occludens 1 (ZO-1). Different letters above column differ significantly (P < 0.05).

16S rDNA Sequencing Analysis

The effect of Magnolol intervened on the gut microbiota of chicks infected with E. tenella was investigated by 16S rDNA gene sequencing, and this raw 16Sr DNA data reported have been uploaded to the Genome Sequence Archive (Genomics, Proteomics & Bioinformatics 2017) in BIG Data Center (Nucleic Acids Res, 2019), Beijing Institute of Genomics (BIG), Chinese Academy of Sciences, under accession numbers CRA010797 (https://ngdc.cncb.ac.cn/gsa/s/w86WxdT6). It has been shown that Magnolol treatment caused a higher number in Sobs, Shannon, Ace, and Chao index and a lower number Simpson (Table 6) which represented the diversity of gut microbiota. Furthermore, there were 850 OTUs existed in N group, 417 in C group, 611 in M group, which suggested intestinal microbiota of chicks was destroyed by E. tenella and Magnolol recovered some OTUs (Figure 5A). LEfSe (LDA > 4) was used to analyze the key phylotypes of gut microbiota in N, C, and M groups. The results showed that Clostridia, Firmicutes, Lachnospiraceae, Lachnospirales, and Ruminococcaceae had high LDA scores in N group, indicating that they were the most abundant OTUs in N group; Proteobacteria, Gammaproteobacteria, Enterobacterales, Enterobacteriaceae, and Escherichia–Shigella displayed the highest LDA scores in C group, indicating that the abundance of these microbiota was significantly affected by E. tenella; Bacteroidales, Bacteroidota, Bacteroidia, Alistipes, and Blautia had the higher scores in M group, indicating that the abundance of these microbiota was significantly affected by Mognolol (Figures 5B and 5C). And at the genus level (Figures 5E and 5F), the abundance of Escherichia–Shigella and Enterococcus as potential pathogenic microbiota was increased (P < 0.01) in C group, while Lachnospiraceae_NK4A136_group, unclassified_f__Lachnospiraceae, norank_f__Ruminococcaceae, Ruminococcus_torques_group, and other microbiota as potential beneficial microbiota were decreased obviously (P < 0.01). Nevertheless, we can find Magnolol intervention led the abundance of Escherichia–Shigella and Enterococcus decreased significantly (P < 0.01), while Alistipes, Blautia, unclassified_f__Lachnospiraceae, and Ruminococcus_torques_group were rose (P < 0.01). Furthermore, spearman correlation analysis (Tables 7 and 8) showed that Firmicutes, Lachnospiraceae, Ruminococcaceae, and Blautia had a positive correlation with T-AOC, SOD, CAT, GSH-Px, IgG and IgM while a negative correlation with IL-1β, IL-6, TNF-α, INF-γ, MDA, and NO. In contrast, Proteobacteria, Enterobacteriaceae, and Escherichia–Shigella showed a negative correlation with antioxidant enzymes, immunoglobulins, and anti-inflammatory cytokines while a positive correlation with inflammatory cytokines and oxidative stress-related indices. So, Magnolol could improve the disturbance of the intestinal microbiota of chicks caused by E. tenella.

Table 6.

The α diversity in different groups.

Group	Sobs	Shannon	Simpson	Ace	Chao
N	422.5 a	4.05 a	0.0422 a	510.58 a	507.01 a
C	117.5 b	1.57 b	0.4592 b	158.76 b	152.51 b
M	336.5 a	3.73 a	0.0573 a	404.92 a	402.39 a
SEM	37.537	0.324	0.594	42.55	44.209
P-value	<0.05	<0.05	<0.05	<0.01	<0.01

“Note: Different superscript letters differ significantly (P < 0.05). Data are presented as mean.” was revised to “Note: Different superscript letters（a-d） differ significantly (P < 0.05). Data are presented as mean.”

Figure 5.

The results of 16S rDNA sequencing of cecum contents. (A) Venn diagram of OTU level; (B) LEfSe multilevel species cladogram (C) LEfSe multilevel species LDA distribution histogram, and the greater the LDA score, the more significant the difference intestinal microbiota in the comparison; (D) community barplot analysis on genus level; (E) Relative abundance (%) genus level between N group and C group, one or more “*” indicates significant difference; (F) relative abundance (%) genus level between C group and M group, one or more “*” indicates significant difference.

Table 7.

The spearman correlation analysis between microbiota and cytokines.

Microbiota	IL-1β	IL-4	IL-6	IL-10	TNF-α	IFN-γ
Firmicutes	−0.554 * (P = 0.0170)	−0.304 (P = 0.2193)	−0.490 * (P = 0.0389)	−0.228 (P = 0.3625)	−0.523* (P = 0.0259)	-0.581 * (P = 0.0115)
Proteobacteria	0.437 (P = 0.0699)	−0.235 (P = 0.3479)	0.525 * (P = 0.0253)	−0.155 (P = 0.5382)	0.536 * (P = 0.0218)	0.342 (P = 0.1653)
Enterobacteriaceae	0.422 (P = 0.0815)	−0.241 (P = 0.3360)	0.495 * (P = 0.0367)	−0.182 (P = 0.4686)	0.500 * (P = 0.0345)	0.349 (P = 0.1558)
Lachnospiraceae	−0.703 ⁎⁎ (P = 0.0011)	0.271 (P = 0.2760)	−0.575 * (P = 0.0126)	0.014 (P = 0.9546)	−0.465 (P = 0.0516)	-0.562 * (P = 0.0151)
Ruminococcaceae	−0.671 ⁎⁎ (P = 0.0023)	0.114 (P = 0.6536)	−0.662 ⁎⁎ (P = 0.0028)	−0.167 (P = 0.5068)	−0.767 ⁎⁎⁎ (P = 0.0002)	-0.715 ⁎⁎⁎ (P = 0.0009)
Blautia	−0.600 ⁎⁎ (P = 0.0085)	0.135 (P = 0.5928)	−0.430 * (P = 0.0746)	−0.059 (P = 0.8166)	−0.416 (P = 0.0861)	-0.577 ⁎⁎ (P = 0.0122)
Escherichia–Shigella	0.422 (P = 0.0815)	−0.241 (P = 0.3360)	0.495 * (P = 0.0367)	−0.182 (P = 0.4686)	0.500 * (P = 0.0345)	0.349 (P = 0.1558)

Note: Different superscript symbols differ significantly (*P < 0.05, ^⁎⁎P < 0.01, ^⁎⁎⁎P < 0.001). Data are presented as correlation coefficient + P-value.

Table 8.

The spearman correlation analysis between microbiota and antioxidant index or immunoglobulin.

Microbiota	T-AOC	SOD	CAT	GSH-Px	MDA	NO	IgG	IgM
Firmicutes	0.781 ⁎⁎⁎ (P = 0.0001)	0.536 * (P = 0.0220)	0.581 * (P = 0.0115)	0.482 * (P = 0.0426)	−0.443 (P = 0.0658)	−0.600 ⁎⁎ (P = 0.0085)	0.519 * (P = 0.0273)	0.544 * (P = 0.0196)
Proteobacteria	−0.490 * (P = 0.0392)	−0.499 * (P = 0.0350)	−0.586 * (P = 0.0106)	−0.478 * (P = 0.0447)	0.533 * (P = 0.0227)	0.432 (P = 0.0736)	−0.536 * (P = 0.0218)	−0.627 ⁎⁎ (P = 0.0053)
Enterobacteriaceae	−0.532 * (P = 0.0231)	−0.477 * (P = 0.0452)	−0.567 * (P = 0.0142)	−0.447 (P = 0.0628)	0.493 * (P = 0.0376)	0.413 (P = 0.0884)	−0.495 * (P = 0.0367)	−0.605 ⁎⁎ (P = 0.0078)
Lachnospiraceae	0.536 * (P = 0.0220)	0.682 ⁎⁎ (P = 0.0018)	0.472 * (P = 0.0482)	0.483 * (P = 0.0421)	−0.404 (P = 0.0968)	−0.476 * (P = 0.0460)	0.616 ⁎⁎ (P = 0.0065)	0.752 ⁎⁎⁎ (P = 0.0003)
Ruminococcaceae	0.633 ⁎⁎ (P = 0.0048)	0.732 ⁎⁎⁎ (P = 0.0006)	0.789 ⁎⁎⁎ (P = 0.0001)	0.634 ⁎⁎ (P = 0.0048)	−0.656 ⁎⁎ (P = 0.0031)	−0.736 * (P = 0.0005)	0.558 * (P = 0.0162)	0.544 * (P = 0.0196)
Blautia	0.595 ⁎⁎ (P = 0.0091)	0.550 * (P = 0.0180)	0.492 * (P = 0.0380)	0.347 (P = 0.1582)	−0.257 (P = 0.3033)	−0.513 * (P = 0.0295)	0.399 (P = 0.1006)	0.478 * (P = 0.0449)
Escherichia–Shigella	−0.532 * (P = 0.0231)	−0.477 * (P = 0.0452)	−0.567 * (P = 0.0142)	−0.447 (P = 0.0628)	0.493 * (P = 0.0376)	0.413 (P = 0.0884)	−0.495 * (P = 0.0367)	−0.605 ⁎⁎ (P = 0.0078)

Note: Different superscript symbols differ significantly (*P < 0.05, ^⁎⁎P < 0.01, ^⁎⁎⁎P < 0.001). Data are presented as correlation coefficient + P-value.

DISCUSSION

Severe coccidian infections could cause acute intestinal inflammation such as necrotizing enteritis, which is clinically manifested by diarrhea, bloody stools, and increased FCR. This problem badly hinders the growth and development of chicks and even leads to mass mortality of the flock (van Eerden et al., 2022). As we expected, the sick chicks with E. tenella caused pathological changes in the cecum, including severe injury of intestinal tissues and infiltration of inflammatory cell (Figures 1B1and 1B2). The damage of the intestinal cells leads to the ability to absorb nutrients reduced, resulting in a reduction of chicken's growth performance ultimately. Magnolol intervened ameliorated the clinical symptom of coccidiosis, enhanced the health of cecum, and improved the growth performance. Yet, the effect of Magnolol on oocyst inhibition is not good as Diclazuril, which may be related to the different anticoccidial mechanisms of them.

E. tenella triggers the inflammatory and oxidative stress response which is characterized by an increase in pro-inflammatory cytokines and a reduction in antioxidant enzymes (Yu et al., 2021). And drugs that have a great antioxidant effect can alleviate inflammation and oxidative stress response (Yang et al., 2022). Happily, the extracts of natural herbal have an excellent antioxidative ability, which could treat coccidiosis. Both chlorogenic and tannins are antioxidants with various pharmacological effects such as anti-inflammatory, antibacterial, and anti-Eimeria effects (Miao and Xiang, 2020; Jing et al., 2022). Liu et al. (2022) found that chlorogenic acid was added to feed improved the reduction of growth performance caused by Eimeria, reduced OPG, decreased inflammatory cytokines in peripheral serum (IL-6 and TNF-α), and enhanced the body's immunity (IL-10 and IgA) and antioxidative capacity (T-AOC, CAT, SOD, and GSH-Px). Studies in the field of anti-Eimeria activity have found that tannins can protect the intestinal health, reduce damage caused by Eimeria infected, and improve the growth of broiler chickens (Choi et al., 2022). Magnolol is also a good antioxidant with many applications in poultry production, exhibiting anti-inflammatory and antioxidant effects (Ranaware et al., 2018). Total Magnolol can also inhibit intestinal injury and enhance gene expression of intestinal tight junction proteins (ZO-1, Claudin-1, and Occludin), which can improve egg production efficiency and reduce feed conversion ratio (Chen et al., 2021). Studies in poultry have also shown that Magnolol is a good growth-promoting feed additive that enhances the meat quality of poultry by modulating the antioxidant level (Du et al., 2021; Lin et al., 2021). However, Magnolol is less studied in the field of Eimeria infection. In this work, after E. tenella infected, we observed heightened the pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, and IFN-γ) and indicators of oxidative stress (NO and MDA), coupled with reduced antioxidant enzymes (T-AOC, SOD, CAT, and GSH-Px). Following the administration of Magnolol intervention, the proinflammatory cytokines and oxidative stress indicators were significantly (P < 0.05) downregulated, whereas those of antioxidant enzymes and anti-inflammatory cytokines were found to be increased. The results revealed Magnolol can reverse the trend that E. tenella infected causes (P < 0.01) decreased antioxidant and immunity, and increased inflammation.

Nrf2 is a classical antioxidative stress transcription factor (He et al., 2020). A study showed that (Xie et al., 2022) Magnolol intervened in broiler chickens has been found to activate Nrf2/NQO1/HO-1 signaling pathway, which would upregulate the antioxidant enzymes (GSH, SOD, and T-AOC) in serum and reduce MDA, and achieved good antioxidant effects to enhance the growth performance of broiler chickens. ChTLR15 is one of the avian-specific toll-like receptors (Boyd et al., 2012), and coccidia infection has been shown to elevate ChTLR15 (Zhou et al., 2013). NLRP3 is involved in innate immunity, which is an important protein complex and involved in the formation of inflammation (Wang and Hauenstein, 2020). E. tenella infection has been found to upregulate ChTLR15 and activate ChNLRP3/ChIL-1β signaling pathway to mediate the inflammatory response in the chick organism (Li et al., 2021). In this study, Magnolol was observed to activate the Nrf2/Keap1/HO-1 signaling pathway in chicks, leading to an increase of antioxidant enzymes and a decrease of oxidative stress-related indices. Additionally, Magnolol was proved to inhibit the inflammatory signaling pathway like ChTLR15/Myd88/NF-κB/NLRP3/Caspase-1. These results were further corroborated by the downregulation of inflammatory cytokines and upregulation of antioxidant enzymes in serum, thus confirming the effects on the inhibition of ChTLR15/ChNF-κB/ChNLRP3 and activation of Nrf2/keap1/HO-1 by Magnolol.

Eimeria infection disrupts the intestinal microbiota by increasing the abundance of potentially pathogenic microbiota while decreasing that of beneficial microbiota in the gut (Huang et al., 2018; Jebessa et al., 2022). Chen et al. (2020) reported that broiler chickens infected with E. tenella were increased the abundance of Lactobacillus, Faecalibacterium, and Ruminococcaceae UCG-013 while decreased Romboutsia and Shuttleworthia. Meanwhile, Enterococcus and Streptococcu were also increased gradually. It has also been demonstrated that Eimeria infection disrupted the mucosal immune barrier of the cecum, leading to shedding of the intestinal mucosa, which not only provided a nutritional basis for harmful microbiota but also promoted the fermentation of protein, so that there was an increase in harmful substances like hydrogen sulfides and nitric oxide (Gilbert et al., 2018). Escherichia–Shigella is a potential pathogenic bacterium in the intestinal tract (Rico-Martínez, 1995; Ahmed and Shimamoto, 2014). Liu et al. (2020) reported a positive correlation between an increase in Escherichia–Shigella in the chicken intestine and NLRP3 inflammatory vesicles in vivo, which can cause inflammation in the organism. Additionally, it has been demonstrated (Yang et al., 2021) that Escherichia–Shigella becomes the dominant intestinal microbiota in chicks infected with necrotizing enteritis. Firmicutes, Blautia, Lachnospiraceae, Ruminococcaceae, and others are beneficial intestinal microbiota in the intestine (Kubasova et al., 2019; Suvorov et al., 2022), which could produce short-chain fatty acids, such as butyric acid that provide energy to intestinal cells and enhance intestinal barrier function and immune regulation. The results of this study demonstrated that the diversity of intestinal microbiota in chicks infected with E. tenella decreased, and the abundance of pathogenic microbiota such as Escherichia–Shigella increased and the abundance of beneficial microbiota including Lachnospiraceae, Ruminococcaceae, and Blautia decreased (Figures 5C and 5E). These findings were consistent with those previous studies (Chen et al., 2020; Choi and Kim, 2022). However, after Magnolol intervened, there was a decrease in pathogenic microbiota and an increase in beneficial microbiota (Figure 5F). Additionally, spearman correlation analysis revealed a positive correlation between pathogenic microbiota and pro-inflammation cytokines, as well as a positive correlation between beneficial microbiota and antioxidant enzymes. Moreover, the analysis showed that probiotics in chickens were closely related to antioxidant and anti-inflammatory properties. Magnolol intervened may have antioxidant and anti-inflammatory effects that inhabit the growth of pathogenic microbiota, thus protecting the health of the intestinal tract.

CONCLUSION

In this work, E. tenella-infected chicks with Magnolol resulted in significant improvements in FCR, OPG, cecum lesion scores, and the bloody feces. Magnolol intervened increased antioxidant related indices, immunoglobulins, and anti-inflammatory cytokines, as well as decrease oxidative stress related indices and pro-inflammatory cytokines. Furthermore, Nrf2/keap1/HO-1 antioxidant signaling pathway was activated, while the ChTLR15/ChNF-κB/ChNLRP3 was suppressed treated with Magnolol. These findings were consistent with the serum results and suggested that Magnolol may increase the ability of antioxidation and decrease inflammation development during E. tenella infection in chicks by activating Nrf2/keap1/HO-1 and inhibiting ChTLR15/ChNF-κB/ChNLRP3. Magnolol could decrease the abundance of potentially pathogenic microbiota and increase beneficial microbiota to rebound the diversity of intestinal microbiota. Additionally, pathogenic microbiota was positively correlated with pro-inflammation cytokines, while beneficial microbiota was positively correlated with antioxidant enzymes. The above results indicated that Magnolol intervened may alter the microbial community, leading to increased diversity and a shift towards a more beneficial composition, which may contribute to the decrease in inflammation and increase in antioxidant activity.

In conclusion, Magnolol showed an effective treatment to improve E. tenella-infected chicks, which are strongly proved that Magnolol may be a potential drug for the treatment of E. tenella infection. However, we have not yet determined the direct effect of Magnolol on E. tenella, and subsequent experiments are needed to explore.